ID: 922165951

View in Genome Browser
Species Human (GRCh38)
Location 1:223115982-223116004
Sequence CAGTAAGAGCAGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 888
Summary {0: 1, 1: 0, 2: 9, 3: 96, 4: 782}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922165951 Original CRISPR CAGTAAGAGCAGAGAGAAGA GGG (reversed) Intronic
900034400 1:394946-394968 CACAATGAGCAGAGACAAGACGG - Intergenic
900055232 1:624834-624856 CACAATGAGCAGAGACAAGACGG - Intergenic
901158979 1:7160549-7160571 CACAAAGAGAAGAGAGAAGGTGG - Intronic
902105552 1:14032966-14032988 CAGTAAGACCAGGGTGCAGAGGG - Intergenic
902559508 1:17268098-17268120 CAGTAAGAACAGTCAGAAGTGGG + Intronic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903278633 1:22237427-22237449 AAGTAAGAGGGCAGAGAAGAGGG - Intergenic
903315229 1:22498479-22498501 AAGAAAGAGCAGAGAGAGCAGGG + Intronic
904199566 1:28811263-28811285 CAGTGCGAGCAGATAGAAGGGGG - Intergenic
904583386 1:31564522-31564544 CAGCAAGAGCAAAGACAAGGAGG - Intergenic
904594416 1:31634116-31634138 CAGTAAGGACAGAGGGAAAAAGG + Intronic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905724062 1:40233485-40233507 AAGTAAGAGCAGAGAGGACTTGG - Intronic
905968036 1:42115944-42115966 TAGTCAGAGCAGAGGGAACAAGG + Intergenic
906084448 1:43119494-43119516 CTTTGAGAGCTGAGAGAAGAAGG - Intergenic
906281385 1:44556543-44556565 CAGGAAGAGCAGACAGGAAAAGG - Intronic
906598379 1:47101397-47101419 CAGTAAAAGCAGTGCTAAGATGG - Intronic
906835382 1:49078193-49078215 GAGTAGGAGGAGAGAGAAGCAGG + Intronic
906970337 1:50506913-50506935 CAGTAATGGCAGGAAGAAGAAGG - Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907356170 1:53875876-53875898 ATTTAATAGCAGAGAGAAGAAGG - Intronic
907451046 1:54546087-54546109 TAGAAAGCGCAGAGAGGAGAGGG + Intronic
907705532 1:56829171-56829193 GAGGAAGAGCAGGGAGGAGAAGG - Intergenic
907718297 1:56948273-56948295 CAGTAAGAGATGAAAGAACATGG + Intronic
908720109 1:67116446-67116468 CAGGGAGAGCAAACAGAAGAAGG - Intronic
909109730 1:71459583-71459605 TAGTAAGAGCAAAGAGATAAAGG - Intronic
909162017 1:72164035-72164057 AAGTAAAAGCAGAAACAAGAAGG + Intronic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
909331582 1:74418940-74418962 CAGCAACAGCAGAAACAAGAAGG - Intronic
909875441 1:80797066-80797088 CCCTAACAGAAGAGAGAAGAAGG - Intergenic
910342323 1:86202315-86202337 CAGTAAGAGCAGGACAAAGAAGG - Intergenic
910354701 1:86341448-86341470 CAGTTAAACCAGAGAGAAAAAGG - Intergenic
910554592 1:88517402-88517424 GAGGAAGAGAAGAAAGAAGAAGG + Intergenic
910554594 1:88517424-88517446 GAGGAAGAGAAGAAAGAAGAAGG + Intergenic
910554596 1:88517446-88517468 GAGGAAGAGAAGAAAGAAGAAGG + Intergenic
910627981 1:89328421-89328443 CATTAAAAGCAGAGTGTAGAGGG + Intergenic
911128251 1:94361677-94361699 CAAGAAGTGCAGAGCGAAGAGGG + Intergenic
911292834 1:96079110-96079132 CAGTCAAGGCAGAGAAAAGAAGG - Intergenic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
911753900 1:101530608-101530630 CAGAAAGAGCTGAGAGGAAAAGG + Intergenic
912267251 1:108171089-108171111 AATGAAGAGTAGAGAGAAGAGGG - Intronic
912671090 1:111625757-111625779 GAGGAAGAGAAGAGAGAAAAAGG - Intronic
912703369 1:111894909-111894931 CAGGAAGAGGAAAGAGGAGAAGG + Intronic
912839908 1:113030242-113030264 AAGTAAAAACAAAGAGAAGAAGG - Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913387697 1:118277772-118277794 GGGTTAGAGCAGAGGGAAGAAGG + Intergenic
913612600 1:120523179-120523201 GAGTGAGAGCTGAGAGGAGAGGG + Intergenic
914331518 1:146675045-146675067 CAGTAAGAGAAGAAAGAGAAAGG - Intergenic
914576828 1:148979499-148979521 AAGAAAAAGCAGAGAGAAGCTGG - Intronic
914578591 1:148999069-148999091 GAGTGAGAGCTGAGAGGAGAGGG - Intronic
914958322 1:152184541-152184563 AAGTAAGAGGAGAGAGCAAAAGG + Intergenic
915669969 1:157479963-157479985 CAGTAAGAAAGGAGAGAAAAGGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916452152 1:164931104-164931126 GAGTGAGAGCAGAGAGAGTAGGG - Intergenic
916970392 1:170007269-170007291 CAGAAAGAGGAGAGAATAGAAGG + Intronic
917130617 1:171738728-171738750 ATGAAAGAGCAGAGAGTAGAGGG + Intronic
917329601 1:173868225-173868247 GAGGAAGAGCAGAGAGGGGAGGG + Intronic
917912876 1:179669266-179669288 CAGTCAGAGCAGTCAGCAGACGG + Exonic
918179504 1:182074157-182074179 AAGAAAGAGGAAAGAGAAGAGGG + Intergenic
918318919 1:183346380-183346402 CAGTAAGAGCAGAGATACGGAGG - Intronic
918925728 1:190782927-190782949 CAGTAATATCATAGAGAAAAAGG + Intergenic
918940033 1:190981807-190981829 CAAAAAAAGCAGACAGAAGAAGG - Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919430057 1:197481359-197481381 CAGTGAGTGCAAAGAGAAGCAGG + Intergenic
919630668 1:199957406-199957428 CAGTAATAATATAGAGAAGAAGG - Intergenic
920523085 1:206643802-206643824 CAGCAAGAGAAGAGAGAAAAGGG + Intronic
920606522 1:207393959-207393981 TAGCAAGAGCAGGGAGGAGAAGG - Intergenic
920610317 1:207429705-207429727 CAATAAGAGAAGAGAGAAAATGG + Intergenic
920783756 1:209020553-209020575 CAGTGAAAGCAGCCAGAAGAGGG + Intergenic
920926093 1:210343226-210343248 CAGAAAGAGCAGGGAGGAGGAGG - Intronic
921300459 1:213746680-213746702 TAGCAGGAGGAGAGAGAAGATGG + Intergenic
921305689 1:213794354-213794376 GAGAAAGGGCAGAGAGGAGAAGG - Intergenic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
921365213 1:214367345-214367367 CACTGAAAGCAGAGAGTAGAAGG - Intronic
921559090 1:216635207-216635229 GAGAAAGAGCAGAGAAGAGAGGG + Intronic
921684753 1:218076991-218077013 CAGTGAGAACAGATATAAGAAGG - Intergenic
922088861 1:222376639-222376661 CAGGGAGAGCTGTGAGAAGATGG - Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922590205 1:226769858-226769880 AAGGAAGAGCTCAGAGAAGATGG + Intergenic
923332451 1:232937879-232937901 CAGCCAGAGCAGAGAGACAAAGG - Intergenic
923904665 1:238370548-238370570 CAGTATGGGAAGAGAGTAGAGGG - Intergenic
923957300 1:239037457-239037479 CAATAAGTGAAAAGAGAAGAAGG + Intergenic
924089443 1:240487277-240487299 CAGCAGGAGCCGGGAGAAGAAGG + Intergenic
924337953 1:243001969-243001991 CACAATGAGCAGAGACAAGACGG - Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1062975928 10:1682680-1682702 TAGCAAGACCAGAGAGCAGAGGG + Intronic
1063367704 10:5501029-5501051 CAGGCAGAGCAGTGAGAGGAGGG + Intergenic
1064304427 10:14152582-14152604 CATTAAGAATAGAGAGAAGCCGG + Intronic
1064767957 10:18694178-18694200 CAGTCAGAGCCTAGAGGAGAAGG - Intergenic
1065773251 10:29096889-29096911 CAGTAAGAGAGTAGACAAGAAGG - Intergenic
1066230149 10:33424259-33424281 CAGTCAGACCATAGAGAGGATGG - Intergenic
1067012973 10:42731775-42731797 CAGAAACAGCAGACAGCAGAGGG - Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1068303465 10:55175781-55175803 AAGAAAGAGGAGAGAGAAAAAGG + Intronic
1068559233 10:58494533-58494555 CAGGAAGAAGAGAGAGAAGGGGG + Intergenic
1068613184 10:59083213-59083235 CACAAAGAGCACAGAGAAAATGG - Intergenic
1070268034 10:74923718-74923740 TAGTAAGAGGTGAGAGCAGATGG + Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070737608 10:78875023-78875045 CACGAAGAGAAGAGAGATGAGGG - Intergenic
1071888131 10:89972722-89972744 CAATGGGAGCAGAGAGGAGAAGG + Intergenic
1072591322 10:96831391-96831413 GAGAACGAGAAGAGAGAAGATGG - Intergenic
1073473346 10:103737513-103737535 CAGTAAGGGCAGGGAGGGGAAGG + Intronic
1073959083 10:108905142-108905164 GAGTAAAAACAGAGAGAAGAGGG + Intergenic
1074467147 10:113693336-113693358 CAGAAGGAGCAAAGAGAAAAGGG - Intronic
