ID: 922167897

View in Genome Browser
Species Human (GRCh38)
Location 1:223130929-223130951
Sequence CAGGGCATCAATGCTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922167891_922167897 7 Left 922167891 1:223130899-223130921 CCTTAATTCCCAGCTGGAAGAAG 0: 1
1: 0
2: 3
3: 18
4: 211
Right 922167897 1:223130929-223130951 CAGGGCATCAATGCTGTTGGTGG No data
922167893_922167897 -2 Left 922167893 1:223130908-223130930 CCAGCTGGAAGAAGCTTTAAGCA 0: 1
1: 0
2: 0
3: 17
4: 155
Right 922167897 1:223130929-223130951 CAGGGCATCAATGCTGTTGGTGG No data
922167892_922167897 -1 Left 922167892 1:223130907-223130929 CCCAGCTGGAAGAAGCTTTAAGC 0: 1
1: 0
2: 1
3: 33
4: 132
Right 922167897 1:223130929-223130951 CAGGGCATCAATGCTGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922167897 Original CRISPR CAGGGCATCAATGCTGTTGG TGG Intronic
No off target data available for this crispr