ID: 922164123

View in Genome Browser
Species Human (GRCh38)
Location 1:223100786-223100808
Sequence ACTTCAGGAGGGACTCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922164123_922164130 5 Left 922164123 1:223100786-223100808 CCACAGAGAGTCCCTCCTGAAGT No data
Right 922164130 1:223100814-223100836 CTAGTGAAGCTGTGAGAAGAGGG 0: 91
1: 1845
2: 2087
3: 1298
4: 1004
922164123_922164129 4 Left 922164123 1:223100786-223100808 CCACAGAGAGTCCCTCCTGAAGT No data
Right 922164129 1:223100813-223100835 CCTAGTGAAGCTGTGAGAAGAGG 0: 91
1: 1759
2: 2078
3: 1412
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922164123 Original CRISPR ACTTCAGGAGGGACTCTCTG TGG (reversed) Intergenic
No off target data available for this crispr