1074728565 10:116342815-116342837 CAGGAAGAACAGAGAGAAGCAGG - Intronic
1075415846 10:122263315-122263337 CAGAAAGAGAAGAGAGAAAAGGG - Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076388139 10:130074153-130074175 CAAAAAGAGCAGAAAGCAGAGGG + Intergenic
1076731819 10:132442962-132442984 CAGGCAGAGCAGAGGCAAGAAGG - Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077202220 11:1315852-1315874 CAGCAAAAGCAGAGCTAAGAGGG - Intergenic
1077934993 11:6774228-6774250 GAGTAAAGGCAGAGAGAATAGGG - Intergenic
1078671153 11:13366887-13366909 CAGAAAGAGGACAGAGAAGTAGG - Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1079087836 11:17460028-17460050 CTGTCAGAGGAGAGAGAAGTGGG - Intronic
1079201289 11:18379525-18379547 CTCTAAGAGCAGAGAAAACAGGG - Intergenic
1079364987 11:19801307-19801329 CAGTCAGTGCAAAGAGGAGAGGG - Intronic
1080175999 11:29363903-29363925 AAATAATAGGAGAGAGAAGAGGG + Intergenic
1080318217 11:30974224-30974246 CAGTAAAAGCAGTGCTAAGAGGG + Intronic
1080672762 11:34396053-34396075 CAATCAGAGAAAAGAGAAGATGG + Intergenic
1080922327 11:36721463-36721485 CAGTGAGAGCAGTGAGAGAAGGG - Intergenic
1081104582 11:39049199-39049221 CATTAAGATCAGAAAGAAGATGG + Intergenic
1081165931 11:39809307-39809329 TAGTAAAAGAAGAGAGAAGAAGG + Intergenic
1081633122 11:44702759-44702781 TAGAAACAGCAGAGAGATGAGGG + Intergenic
1081733777 11:45389699-45389721 TAGTAAGGGAAGAGAGTAGACGG - Intergenic
1082728118 11:56761371-56761393 CAGAAGGAGAAGAGAGTAGATGG - Intergenic
1082749119 11:56998943-56998965 CAGTTGGAGCACAGAGAAGAAGG + Intergenic
1082751722 11:57026114-57026136 CAGAGAGAGCTGAGAGAAAATGG - Intergenic
1082758091 11:57097817-57097839 CAGCCAGAGGACAGAGAAGATGG + Intergenic
1083250545 11:61464015-61464037 CAAGAAGAGGAGAGAGGAGAGGG - Intronic
1083470257 11:62879624-62879646 AAGTAATAGCATAGAGAAAAGGG - Intronic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084011942 11:66356227-66356249 CAGTAAGAGCAGTGCTTAGAGGG - Intronic
1084279306 11:68076771-68076793 CAGAAAGGACATAGAGAAGAGGG + Intronic
1085560860 11:77472421-77472443 CTGTAAGAGGAGAGACAGGATGG + Intronic
1085663768 11:78394384-78394406 AAAGAAGAGCAGAGATAAGAGGG + Intronic
1085801202 11:79591326-79591348 CAGACAGTGCAGGGAGAAGAAGG + Intergenic
1087304840 11:96476365-96476387 CAGTAAAAGCAGTGCTAAGAGGG + Intronic
1087359888 11:97144884-97144906 AAGTAAGAGGAGTGAGAGGATGG + Intergenic
1087430011 11:98041631-98041653 AAGAAAGAGCAGGCAGAAGAAGG - Intergenic
1087882848 11:103439134-103439156 CAGTAAGAGAAGAGTGATAAAGG + Intronic
1087945315 11:104153100-104153122 CAGGAAGAGCAGATAAGAGAAGG - Intronic
1088325459 11:108596239-108596261 CAAGAAGAGTAGAGTGAAGATGG + Intergenic
1088548086 11:110981860-110981882 GAGAAAGAGAAAAGAGAAGAGGG + Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088977705 11:114830474-114830496 CAGCAAGAGCAAAGACAAGGAGG + Intergenic
1089079456 11:115763718-115763740 CAGGAAGAGTGGAAAGAAGAGGG - Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089148182 11:116345564-116345586 CAGTAGGATGAGAGAGAAGAGGG - Intergenic
1089191687 11:116658575-116658597 CCGTAAGTGGGGAGAGAAGAGGG - Intergenic
1089590304 11:119536026-119536048 GAGCAGGAGAAGAGAGAAGAGGG + Intergenic
1090310668 11:125734412-125734434 CAGAAAGAGTAGAGAGAAAAGGG - Intergenic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090401851 11:126454161-126454183 CAATAATAGGAAAGAGAAGAAGG - Intronic
1091015334 11:132045835-132045857 CAGAAAGAGCTCAGAGAAAAGGG - Intronic
1091053400 11:132395718-132395740 CTGGAAGAGAAGAGAGATGATGG + Intergenic
1092021945 12:5210142-5210164 CAGTAAAAATAGAGAAAAGATGG - Intergenic
1092517690 12:9232925-9232947 TAGTAAGAGAAGACCGAAGAAGG + Intergenic
1093820509 12:23611808-23611830 GAGTAAGGGTAGAGAGAGGATGG - Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1095196854 12:39329421-39329443 CACTAAGAACAAAGAGAAGGAGG + Intronic
1096718769 12:53506176-53506198 CAGAAAGAGCAGGGAGCAAAGGG - Exonic
1096848680 12:54421454-54421476 CAGAAAGAGCCAAGAGAGGAGGG - Intergenic
1097064377 12:56309997-56310019 CAGCAAGAACAGAGACAGGAAGG - Exonic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1097894440 12:64810266-64810288 CTGTAAGAACAGAGAAAACATGG - Intronic
1098572498 12:72004714-72004736 TAGCAAAAGCAGAAAGAAGATGG + Intronic
1098967881 12:76812288-76812310 CAGTTAAAGCAGAGTGATGATGG - Intronic
1099163943 12:79278505-79278527 CAGCAAGAGCAGAGCTAAGAGGG + Intronic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1099860148 12:88216128-88216150 CAGCAAGAGCAGCGGTAAGAGGG + Intergenic
1100283050 12:93137039-93137061 CAGTGAGAGAAGAGACAAAACGG + Intergenic
1101147658 12:101856223-101856245 CAGGAAGTGCAGAGTGAAGGTGG - Intergenic
1102459078 12:113089185-113089207 GAGAAAGAGCAGAGAGACCAGGG + Intronic
1102518955 12:113467473-113467495 CAGTCAGGGAAGGGAGAAGAGGG - Intronic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103460779 12:121103246-121103268 CAGAAGCAGCAAAGAGAAGAGGG + Intergenic
1103585683 12:121953304-121953326 TAGTCAGAGCTGAGACAAGAAGG + Intronic
1103898741 12:124292265-124292287 TAGGAAGGGCAGAGGGAAGAAGG - Intronic
1104176128 12:126334491-126334513 CAGTTACACCAGAGAGAAAATGG - Intergenic
1104223374 12:126807773-126807795 GAGTAAGAACAGACAGAATAGGG + Intergenic
1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG + Intergenic
1105246755 13:18659756-18659778 GAGTCAGAGTAGAGTGAAGAAGG - Intergenic
1105634442 13:22203779-22203801 CTGCAAGAGCATAGAGAATATGG + Intergenic
1105639995 13:22252512-22252534 CCGCAAGAGCACAGAGATGACGG - Intergenic
1106079128 13:26486016-26486038 CAGAAGGAACAGAGAGAACAGGG + Intergenic
1106576285 13:30978874-30978896 CAAAGAGAGCAGAGAGATGATGG - Intergenic
1106618309 13:31350702-31350724 AAGGAAGGACAGAGAGAAGATGG - Intergenic
1106694224 13:32153978-32154000 CACTAAGGGCAGAAATAAGATGG - Intronic
1106864204 13:33945958-33945980 CAGTAAGATCAGAAAGCAAAAGG - Intronic
1107346885 13:39471437-39471459 AAGTGAGAGCAGAAACAAGAGGG + Intronic
1108579571 13:51817213-51817235 GAGAAAGAGGAGAGAGAGGAAGG + Intergenic
1108758825 13:53537716-53537738 CAGAAAGAAAAGAGAGAAGGGGG - Intergenic
1108760547 13:53558013-53558035 CAGCAAGGGCAGAGAGAAATTGG + Intergenic
1109098312 13:58145404-58145426 CAGGCAGAGCTGTGAGAAGAGGG + Intergenic
1109140250 13:58705694-58705716 CAGGAAGGGAAGAGAGATGAAGG - Intergenic
1109188590 13:59299184-59299206 GAGGAGGAGCAGGGAGAAGAGGG + Intergenic
1109333243 13:60958360-60958382 TAGAAAAAGCAGACAGAAGAAGG + Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1109848602 13:68031430-68031452 TAGTAAAAGCAGAGACCAGATGG + Intergenic
1110714061 13:78681930-78681952 CAGGAAGAGCAAGGAGAAAAAGG + Intergenic
1111915048 13:94351939-94351961 CAAGGAGAGGAGAGAGAAGAAGG + Intronic
1112158775 13:96847171-96847193 AAGGAAGAGCAGAGAGGAGGAGG + Intergenic
1112189451 13:97162079-97162101 GAGGAAGAGGAGAGAGAAGGTGG + Intergenic
1112201601 13:97281945-97281967 CAGTAAGAGCAGTTACGAGAAGG - Intronic
1112563924 13:100536319-100536341 CAGAAAGAGAACAGAGAGGAAGG - Intronic
1112769982 13:102784218-102784240 CAGTAAAAACAGAGAGAATCTGG - Intergenic
1113258041 13:108528781-108528803 AAGAGAGAGAAGAGAGAAGAGGG - Intergenic
1113491970 13:110699329-110699351 CACAAAAAGCAGAGAGAACAGGG + Intronic
1113818186 13:113190114-113190136 CAGAAAGAGAAGAGAAAAAATGG + Intronic
1114416601 14:22549034-22549056 CAGTTGCAGCAGAGAGATGATGG + Intergenic
