ID: 922164123

View in Genome Browser
Species Human (GRCh38)
Location 1:223100786-223100808
Sequence ACTTCAGGAGGGACTCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922164123_922164129 4 Left 922164123 1:223100786-223100808 CCACAGAGAGTCCCTCCTGAAGT No data
Right 922164129 1:223100813-223100835 CCTAGTGAAGCTGTGAGAAGAGG No data
922164123_922164130 5 Left 922164123 1:223100786-223100808 CCACAGAGAGTCCCTCCTGAAGT No data
Right 922164130 1:223100814-223100836 CTAGTGAAGCTGTGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922164123 Original CRISPR ACTTCAGGAGGGACTCTCTG TGG (reversed) Intergenic