1114719772 14:24868792-24868814 TAGTAAAAACAGAGAGAAAAGGG + Intronic
1114832131 14:26157309-26157331 CAGAAGGAGAAGAGAGATGAAGG - Intergenic
1114832182 14:26157724-26157746 TCTTAAGAGCAGAGAGAGGATGG - Intergenic
1114937582 14:27561966-27561988 GAGTAAGAGCTGCAAGAAGATGG - Intergenic
1115089731 14:29559354-29559376 CAGGAAGATCATAGAGAGGAGGG + Intergenic
1115434671 14:33359156-33359178 GAGGAACAGGAGAGAGAAGAGGG + Intronic
1116043612 14:39715999-39716021 CATTAAGAGCAAGGGGAAGAGGG - Intergenic
1116918039 14:50544297-50544319 TAGTAAGGACAGAGAAAAGAGGG - Intronic
1117291040 14:54333016-54333038 CAGGAAGAGCAAAGAGCAGCAGG + Intergenic
1117350489 14:54876847-54876869 CAGTAAGAGAAGAGACAGAAGGG + Intronic
1117732603 14:58738796-58738818 CAGAAAGAACGGACAGAAGAAGG + Intergenic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119606029 14:76018198-76018220 CAGCAAAAGCAGAGCCAAGAGGG - Intronic
1119907970 14:78322749-78322771 AAGCACGAGCAGAGATAAGACGG - Intronic
1120129457 14:80787879-80787901 CAGTAAGTCCAGAGACAGGATGG + Intronic
1120221848 14:81743170-81743192 CATCAAGAGCAAAGAGAAGATGG - Intergenic
1120975022 14:90240834-90240856 AAGGAAGTTCAGAGAGAAGAGGG - Intergenic
1121108953 14:91299404-91299426 CAGTAGGAGCTGAAACAAGAAGG + Intronic
1121209830 14:92199898-92199920 CAAGAAGAGCAGAGAGGAGAGGG + Intergenic
1121876849 14:97460680-97460702 CCTTCAGGGCAGAGAGAAGATGG + Intergenic
1122089080 14:99326265-99326287 CAGGCAGAGGAGAGAGGAGAGGG - Intergenic
1122632746 14:103114473-103114495 CAGGAAGACTAGAGATAAGAAGG - Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1123144910 14:106119662-106119684 AAGAAAGAGCAGTGAGAAGGAGG + Intergenic
1123911177 15:24969001-24969023 AAGTAAGAGCAGAGAGGAATTGG + Intronic
1125027319 15:35043937-35043959 AAGTAACAGCACTGAGAAGAAGG - Intergenic
1125200613 15:37098268-37098290 GAAAAAGAGCAGGGAGAAGAGGG + Intronic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1126354154 15:47777114-47777136 CAGTTAGAGCAGTGGTAAGAAGG + Intergenic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1126538447 15:49794906-49794928 GAGCAAGAGCTGAGAGAAGTAGG + Intergenic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1127566499 15:60194280-60194302 CAGGAAGAGGAGAGGGAACAGGG - Intergenic
1127705814 15:61546340-61546362 CAGGAAGGGCTTAGAGAAGAGGG - Intergenic
1128764075 15:70240362-70240384 CAGGAAGAACAGGGAGAAGTGGG - Intergenic
1129053823 15:72805851-72805873 CAGTAAGAGAACAGAGAACTTGG - Intergenic
1129146669 15:73654201-73654223 GAGTAAGATCAGGGAGAAAATGG + Intergenic
1129452747 15:75659915-75659937 CAGAAAGAAAAGAGAGAGGAGGG - Exonic
1129682942 15:77668322-77668344 CACTAAAGCCAGAGAGAAGAGGG + Intronic
1130392593 15:83472300-83472322 CAATAAGAGAAGGGAAAAGAAGG - Intronic
1130607120 15:85327956-85327978 CAATAAAGGCAGAGATAAGATGG - Intergenic
1130836390 15:87654013-87654035 CACCAAGAGTAGAGATAAGAAGG - Intergenic
1130956003 15:88628052-88628074 CAGTAAGAGTAGCAACAAGAGGG + Intronic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1131603282 15:93872201-93872223 GTGAGAGAGCAGAGAGAAGAGGG - Intergenic
1131755470 15:95556077-95556099 CTCTAAGAGCAGAAAGAAAAGGG - Intergenic
1132337195 15:101055590-101055612 CAGGAGGAGCAGACAGAATAAGG + Intronic
1132375140 15:101323857-101323879 CAGTAAGGGCCCAGAGAGGAGGG + Intronic
1132541995 16:514523-514545 CTGAAAGGGCATAGAGAAGATGG + Intronic
1133047377 16:3096310-3096332 CAGGAAGGGCAGAAAGCAGAGGG - Intronic
1133174072 16:4000587-4000609 CAGTAAGAACAGACAGCAGATGG + Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1135352463 16:21740582-21740604 GAGTAAAAGCAGAGAGCAGGAGG - Intronic
1135450951 16:22556704-22556726 GAGTAAAAGCAGAGAGCAGGAGG - Intergenic
1135681980 16:24465253-24465275 CAGGAAGAAGAGAGAGAAGGGGG + Intergenic
1136232404 16:28894410-28894432 CAGGAAGAGCAGGCAGCAGAGGG - Intronic
1136481654 16:30545799-30545821 CAGTTAAATCAGAGAGAAAAAGG + Intronic
1137362779 16:47834860-47834882 CAGAAGGAGAAGAGAGAAAAAGG + Intergenic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1137509880 16:49089930-49089952 GAGGAAGAGCAGAGAGGAGATGG - Intergenic
1137715547 16:50596107-50596129 CAGTGAGAGCAGTGAGAAGCAGG + Intronic
1138008940 16:53360364-53360386 CAGTCAGATCAGAAAGAAGGGGG + Intergenic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138493100 16:57388378-57388400 GAGGAAGAGGAGAGAGAAGGAGG - Intergenic
1139080806 16:63518069-63518091 CAATAATAGCATAAAGAAGATGG - Intergenic
1139284168 16:65796029-65796051 CAATAAGGGCAGAGAGAAGCAGG - Intergenic
1139301054 16:65945666-65945688 CAGTCAGAGCAGTGAGCACAGGG - Intergenic
1139706941 16:68747307-68747329 CAGAAAGAGGAGGGAGGAGAGGG + Intronic
1140002036 16:71035855-71035877 CAGTAAGAGAAGAAAGAGAAAGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140644652 16:77016240-77016262 CAGAAGGTGCAGAGAGTAGATGG + Intergenic
1140740193 16:77934714-77934736 GAGTTAGAGCAGAGAACAGAGGG + Intronic
1141267478 16:82509910-82509932 CAGAAAGAGCAAGGAGAAGCTGG - Intergenic
1141485593 16:84337757-84337779 CAGTCAGACGAGAGAGAAAAAGG + Intergenic
1141862759 16:86729234-86729256 CAGGAAGATCAGACAGGAGAAGG - Intergenic
1142081095 16:88149215-88149237 CAGGAAGAGCACAAAGAAGCGGG - Intergenic
1143424409 17:6822436-6822458 CAGAAAGAGCATAGAGAAAATGG - Intronic
1143936389 17:10489695-10489717 CAGAAGGAGAAGAGAGAAAAAGG - Intergenic
1144266417 17:13573859-13573881 CAGAGAGAGCAGAGAGAAGGAGG - Intronic
1144376716 17:14650197-14650219 TGGTAAGAGCAGGGAGAAGAGGG + Intergenic
1145981934 17:29017998-29018020 CAGAAAGAGCAGGGACAAGAGGG - Intronic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146112423 17:30102069-30102091 CAGCAAGAGGACAGAGAACATGG + Intronic
1146673677 17:34758579-34758601 GAGGAAGAGGAGAAAGAAGAAGG + Intergenic
1146866399 17:36338632-36338654 AAGTAATAGGAGAGATAAGAGGG + Intronic
1147035952 17:37680998-37681020 CAGGAGGAGGAGAGAGAAGGGGG - Intergenic
1147069269 17:37939244-37939266 AAGTAATAGGAGAGATAAGAGGG + Intergenic
1147080797 17:38018781-38018803 AAGTAATAGGAGAGATAAGAGGG + Intronic
1147096740 17:38142741-38142763 AAGTAATAGGAGAGATAAGAGGG + Intergenic
1147241043 17:39090703-39090725 CAGTCGGGGCAGAGAGAAAAGGG - Intronic
1147562387 17:41517053-41517075 CAGGAAGAGGAGAGAGACGGGGG + Intronic
1147608118 17:41785704-41785726 CAATAAGAGGTTAGAGAAGACGG + Intronic
1148080628 17:44966199-44966221 CAGGCAGAGGAAAGAGAAGAAGG + Intronic
1148473781 17:47913406-47913428 CAGTAAGTACAGAAATAAGAGGG - Intronic
1148521048 17:48275273-48275295 CAGGGAGATCAGAGAGAATAAGG - Intronic
1149611017 17:57957692-57957714 CTGGAAGAGCAGAGACAATAGGG - Intergenic
1149775654 17:59354892-59354914 CAGTGAGAGAAGAGAGGAGTTGG + Intronic
1149845068 17:60004226-60004248 AAGTAATAGGAGAGATAAGAGGG - Intergenic
1149890135 17:60381727-60381749 AAGTAATAGGAGAGATAAGAGGG - Intronic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1152249027 17:79201959-79201981 CAGTAACTGTAGAGAGAAGGTGG - Intronic
1153397756 18:4643919-4643941 GAATCAGAGTAGAGAGAAGAGGG + Intergenic
1153811334 18:8754569-8754591 CAGTAATGTCAGAGAGAAAAGGG + Intronic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154236785 18:12613459-12613481 CTAAAGGAGCAGAGAGAAGAAGG - Intronic
1154442102 18:14399366-14399388 GAGTCAGAGTAGAGTGAAGAAGG + Intergenic
1155036579 18:22029818-22029840 CAGTGAGAGCCGAGAGAAGGGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155709569 18:28859241-28859263 AAGTAAGAGAAGAGAGAAAAAGG - Intergenic
1155724433 18:29062004-29062026 CAGAAAGAGAAGAGTGAAGAAGG - Intergenic
1155901218 18:31393493-31393515 CAGTAGCAGAAGAGAGAAGGGGG + Intronic
1156037204 18:32778135-32778157 GAGAAAGAGCAGAGAGAACAAGG + Intergenic
1156151725 18:34251070-34251092 CAGGAAGAAGAGAGAGAATAGGG + Intergenic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1156658265 18:39313457-39313479 CAGCAAGAGGAGAGGGGAGAAGG - Intergenic
1156958776 18:42997447-42997469 AAGAAAGAAGAGAGAGAAGAAGG + Intronic
1157321314 18:46636672-46636694 CAGTAACAGGAGAGAGTAAAGGG - Intronic
1157439197 18:47697134-47697156 CAGACAGGGCACAGAGAAGAGGG - Intergenic
1157482538 18:48064764-48064786 CAATAGGAACAGGGAGAAGAAGG + Intronic
1158175186 18:54648402-54648424 CAAGAAGAGAAGAGAAAAGAAGG - Intergenic
1158317943 18:56232175-56232197 AAGGAAAAGAAGAGAGAAGAAGG + Intergenic
1158483795 18:57846509-57846531 CATTCAGAGCAGAGAGGAGAGGG + Intergenic
1158485216 18:57860145-57860167 CAGAAAGAGAAGAGAGAGAAAGG - Intergenic
1159738016 18:72127678-72127700 AAGTAAGAAAAGAGAAAAGAAGG - Intergenic
1160008306 18:75084750-75084772 CAAAACGAGCAGAAAGAAGACGG + Intergenic
1160111940 18:76041346-76041368 CAGTAAGAGCAGAATTAATATGG + Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1162516198 19:11149283-11149305 CAAGGAGAGCAGAGAGAAGGTGG + Intronic
1163377553 19:16942787-16942809 CAGAAAGAGCACAGAGACAAAGG - Intronic
1164465401 19:28483362-28483384 GAGAAAGAGGAGAGAGAAGAGGG - Intergenic
1164551517 19:29216460-29216482 AAATAAGAGCAGAGCGAAGGGGG + Intergenic
1164814136 19:31181408-31181430 CCATCTGAGCAGAGAGAAGAAGG + Intergenic
1165100553 19:33436194-33436216 AAGGAAGAGGAAAGAGAAGAGGG + Intronic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1166500584 19:43338082-43338104 CAGGAAGGGCAGACAGAAAAGGG - Intergenic
1166665340 19:44676441-44676463 CAGTGGGAGCAGACAGGAGAGGG - Intronic
1167373747 19:49100400-49100422 CAGCAAGAGAAGGGAGGAGATGG - Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
1167636399 19:50658479-50658501 CGGTGAGATCAGAGAGAAGGAGG + Intronic
1167640790 19:50680275-50680297 CAGGAAGAGCCCAGAGAGGAAGG + Intronic
1167755973 19:51414099-51414121 TAGAAAGAGCAGAGAGCAGGAGG + Intronic
925439358 2:3870536-3870558 TTGTCAGAGCTGAGAGAAGAAGG - Intergenic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
927151590 2:20199372-20199394 CAGCACGATCTGAGAGAAGATGG + Intergenic
928650275 2:33396663-33396685 TTGTAAGACCAGAGAGAAGCAGG - Intronic
928910629 2:36417227-36417249 CAGTAGGGGAAGAGAGAAGAGGG - Intronic
929241491 2:39658211-39658233 CAAGAAGGGCAGAGAGAAAACGG - Intergenic
930036821 2:47091089-47091111 AAGAAAGAACAGAGAGAGGAAGG + Intronic
930062654 2:47303147-47303169 GAGTAAGAGCACAGAGATCAAGG + Intergenic
931087217 2:58846014-58846036 CAGTCAGGGCAGGGAGGAGAAGG - Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
933202544 2:79467034-79467056 CTTTAAGAGTTGAGAGAAGAAGG + Intronic
933894263 2:86796417-86796439 CATCAAGAGTAAAGAGAAGAGGG + Intronic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
935606762 2:104979373-104979395 CAGCGAGAGCAGAGTGAACAAGG - Intergenic
935631415 2:105215585-105215607 CAGTAAGAGCAGAGGCTACAAGG - Intergenic
935789302 2:106576272-106576294 CGGTAAGAACAGAGAGGAGAAGG + Intergenic
935975833 2:108577841-108577863 CGGTAAGAGGAGAGAACAGATGG - Intronic
936629504 2:114186519-114186541 CAGGAAAAGGAGAGAGAAGCAGG - Intergenic
936630631 2:114199071-114199093 GTGTAAGAGCAGTGAAAAGAAGG - Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
937329114 2:121013540-121013562 CAGTGAAAGCAGTGATAAGAGGG + Intergenic
937419555 2:121742301-121742323 CAGTAGGAGAACAGAGAAAAGGG - Intronic
937800970 2:126079841-126079863 CAGAAAAAACAGAGAGAAGGAGG + Intergenic
937995127 2:127688218-127688240 CAGTAACAGCACAAAGGAGATGG - Intergenic
940125571 2:150319795-150319817 CTGAAAGTCCAGAGAGAAGAAGG - Intergenic
941101802 2:161304825-161304847 CAGTAACAGAAGGGAGAGGAAGG - Intergenic
941602602 2:167561295-167561317 CAGTCAGAGCAGTGTGTAGACGG + Intergenic
941641016 2:167988445-167988467 CACTAAGATCAGAAAGATGATGG - Intronic
941674792 2:168332212-168332234 CAGTAAAAGCAGTGCTAAGAAGG + Intergenic
941827443 2:169916407-169916429 GAGTCAAAGCAGAGAAAAGAGGG - Intronic
941898520 2:170655260-170655282 CAGTCACAGTATAGAGAAGACGG + Intergenic
942160658 2:173182891-173182913 CAGTAACAGAAGTGAGGAGATGG + Exonic
942409235 2:175690553-175690575 CAGTAATAACAGAGAAATGAAGG - Intergenic
942516403 2:176757965-176757987 CAGTAAGAGCCAAGCAAAGAGGG - Intergenic
943076947 2:183207296-183207318 GAGGAAGATCAAAGAGAAGAGGG - Intergenic
944075311 2:195723025-195723047 CAGAAACTGCAGAGAGAAAAAGG - Intronic
944157563 2:196623321-196623343 CAACACCAGCAGAGAGAAGAGGG - Intergenic
944218561 2:197279612-197279634 CAGCAAGGGAAGAGAGAAAAAGG - Intronic
944364276 2:198898260-198898282 AAGGAAGAAAAGAGAGAAGAAGG + Intergenic
944737575 2:202581696-202581718 CAGCAAAAGCAGTTAGAAGAGGG - Intergenic
945112031 2:206369109-206369131 CAGTCAGAGCACACTGAAGAGGG + Intergenic
946110643 2:217412351-217412373 AAGCAAGTGGAGAGAGAAGATGG + Intronic
946214084 2:218170128-218170150 AAGAAAGTACAGAGAGAAGATGG - Intergenic
946421607 2:219568162-219568184 AAGTACGAGCAGATCGAAGAGGG - Exonic
947090472 2:226504661-226504683 AAGCAAGAACAGAGAGAAAAGGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947435593 2:230069326-230069348 CAGAAAGAGCAGGGAGAGGTGGG - Intergenic
947701161 2:232235155-232235177 CATTTAGAGCAGAGAGAGGAAGG - Intronic
948183062 2:235998375-235998397 CAGGAACAGGAGTGAGAAGATGG + Intronic
948741382 2:240048766-240048788 GACTAAGAGGAGAGAGAAGAGGG - Intergenic
948742426 2:240056668-240056690 CAGGAAGAGCAGAGAGGAGGAGG + Intergenic
948842661 2:240662730-240662752 CAGTAAGAGCACAGTTAGGAGGG - Intergenic
1168994702 20:2124499-2124521 TATTAAGAGCAGAGAGATCATGG + Intronic
1169352306 20:4878913-4878935 CAAAAAGATCAGAGAGGAGAGGG - Intronic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1169928273 20:10805763-10805785 CATTAAGAGCAGCCAGAAGCAGG - Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170014792 20:11768497-11768519 CAGGAACAGGAGAGAGAAGAGGG + Intergenic
1170375208 20:15692593-15692615 CTGGAAGCGCAGAGAAAAGAAGG + Intronic
1171105743 20:22430764-22430786 CAGAAAGACAAGAGAGAAGTAGG + Intergenic
1171129510 20:22637784-22637806 CAGTAATAGCATAAAGGAGAGGG - Intergenic
1171365165 20:24618053-24618075 CAGGAAGAGCCGGGGGAAGAGGG + Intronic
1171465683 20:25326140-25326162 AAGAAAGAGAAGAGAGAGGAAGG + Intronic
1172361624 20:34316624-34316646 CCGTAGGAGCAGAGAGAAGGAGG + Intergenic
1172652280 20:36512349-36512371 CAATAAGATCAGAGAGACAAGGG - Intronic
1172897636 20:38311738-38311760 CAGTTAGAGCTCAGAGGAGAGGG + Intronic
1173128364 20:40362167-40362189 CAGGAAGAGAACAGAGAGGATGG + Intergenic
1173377145 20:42496165-42496187 GAGGAAGAGGAGAAAGAAGAGGG + Intronic
1173475312 20:43354995-43355017 CAGAAAAATCAGAGAGAAAAAGG + Intergenic
1173546647 20:43903064-43903086 CAGTAAGAGCAAAGACAGGGTGG - Intergenic
1174059670 20:47823840-47823862 AAATAAGTGCAGAGAGAACAGGG - Intergenic
1174508992 20:51036901-51036923 CAGCAAGATCAGAGAGAGGAAGG - Intergenic
1174600351 20:51719255-51719277 CAACAAGAGCAGAGAGGACAAGG + Intronic
1176453969 21:6891806-6891828 GAGTCAGAGTAGAGTGAAGAAGG - Intergenic
1176832144 21:13756854-13756876 GAGTCAGAGTAGAGTGAAGAAGG - Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1176920604 21:14683599-14683621 GAGAAAGAGAGGAGAGAAGAAGG + Intergenic
1177418759 21:20828015-20828037 CAGCAAGAGCACAAAGATGATGG + Intergenic
1177593133 21:23199956-23199978 CAGAAAGAGAAAAGAGAACAAGG - Intergenic
1177928351 21:27248196-27248218 GAGGAGGAGGAGAGAGAAGAAGG - Intergenic
1177944674 21:27452960-27452982 CAGTAAGCTAAGAGAGAAAATGG + Intergenic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1178748217 21:35274223-35274245 GAGCAAGAGCAGAGTGAACAAGG - Intronic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179353864 21:40640372-40640394 TGGTAAGGGCAGAGACAAGAGGG - Intronic
1179432496 21:41333457-41333479 CAGAAACAAGAGAGAGAAGAGGG - Intronic
1180124065 21:45775985-45776007 CAGCAAAAGCAGAGCTAAGAGGG - Intronic
1181528718 22:23503969-23503991 CAGGAAGGGCAGTGAGAAGGCGG - Intergenic
1181719361 22:24761989-24762011 CAGTAAGAGAAGACAAAACAGGG + Intronic
1181735713 22:24879918-24879940 CAGAAAGAGCAGAAAGAGTAAGG + Intronic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1182747665 22:32617881-32617903 CAGAAACAGCATAGAGGAGAAGG - Intronic
1183170557 22:36184668-36184690 CAGGAGGAGAATAGAGAAGAGGG - Intergenic
1183354556 22:37351207-37351229 GAGGGAGAGAAGAGAGAAGAGGG - Intergenic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1183907109 22:41049825-41049847 GAGTAAGGGCTGAGAGAGGAAGG + Intergenic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1185181210 22:49364475-49364497 CAGGAAGGGCAGGGAGGAGAGGG - Intergenic
1185199688 22:49494092-49494114 CAGTTGGAGCAGAGAGCAGAGGG + Intronic
949147885 3:725565-725587 CTGCAAGGGCAGAGTGAAGAGGG - Intergenic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
949554199 3:5138636-5138658 CAGTAAGCGCAGTAAGAAGTTGG - Intronic
949717780 3:6953237-6953259 CAGTTAGAAGACAGAGAAGAGGG + Intronic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
949996906 3:9625110-9625132 CAGAAAGTGGAGACAGAAGAGGG - Intergenic
950063731 3:10094007-10094029 GAGTGAGAGCATAGAGTAGAGGG - Intronic
950118162 3:10464535-10464557 CAGGCAGAGAAGAGAGGAGAGGG - Intronic
950344306 3:12278483-12278505 TAGTAAGAGGAGGTAGAAGAGGG - Intergenic
950349046 3:12328730-12328752 CAGGAAGGGAAAAGAGAAGAGGG - Intronic
950566569 3:13772960-13772982 CAGAAAGAGCAGAGACAGGCAGG - Intergenic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
950847977 3:16033295-16033317 GAGGAAGAGGAGAAAGAAGAGGG + Intergenic
951182213 3:19671852-19671874 CATTGAGAGCAAAGAGAAGGAGG - Intergenic
951206838 3:19934332-19934354 GAGACAGAGGAGAGAGAAGAGGG - Intronic
951243749 3:20316548-20316570 CATTTGGAGCAGAGACAAGATGG + Intergenic
952002003 3:28796823-28796845 GGCCAAGAGCAGAGAGAAGAGGG + Intergenic
952225221 3:31368396-31368418 CATTAAGAGCAGTGACAAAATGG - Intergenic
952269351 3:31817038-31817060 CAGCCAGAGCAGGGAGAGGATGG - Intronic
952482532 3:33776245-33776267 GAGAAAGAGGAGAAAGAAGAAGG - Intergenic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
954285667 3:49617381-49617403 CAGGAAGGGCAGAGAGATGAAGG - Intronic
954389797 3:50262739-50262761 CAGTAAGGTCAGAAAGCAGAAGG - Intergenic
954416897 3:50397731-50397753 CAGAAAGAGCAGATAGCAGCAGG - Intronic
954505699 3:51070702-51070724 CAGTATCAGCTGAGAAAAGATGG - Intronic
954692515 3:52403188-52403210 CACGGACAGCAGAGAGAAGACGG - Exonic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
955035639 3:55264567-55264589 GAGGATGAGGAGAGAGAAGAAGG + Intergenic
955444468 3:58994751-58994773 CAGGAAGAGGAGAGAAAGGATGG + Intronic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
956303698 3:67801225-67801247 CAGCAAAAGCAGTGATAAGAGGG - Intergenic
956689217 3:71860720-71860742 CTGTAATAGCAAAGAGAATAAGG + Intergenic
956693108 3:71895832-71895854 AACTGAGAGTAGAGAGAAGATGG + Intergenic
956848962 3:73210868-73210890 CATTAGGAGCAGAGAGAGGCAGG + Intergenic
957123958 3:76133771-76133793 GAATAAAAGCAGATAGAAGAAGG - Intronic
957161348 3:76613577-76613599 CCCTAAGTGCAGAGAGAAGACGG + Intronic
957174344 3:76786468-76786490 CAGAAAGAAGAGAGAGAAGGGGG + Intronic
957434507 3:80156399-80156421 AAGTAAGAGCAGAGCAAAGAAGG - Intergenic
957925139 3:86799385-86799407 CAGAAAGAACATAGAGAAAAGGG - Intergenic
958472646 3:94540839-94540861 GAGTAAGAACTGATAGAAGAAGG - Intergenic
958665047 3:97126845-97126867 CAGTAAGAGCATAAAGAAGATGG + Intronic
958985481 3:100775778-100775800 CAATAAGAGCTGAGAGTGGAAGG + Intronic
958988598 3:100813727-100813749 CAGTCAGAGCTGAAAGAAGAGGG + Intronic
959191405 3:103116314-103116336 CAGTAAAAGCAGTAATAAGAAGG + Intergenic
959257286 3:104031376-104031398 TACTCAGAGCACAGAGAAGAGGG + Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
960128501 3:114027101-114027123 CTGTAAGATCAAAGAGAAAATGG + Intronic
961106976 3:124250490-124250512 GAGTAAGAGAAGAGAGCTGAGGG - Intronic
961491754 3:127261275-127261297 CAGCAAGAGCAGGGAGGAGCAGG - Intergenic
961745827 3:129062887-129062909 GAGAAAAAGGAGAGAGAAGACGG - Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
961924670 3:130465205-130465227 GAGTCAGAGCTGAGAGAACAGGG + Intronic
962491798 3:135901807-135901829 CAGCATGAGCAAAGATAAGAAGG + Intergenic
962611962 3:137085231-137085253 AAGAAAGAGTAGAGAGAAGCAGG + Intergenic
962867315 3:139458411-139458433 CAGTAAGGGCAGGGAAAAGCAGG - Intronic
963617425 3:147559415-147559437 GAGGAAGAGGAGAGAGAAGCGGG - Intergenic
964177654 3:153844285-153844307 CAGTAAGAGAAGATAAAGGAAGG + Intergenic
964329377 3:155585234-155585256 TGGTAAGAGCAGAGACAACATGG - Intronic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
965158031 3:165089524-165089546 GAGCAGGAGCAGAGAGAAGAAGG + Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966183983 3:177212078-177212100 CAATCAGAACAGAGAGCAGAGGG + Intergenic
966244325 3:177789799-177789821 CTATAAAAGCAGAGAGGAGAGGG + Intergenic
966310935 3:178593021-178593043 AAGTACGAGCAGAGGGAAGGGGG + Intronic
967347446 3:188473692-188473714 AAGAAAGAGCAGAGAAATGAGGG - Intronic
967674032 3:192274568-192274590 AAGAGAGAGGAGAGAGAAGAGGG + Intronic
967906746 3:194507787-194507809 GAGGAAGAGCAGCGAGGAGAGGG - Intergenic
968426221 4:525145-525167 CAGGATGAGGAGAGAGAAAAGGG - Intronic
968449857 4:670023-670045 CTGCAAGAGAAGACAGAAGATGG - Intronic
969072221 4:4548644-4548666 AAGTAAGTGCAGAGAGAGGAAGG + Intergenic
969511265 4:7619351-7619373 CAGTAAGTCCAGGGAGCAGAGGG + Intronic
969796498 4:9532014-9532036 GGGTAAGAGCAAAGACAAGATGG + Intergenic
970136685 4:12932870-12932892 CATTTAGCCCAGAGAGAAGAGGG - Intergenic
970820446 4:20205631-20205653 CAGTTAAAACAGAGAAAAGAGGG + Intergenic
971074947 4:23137298-23137320 CAGTCAGAGCTGAAATAAGAAGG - Intergenic
971145615 4:23973164-23973186 CAGGAAGGGCAGGAAGAAGAAGG + Intergenic
971239144 4:24872049-24872071 AAGGAAGAGCAAAGTGAAGAAGG + Intronic
971311565 4:25529913-25529935 AAGAAAGAGAGGAGAGAAGAAGG + Intergenic
972331833 4:38071160-38071182 CAGTAAGAGCAGGGACAGGAGGG - Intronic
972846642 4:42999442-42999464 CAGTATGTGCAGTGACAAGATGG - Intronic
972982251 4:44720115-44720137 AACTCAGAGCAGAGAAAAGATGG + Intronic
972985724 4:44762201-44762223 GTTTAATAGCAGAGAGAAGATGG + Intergenic
973066551 4:45801806-45801828 CACTAAAAGCGGAGAGAAAAAGG - Intergenic
973094045 4:46175170-46175192 CAGAAAGGGAAGAGAGAAGGAGG + Intergenic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
973853839 4:54990044-54990066 CAGTAAAAGCAGTGCTAAGAGGG + Intergenic
974074296 4:57154834-57154856 CAGGGAGAGGAAAGAGAAGAGGG - Intergenic
974769314 4:66389967-66389989 CAGTAAGAGGACACAGATGATGG - Intergenic
974869881 4:67628195-67628217 AAGTAAGAGCAAAGAAAAGAAGG - Intronic
975156489 4:71078651-71078673 GAGTATGAGCTGAGCGAAGAAGG - Intergenic
975655927 4:76641316-76641338 GAGGATGAGCAGGGAGAAGATGG - Intronic
975934677 4:79564352-79564374 CTGGAAGGGCAAAGAGAAGAAGG + Intergenic
976025058 4:80677095-80677117 CAGTAAGAGCAGTGCTAAGAGGG - Intronic
977398258 4:96498665-96498687 TAGAAAGAGCAGAGGGAAGGAGG + Intergenic
977400638 4:96527115-96527137 ATTTAAGAACAGAGAGAAGAAGG + Intergenic
977578240 4:98697515-98697537 TAGCAAGAGCAGGGAGAAGGAGG - Intergenic
977597789 4:98902470-98902492 CATTAAGAGCAAAGAGCAAACGG + Intronic
977734479 4:100396909-100396931 AAGGAAGAGAGGAGAGAAGAAGG - Exonic
978099213 4:104816320-104816342 CAGGAAGAACAGAGATGAGAGGG + Intergenic
979239170 4:118433324-118433346 CACAATGAGCAGAGACAAGACGG + Intergenic
979533689 4:121795768-121795790 TAGAAAGAGCAGGGAGAAGGAGG + Intergenic
980447046 4:132922894-132922916 CAATAAGACCAGAGAGAGGTAGG - Intergenic
981221011 4:142234913-142234935 CATAAAGAGAAGAGAGAAGAGGG + Intronic
981282847 4:142979421-142979443 CAGTAAGAGCAGAGTGAAGCAGG + Intergenic
981321354 4:143395839-143395861 GAGTAAGTGAAGAAAGAAGAAGG + Intronic
981341615 4:143628123-143628145 AAGTAAGGGCAGAGAAAAAATGG - Intronic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
982429901 4:155310911-155310933 CAGTAACTAGAGAGAGAAGAGGG + Intergenic
982617351 4:157656063-157656085 CAGTAAGAGGAAAGAGATGAAGG + Intergenic
983473816 4:168190168-168190190 CAGTAAAAGCAGTGCTAAGAAGG + Intergenic
984090465 4:175368321-175368343 CTGAAAGGGCAGAGAGAAAATGG - Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984324725 4:178237519-178237541 CATTAAGAGTAGAAAGAAAATGG + Intergenic
984510950 4:180678155-180678177 CAGTAAGCGTGGAGAAAAGAAGG - Intergenic
984887011 4:184458038-184458060 CAGCAAGAGCAAAGACATGAAGG - Intronic
985117289 4:186604870-186604892 GAGGAAGAGCAGAGAGGAGGAGG + Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985817293 5:2136247-2136269 CAGAAACAGCTGAGAGTAGAAGG - Intergenic
986150905 5:5129743-5129765 CAGCAAGGGCAGAGGGCAGATGG - Intergenic
986372817 5:7097831-7097853 CAATTGGAGGAGAGAGAAGAGGG + Intergenic
987281463 5:16418230-16418252 CAGGAACAGGAGGGAGAAGAGGG + Intergenic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
988326824 5:29779361-29779383 CCATAAAGGCAGAGAGAAGATGG + Intergenic
988436781 5:31185097-31185119 CAGTAAGAATATAGAGAAAAGGG + Intergenic
988788359 5:34584683-34584705 CAGCAACAGCAGAGAGCAAAAGG - Intergenic
989083288 5:37649151-37649173 CAGGCAGAGAGGAGAGAAGAAGG + Intronic
989226106 5:39030914-39030936 CACCAAGAGGACAGAGAAGAAGG + Intronic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
990238719 5:53795686-53795708 CAGATGGAGCAGGGAGAAGATGG - Intergenic
990279126 5:54231046-54231068 CAGAAAGAGCAGGGGAAAGAGGG - Intronic
991089618 5:62681477-62681499 CAGAAAGAGTAAAGAGAACATGG + Intergenic
991226165 5:64275659-64275681 CAGGGAGAAAAGAGAGAAGAAGG - Intronic
991258194 5:64638279-64638301 CAGGAGGAGCAGTGACAAGATGG + Intergenic
991272648 5:64803291-64803313 AAGAAAGAGGGGAGAGAAGAAGG - Intronic
991939156 5:71833420-71833442 CAGAAAAAGAAGAGAGGAGAGGG - Intergenic
992143716 5:73824385-73824407 TAGAAAGAGCTCAGAGAAGAAGG + Intronic
992301751 5:75389169-75389191 CAGTAAGAGAAGGGAAAAGAAGG + Intronic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
993084158 5:83342477-83342499 CATCAAGAGCAGGAAGAAGATGG - Intronic
993108579 5:83627834-83627856 GAGTGAGAGGAGAGAGAACAGGG - Intergenic
993245236 5:85442686-85442708 TAGTAAAAGCAGGGAGAAAAGGG + Intergenic
993295350 5:86131529-86131551 CAGTAACACCAGAGAGAGTAAGG - Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
993722780 5:91338044-91338066 GAGAAAGTGCAGAGAGCAGAGGG + Intergenic
993805066 5:92397056-92397078 CAGTAAGATCAGAGATAAGTTGG - Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994266307 5:97720941-97720963 CATTAAAAGCAGTGTGAAGAGGG - Intergenic
994905715 5:105839220-105839242 AAGTAGGAGCTGTGAGAAGAGGG - Intergenic
994985538 5:106928433-106928455 CAGAAAGAGCTGGGGGAAGATGG + Intergenic
995716160 5:115083572-115083594 TAGAAAGAGAAGTGAGAAGAAGG + Intergenic
995735851 5:115298373-115298395 GAGAAGGAGAAGAGAGAAGAAGG + Intergenic
996390434 5:122954962-122954984 GAATAAGAGGAGAAAGAAGAAGG - Intronic
996429502 5:123356585-123356607 GATTAAAAGGAGAGAGAAGAAGG - Intronic
997341038 5:133144780-133144802 ATGTAAGAGCAGAGAGGACAGGG + Intergenic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
997606950 5:135182037-135182059 CAGTATGAGCTGAGACAAGAAGG + Intronic
997894059 5:137700052-137700074 CAGTCAGAGAAGAGAGAACAGGG - Intronic
998217065 5:140245488-140245510 CAGGAAGGGAAAAGAGAAGAGGG + Exonic
998495824 5:142588473-142588495 GAGAGAGAGAAGAGAGAAGAGGG - Intergenic
999283069 5:150377451-150377473 CTGGAAGAGCTGAGAGAAGATGG + Intronic
999378759 5:151105308-151105330 TAGGAAGAGCAGAGAGATGCGGG + Intronic
1000094412 5:157958557-157958579 CTGTAAGATCAGAGAGGACAAGG - Intergenic
1000153908 5:158531741-158531763 AAGAAAGAGGAGAGAGGAGAGGG + Intergenic
1000229801 5:159304986-159305008 CAGTAAGAGAAGGCAGAACAGGG - Intergenic
1000668941 5:164035756-164035778 AAGAAAGAGCAGAGAAAGGAAGG - Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001041550 5:168339268-168339290 CTCTAAGAGCAGAGGGATGAGGG + Intronic
1001765366 5:174241735-174241757 CAGCAAGATCTGGGAGAAGAGGG + Intronic
1002739420 5:181423922-181423944 CACAATGAGCAGAGACAAGACGG + Intergenic
1002949956 6:1800028-1800050 CAGTAAGGGAAGAGAGCAGGAGG + Intronic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1003091716 6:3109426-3109448 AAGGAAGATCAGAGACAAGAGGG + Intronic
1003272541 6:4620112-4620134 CACTACGAACAGAAAGAAGAGGG + Intergenic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005351980 6:24945592-24945614 CAATAACAGCACAAAGAAGAGGG + Intronic
1005433405 6:25782213-25782235 CAGTAAGTGGAGAAAGAAAAAGG + Intergenic
1005566766 6:27103792-27103814 AAGTAAGTGCAGAGCAAAGAGGG - Intergenic
1005893928 6:30162454-30162476 CAGGAAGAGCAGAGATTGGATGG + Intergenic
1006151841 6:31994046-31994068 CACTAAGAGCAAAGGGAACAGGG - Intronic
1006158142 6:32026784-32026806 CACTAAGAGCAAAGGGAACAGGG - Intronic
1006176746 6:32127152-32127174 GAGGAAGAGCAGGGGGAAGATGG + Exonic
1006245092 6:32726494-32726516 CTGAAAGAGAAGAGAGAAAAAGG + Intergenic
1006266649 6:32931345-32931367 GCCTAAGAGCAGAGGGAAGAGGG + Intergenic
1007054808 6:38872015-38872037 CAGTAAGAGAAGAGGAAAGCAGG - Intronic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1008043659 6:46829660-46829682 AAGGAGGAGGAGAGAGAAGAAGG - Intronic
1008631407 6:53365936-53365958 CTGTAAGAGCAGTCAGAAGGAGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008914776 6:56775143-56775165 CAGGAAGAACAGAAAGAACAAGG + Intronic
1009349054 6:62651941-62651963 AAGAAAAAGCAGAGAGAAGAGGG - Intergenic
1009371477 6:62908712-62908734 TAGAAATAGCAGACAGAAGAAGG + Intergenic
1010147586 6:72689241-72689263 GAGTAAGAGCAGAGACAAGGGGG + Intronic
1010887756 6:81264282-81264304 TAGGAAGAAAAGAGAGAAGAAGG + Intergenic
1011253174 6:85394328-85394350 CAGTAGAAGCAGAGAGGAAATGG + Intergenic
1011371313 6:86639827-86639849 AAGAAGGAGGAGAGAGAAGATGG + Intergenic
1011570961 6:88734328-88734350 TATTAAGAGAAGAGAGAAAATGG + Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012144852 6:95668602-95668624 CAGGAACAGCAGTGAGAAGAAGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012621985 6:101356412-101356434 AACTAAGAGCAAAGAGAAGAAGG - Intergenic
1012858763 6:104533843-104533865 GAGAGAGAGGAGAGAGAAGAGGG - Intergenic
1013114415 6:107090625-107090647 CAATAAGACAAGGGAGAAGAGGG + Intronic
1013752759 6:113426229-113426251 GAGTAATTGCAGAGAGAAAATGG - Intergenic
1013967437 6:115971898-115971920 GACTAAGAGCAGAGAGAAGAGGG + Intronic
1014072231 6:117196062-117196084 CAGTAATAGGAAGGAGAAGAAGG - Intergenic
1014269035 6:119315045-119315067 CAGAAAGAGGAAAGAGAAGCTGG - Intronic
1015090258 6:129347389-129347411 CATTCAGAGGAGAGAGGAGAAGG + Intronic
1015138209 6:129898417-129898439 CAGTATGAGAAAAGAAAAGATGG + Intergenic
1015891390 6:137973206-137973228 AATTAAGAGAAGAAAGAAGAGGG + Intergenic
1016527075 6:145013789-145013811 AAGTAAGATTAGAGAGAAGAAGG - Intergenic
1016758579 6:147713817-147713839 GAGTAAGGGAGGAGAGAAGAGGG - Intronic
1017885732 6:158597978-158598000 GAGTAAGAGCTGATACAAGAGGG - Intronic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1018141771 6:160844909-160844931 CAGTTAGCCCAGAGAAAAGATGG - Intergenic
1018304844 6:162444138-162444160 CAGCAGGTGCAGTGAGAAGACGG - Intronic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019244531 6:170699481-170699503 CACAATGAGCAGAGACAAGACGG + Intergenic
1019254838 7:42815-42837 CAGTAAAAACAGAGAAAAGGTGG + Intergenic
1019917802 7:4144651-4144673 CAGGAAGAGCTGAGAGAGGGAGG + Intronic
1020610899 7:10396610-10396632 CAGTAATCGCTGAGAGAAGGTGG - Intergenic
1020858786 7:13461871-13461893 CAGTAAGAGCACAGACTTGAAGG - Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022292444 7:29017208-29017230 CAAAATGAGCAGAGAGAATATGG - Intronic
1022838226 7:34136978-34137000 CAGAGAAAGCAGAGAGCAGAGGG + Intronic
1023018195 7:35986388-35986410 AAGTGAGAGGAGGGAGAAGAAGG + Intergenic
1023119192 7:36892381-36892403 CAGGAAGAGCACAGAGGAGTTGG - Intronic
1023330019 7:39105088-39105110 CATCAAGAGCAGAGGGCAGATGG + Intronic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024693098 7:51824295-51824317 CAGTGGGAGCAAAGAGAATATGG - Intergenic
1024757451 7:52552291-52552313 GAGTGAGAGCTGAGCGAAGAGGG - Intergenic
1025033483 7:55575610-55575632 CTGGAAGAGCAGTGAGGAGATGG + Intergenic
1025235236 7:57230148-57230170 AAATAAGTGCAGAGAGAACAGGG + Intergenic
1025241528 7:57280420-57280442 CAGGAAGAGCAAAGCAAAGAAGG + Intergenic
1025242840 7:57292196-57292218 CCATAACAGCAGAGAGAAGCTGG - Intergenic
1025713898 7:63936102-63936124 CAATAACAGCACAGAGAAGGTGG + Intergenic
1026128598 7:67601485-67601507 CAGTAAGAGCAGTGTGAACCAGG - Intergenic
1026166314 7:67912890-67912912 CAGGAAGAGCAAAGCAAAGAAGG + Intergenic
1026934090 7:74242087-74242109 CAGTAAGGTTAGAGAAAAGACGG + Intronic
1026962431 7:74417368-74417390 CAGGCAGAGCAAAGAGAAGTGGG - Intergenic
1027586181 7:80061681-80061703 CAGTAAGGAAAGAGAGAAGCAGG + Intergenic
1028063900 7:86356716-86356738 CAGCAAAAGCAGTGAGTAGAGGG + Intergenic
1029058066 7:97767461-97767483 CAATAACAGCAGAAGGAAGATGG - Intergenic
1030179830 7:106694769-106694791 GAGAAAGGGCAGAGAGAAGTGGG - Intergenic
1030463411 7:109869383-109869405 AGGAAAGGGCAGAGAGAAGAAGG - Intergenic
1030508649 7:110455944-110455966 GAGAGAGAGAAGAGAGAAGAGGG + Intergenic
1030625791 7:111844742-111844764 CTGTAAGATCATAGAGCAGATGG - Exonic
1030714836 7:112795537-112795559 AAGTAAGAGAACAGAGAAGATGG - Intergenic
1030714890 7:112796044-112796066 AAGTAAGAGAATAGAGAAGATGG + Intergenic
1031254014 7:119424828-119424850 CAGTAAAAGCAGTGCTAAGAGGG + Intergenic
1031998250 7:128246909-128246931 CAGGGAGTGCAGAGAGAAGTGGG + Intronic
1032501822 7:132405415-132405437 GAGTGAGATCAGAGAGAAAAGGG - Intronic
1032544214 7:132728351-132728373 TGGGAAGAGGAGAGAGAAGAAGG - Exonic
1032714823 7:134498570-134498592 CACTAAGACCAGAAAGAGGATGG - Intergenic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1033483519 7:141764871-141764893 AAGTAAGAAGAGAAAGAAGAAGG - Exonic
1033503022 7:141972880-141972902 CAGTAGGGGCACAGAGATGAAGG + Exonic
1033716496 7:144008445-144008467 CAGCCAGAGCAGTGAGAAAAGGG + Intergenic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1033838954 7:145350391-145350413 CTGTAAGATGAGAGAGAAAATGG - Intergenic
1034215069 7:149398794-149398816 CAGCAACTGCAGAGAGAAGACGG - Intergenic
1034312139 7:150098082-150098104 CAGTGAGTGCAGATAGGAGATGG - Intergenic
1034505782 7:151489626-151489648 TAGTAAGAGCAGAGACCAGGTGG - Intronic
1034697488 7:153066759-153066781 CACTGAGAGCAGAGAGAACCTGG + Intergenic
1034794716 7:154002576-154002598 CAGTGAGTGCAGATAGGAGATGG + Intronic
1034845792 7:154443271-154443293 CACTAAGAGAAGAGAAAAGCAGG - Intronic
1035503594 8:108691-108713 CACAATGAGCAGAGACAAGACGG - Intergenic
1035741361 8:1930602-1930624 CACTCAGAGCAGAGAGAACGGGG - Intronic
1035850635 8:2915819-2915841 GGGTAGGAGGAGAGAGAAGAAGG + Intergenic
1036307168 8:7611057-7611079 CGGTAAGAGCAAAGACAAGGTGG + Intergenic
1036359084 8:8065186-8065208 CGGTAAGAGCAAAGACAAGGTGG + Intergenic
1036511462 8:9404166-9404188 CAGCAAGAGCTGAGAGAACTTGG - Intergenic
1036521363 8:9494493-9494515 CAGTAAGAGCAGAAAGTAGATGG - Intergenic
1036803116 8:11807882-11807904 CAGTAAGAGGAGAGAGACCTCGG + Intronic
1036891874 8:12601766-12601788 CGGTAAGAGCAAAGACAAGGTGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037609031 8:20460899-20460921 TAGAAAGAGCAGAGTGAACAAGG - Intergenic
1038261545 8:26000393-26000415 CTGTAAGTGCAGAGACAACAGGG - Intronic
1038472413 8:27836533-27836555 GAGTAACTGTAGAGAGAAGAGGG + Intronic
1038918886 8:32059850-32059872 GAGAAAGAGAAGAGAGAAAATGG - Intronic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039143737 8:34421871-34421893 CAGAAAGAGCAGGGAGCAGGAGG + Intergenic
1039794882 8:40904307-40904329 GAGTAAGGGAATAGAGAAGAGGG - Intergenic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1039859637 8:41445922-41445944 GAGTAAGAGCTGAAACAAGAAGG - Intergenic
1039926745 8:41940907-41940929 CAGTGAGAGCAGCGAGGAGGAGG - Exonic
1040518050 8:48150526-48150548 CAGAATGAGCAGACAGATGAGGG - Intergenic
1040719301 8:50297793-50297815 AAGCAAAACCAGAGAGAAGAGGG + Intronic
1040860065 8:51989874-51989896 CACTTAGAGAAGAGAGCAGAGGG - Intergenic
1040889472 8:52301996-52302018 GAGCCAGAGCAGAGTGAAGATGG + Intronic
1041008317 8:53517012-53517034 CAGAAAGAGCACTAAGAAGAGGG + Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1041447142 8:57964770-57964792 CAGGCAGAGAAGAGAGAAAAGGG + Intergenic
1042469724 8:69171881-69171903 CAGTAAAAGCAGTGTGAAGAGGG - Intergenic
1042826066 8:72980788-72980810 CAGTAAGAGGACAGAGAAAAAGG - Intergenic
1043038892 8:75234002-75234024 CTGTAAGGGCAGAGAAAATATGG - Intergenic
1043277554 8:78418962-78418984 TAGGAAGAGAAGAGAGAATATGG + Intergenic
1043358252 8:79439323-79439345 CAGGAGGAGGAGAGAGAAGGGGG - Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044257182 8:90078392-90078414 CAGTATGGGCAAAGAGATGATGG - Exonic
1045099371 8:98829002-98829024 CTCTCAGAGCAGAGAGCAGATGG - Intronic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1045833840 8:106496732-106496754 CAGCAAGATCTCAGAGAAGATGG + Intronic
1046013394 8:108577063-108577085 CACTAAGAGCGGGAAGAAGAAGG - Intergenic
1046209811 8:111055861-111055883 CAGTTAAAGCAGTGATAAGAAGG - Intergenic
1046645766 8:116783795-116783817 CAGCATGAGCAGGCAGAAGAGGG - Intronic
1046687784 8:117246090-117246112 AAGAAAGAGGAGAGAGAAGAAGG + Intergenic
1048132924 8:131717512-131717534 AAAGAAGAGCAGAAAGAAGATGG + Intergenic
1048349237 8:133602611-133602633 CAGTGATAGCAGAAAGAAGAGGG + Intergenic
1048427374 8:134335346-134335368 CAGTAACAGCATAGGGAAGGGGG + Intergenic
1048531580 8:135254850-135254872 CAGAAGCAGCAGAGAGGAGAAGG + Intergenic
1048739941 8:137545333-137545355 CAGTAGGAGGTGAGAGTAGAGGG + Intergenic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050259649 9:3828061-3828083 CAGGAAAACCAGAGAGAAAAAGG + Exonic
1050842058 9:10162538-10162560 CAGAAAGGGTAGAGAGTAGAAGG + Intronic
1051342581 9:16125562-16125584 GAGCAAGAGTAGAAAGAAGAGGG + Intergenic
1051692992 9:19736276-19736298 CAGTAAGAGAAAACAGATGATGG + Intronic
1051752263 9:20355019-20355041 AAATAAGATTAGAGAGAAGAAGG - Intronic
1051810862 9:21048125-21048147 CAGGAACAGCAGAGCCAAGAAGG - Intergenic
1052583722 9:30395849-30395871 CAATAACAGCACAAAGAAGAGGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053278555 9:36801472-36801494 CAGGAAGAGCAAAGAGAAGATGG + Intergenic
1053518302 9:38751405-38751427 GAGCAAGAGCAGAGATTAGAGGG - Intergenic
1054729371 9:68685304-68685326 GATGAAGATCAGAGAGAAGAGGG - Intergenic
1055356997 9:75447947-75447969 CAGTAGCAGCAGAGAAGAGAAGG - Intergenic
1055525034 9:77124546-77124568 CTGGAAGGGCAAAGAGAAGAAGG - Intergenic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1056435423 9:86571103-86571125 CAGAAAAAGCAGGCAGAAGAAGG + Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1057055816 9:91959868-91959890 TATTAAGAACAGAGAGAAGCAGG - Intergenic
1057112492 9:92486585-92486607 CAGGAAGAGCTGTGAGGAGAGGG - Intronic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057173886 9:92980600-92980622 CAGTAAAAGCAGTGCTAAGAGGG - Intronic
1057256947 9:93557523-93557545 CAGTATGAGCTGAAACAAGAAGG + Intronic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1057416789 9:94870920-94870942 CAATCAGGGCAGAGAGAGGAGGG - Intronic
1057516609 9:95727278-95727300 CAGGAAGAGGAAAGAGAAGGGGG - Intergenic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1057717350 9:97505059-97505081 CATTAAGAGCAAAGAGAATTAGG - Intronic
1057722893 9:97547028-97547050 GAGAAAGAGCAGAGAGAATCTGG - Intronic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1059142078 9:111862938-111862960 CAGAAGGAGAAGAGAGAACAAGG - Intergenic
1059222560 9:112638690-112638712 CAGAAAGAGAAGAGAGAATGGGG - Intronic
1059266395 9:113035625-113035647 TAGTATGAGCAGAGATAAAAAGG - Intergenic
1059617824 9:115969856-115969878 TAGAAAGAGAAGAGAGAACATGG + Intergenic
1059635275 9:116164277-116164299 GAGTAGGAAGAGAGAGAAGAAGG - Intronic
1059901313 9:118929206-118929228 AAGAAAGAACAGAGAGTAGAGGG - Intergenic
1059917721 9:119122349-119122371 CAGTAAGAGCACAGGGAATAAGG - Intergenic
1059998731 9:119939242-119939264 GTGTAAGAGCAGAGAAGAGAAGG + Intergenic
1060049238 9:120365599-120365621 CAGAAAGGAGAGAGAGAAGAGGG + Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060385040 9:123218162-123218184 TAGTAAGAAGAGAGAGAAGGAGG - Intronic
1060619382 9:125049821-125049843 CATTATGAGCAGAGTGAAAAAGG - Intronic
1060730156 9:126031779-126031801 CAGAAAGAGGAGGGGGAAGAGGG + Intergenic
1060872751 9:127055937-127055959 CAGAAAGAGCAGTCAGAGGAGGG + Intronic
1060876083 9:127084516-127084538 CACAAAGAGCAGTGGGAAGAGGG - Intronic
1061255396 9:129452185-129452207 CAGGAAGGGCAGAGAGAAGGCGG + Intergenic
1203604719 Un_KI270748v1:48707-48729 CACAATGAGCAGAGACAAGACGG + Intergenic
1186337941 X:8611393-8611415 GAACAAGAGAAGAGAGAAGATGG + Intronic
1186392573 X:9175605-9175627 AAGTAAGATCAGAAAGCAGATGG - Intergenic
1186573173 X:10737662-10737684 AGGAAAGAGAAGAGAGAAGAAGG + Intronic
1186623512 X:11266618-11266640 CATGAAGAGCAGAGAGAAAAGGG + Intronic
1186932962 X:14414788-14414810 TAGTAGGGACAGAGAGAAGAGGG + Intergenic
1187025810 X:15434275-15434297 AAGAAAGAGGAGAAAGAAGAAGG + Intronic
1187195536 X:17080204-17080226 GAGAAAAGGCAGAGAGAAGAAGG - Intronic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187418106 X:19111015-19111037 TAGTAGGAGTAGAGAGAAGTGGG + Intronic
1187643255 X:21318286-21318308 CAGAAAGAGCAGAAAGAACATGG + Intergenic
1188168846 X:26895618-26895640 CAGCAAAAGCAGTGTGAAGAGGG + Intergenic
1188218049 X:27502994-27503016 AAGAAAGAGGAGAAAGAAGAGGG + Intergenic
1188939781 X:36223052-36223074 AAGTAAGAGAAGAGAGTAGGGGG - Intergenic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1189069797 X:37851235-37851257 CAGGAAGAAGAGAGAGAGGAGGG - Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189195317 X:39147616-39147638 AAGTAAGAGCACAGTGAAGGGGG + Intergenic
1189414363 X:40801774-40801796 CAGTTGGAGCACAGAGGAGAAGG + Intergenic
1189618803 X:42813825-42813847 CAGTTAGAGCAGTGTGTAGAGGG - Intergenic
1189642720 X:43090344-43090366 TAATAAGAGCAGAGAGACAAAGG - Intergenic
1190402633 X:50054202-50054224 CAGTCAAAGAAGAGAGTAGAGGG - Intronic
1190550025 X:51570417-51570439 CTGTTAGAGCAGAGGAAAGATGG + Intergenic
1191838991 X:65496473-65496495 CAGAAAAAGAAGAGAGAAAATGG + Intronic
1192040476 X:67615382-67615404 CAGAAATAACAGAGAGCAGAAGG + Intronic
1192097469 X:68227745-68227767 CAGTTAGAGCAGTGTGTAGAGGG + Intronic
1192318773 X:70072129-70072151 CAACCAGAGCAGAGACAAGAAGG + Intergenic
1192540962 X:71972438-71972460 CAGAAACAGCGGAGAGCAGAAGG - Intergenic
1192935193 X:75851285-75851307 CAGTAAGTGCAGAGCCCAGAGGG - Intergenic
1193258357 X:79376940-79376962 GAGGAAGAGGAGAAAGAAGAAGG + Intergenic
1193381139 X:80817628-80817650 CAATAACAGCAAAAAGAAGATGG + Intergenic
1193396730 X:80992144-80992166 CAGTAAGAGGAGACAAAAAAAGG + Intergenic
1194718644 X:97315105-97315127 CTTTAAGGGCAGGGAGAAGAAGG - Intronic
1194765436 X:97842775-97842797 CAGTAAGAGAAAAGGGAACATGG - Intergenic
1195123969 X:101786682-101786704 TAGAAAAAGCAGACAGAAGAAGG - Intergenic
1195146464 X:102022234-102022256 CAGGAAGAAGAGAGTGAAGAGGG - Intergenic
1195756608 X:108205058-108205080 GAGAAAGGGTAGAGAGAAGAGGG + Intronic
1195860763 X:109380527-109380549 CATTAAGAGGGAAGAGAAGAGGG - Intronic
1195999684 X:110768554-110768576 CAGAAAAAGCAGGTAGAAGAAGG + Intronic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196322593 X:114359587-114359609 GAGGAAGAGAAGAGAGATGAGGG + Intergenic
1196333627 X:114502930-114502952 CAGCAAAAGCAGAGCTAAGAGGG + Intergenic
1197005766 X:121495469-121495491 CAATGAAAGAAGAGAGAAGATGG - Intergenic
1198480746 X:137037641-137037663 AAGTGAGATCAGAGAGAGGAAGG - Intergenic
1198482491 X:137053483-137053505 CATTAAGAACACAGAGAAGGGGG - Intergenic
1198806346 X:140499251-140499273 CAGTGAGAACAGGTAGAAGAAGG + Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199907351 X:152246731-152246753 AAGTAAGAGCATAGAAGAGATGG - Intronic
1200345696 X:155445239-155445261 CAGCAAAAGCAGTGATAAGAGGG + Intergenic
1200808598 Y:7459123-7459145 GAGGAAGAGGAGAAAGAAGAAGG - Intergenic
1201433217 Y:13927321-13927343 AAGGAAGAGAAGAGAGAAAAAGG - Intergenic
1201570927 Y:15413598-15413620 CAGTAGGGTGAGAGAGAAGAAGG + Intergenic
1202386922 Y:24335115-24335137 CACAATGAGCAGAGACAAGACGG + Intergenic
1202483864 Y:25335013-25335035 CACAATGAGCAGAGACAAGACGG - Intergenic