ID: 922169751

View in Genome Browser
Species Human (GRCh38)
Location 1:223144288-223144310
Sequence TGCCCACCCGAACCCCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922169743_922169751 26 Left 922169743 1:223144239-223144261 CCTAGGTAGGTCTCCAAGGGCTG 0: 1
1: 0
2: 0
3: 28
4: 587
Right 922169751 1:223144288-223144310 TGCCCACCCGAACCCCACTGTGG 0: 1
1: 0
2: 0
3: 16
4: 112
922169746_922169751 13 Left 922169746 1:223144252-223144274 CCAAGGGCTGTATGTAGAGGGAT 0: 1
1: 0
2: 0
3: 7
4: 126
Right 922169751 1:223144288-223144310 TGCCCACCCGAACCCCACTGTGG 0: 1
1: 0
2: 0
3: 16
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922169751 Original CRISPR TGCCCACCCGAACCCCACTG TGG Intergenic
900292665 1:1930066-1930088 TGGCCACACGGTCCCCACTGAGG + Exonic
901655829 1:10768644-10768666 TGCCCAGCCAGAGCCCACTGTGG + Intronic
902817929 1:18926692-18926714 TCCCCACCCCCACCCCACTCAGG + Intronic
903446583 1:23426107-23426129 TTCCAAACCCAACCCCACTGAGG - Intergenic
904090537 1:27941894-27941916 TGCCCACCTGGACCCCAAGGAGG + Intronic
908606877 1:65807786-65807808 TGCCCACTCCAACCCTACTTGGG - Intronic
915973082 1:160367508-160367530 TGCCAGCCCTAACCCAACTGAGG - Intronic
918257518 1:182762830-182762852 TGACTACCCGAACCCCAATTAGG - Intergenic
919192671 1:194244131-194244153 TGCCCACCCCAATCCCTGTGTGG - Intergenic
919891963 1:201982433-201982455 TGCCCACCCATATCCTACTGAGG - Intronic
922169751 1:223144288-223144310 TGCCCACCCGAACCCCACTGTGG + Intergenic
922351102 1:224735147-224735169 TCCCCACCCCAGCCCCACAGTGG + Intronic
923162313 1:231325437-231325459 TCTCCACCCCATCCCCACTGGGG - Intergenic
1062888356 10:1036641-1036663 TCCCCACCCCCACCCCACGGGGG - Intergenic
1062944915 10:1452968-1452990 GGCCCGGCCCAACCCCACTGAGG - Intronic
1066421921 10:35271705-35271727 TGGCCCCTCCAACCCCACTGGGG + Intronic
1071588131 10:86845552-86845574 TGCCCACCAGAGCCACAGTGCGG + Intronic
1073323106 10:102627642-102627664 TGCCCACCAGAACTCCCCAGCGG - Intronic
1076003706 10:126931583-126931605 GCCCCACCCCAACCCCAGTGGGG - Intronic
1077111222 11:863098-863120 TGACCACCCCACCCCCACTGTGG + Intronic
1077303621 11:1858214-1858236 TCAGCACCCGAACCCCACAGGGG - Intronic
1077794456 11:5477338-5477360 TGCCCACTGGTTCCCCACTGAGG - Intronic
1078580111 11:12533049-12533071 TGCCCACCCCAACACCAATCTGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1083758166 11:64802357-64802379 CCCCCACCCCTACCCCACTGGGG - Intronic
1084065495 11:66701567-66701589 TGCCCTCCCAAACCCACCTGTGG + Exonic
1084188634 11:67488823-67488845 GCCCCACCCACACCCCACTGAGG - Intronic
1088295775 11:108292242-108292264 TGCCCACCCCTACCCCAGCGTGG - Intronic
1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG + Intronic
1091358605 11:134957316-134957338 TGAGCACCCCATCCCCACTGCGG + Intergenic
1095632873 12:44398600-44398622 TGCCCACCCCACCCCCACACAGG + Intergenic
1096111891 12:49033753-49033775 TGCCCACCCGGAGGCCCCTGTGG + Exonic
1096868280 12:54578006-54578028 TCCCCACCTGACACCCACTGGGG + Exonic
1097020853 12:56020095-56020117 AGCCCTCCCGAAGCACACTGCGG + Intronic
1097194648 12:57236757-57236779 TGCCCACCCCAACCCCACCCCGG + Intronic
1098777658 12:74641736-74641758 TGCCCACACCAACACCACTGTGG + Intergenic
1102027790 12:109723445-109723467 TGCCCACCCAACCCCCATTATGG + Intronic
1103041258 12:117697312-117697334 TGCCCTCCAGAAGCCCTCTGGGG - Intronic
1103978517 12:124720282-124720304 CTGCCACCCTAACCCCACTGAGG - Intergenic
1105237181 13:18568030-18568052 CGCCCACCCGGACCCCACGCCGG + Intergenic
1106230989 13:27820922-27820944 TTCCCACGTGAACCCCCCTGAGG - Intergenic
1117610140 14:57474739-57474761 TGCTCACCCGAAACCCATTTAGG - Intronic
1122315102 14:100821238-100821260 TGCCCACCCCACCCCCACCCGGG - Intergenic
1122316897 14:100831048-100831070 AGCCCACTCGAATCTCACTGGGG - Intergenic
1122798464 14:104218061-104218083 TGCTCACCCCAGCCCCACAGAGG - Intergenic
1124954037 15:34348189-34348211 TGCCAGCCCCAGCCCCACTGAGG - Exonic
1125930205 15:43594508-43594530 CCCCCACCCCCACCCCACTGAGG - Intronic
1125943373 15:43694340-43694362 CCCCCACCCCCACCCCACTGAGG - Intronic
1127321048 15:57846856-57846878 TTCCCACCCAATGCCCACTGTGG - Intergenic
1128462866 15:67884587-67884609 TTCCCTCCAGAACCCCACAGCGG + Intergenic
1128989361 15:72246023-72246045 TTCCAACCCTAACCCCACTTTGG + Intronic
1131057343 15:89383522-89383544 TGCCCATTCAAACTCCACTGGGG - Intergenic
1137849121 16:51721080-51721102 TGCCCACCAAAACCCAACTGTGG + Intergenic
1141672211 16:85498038-85498060 ACCCCACCCCCACCCCACTGAGG - Intergenic
1144790539 17:17856127-17856149 TGCCCACACAAACTCCCCTGAGG - Intronic
1145868136 17:28253702-28253724 TGCCCACCCCAACCCCAGAAGGG + Intergenic
1145992593 17:29088018-29088040 TGCCCACCCCAACCCCAGGCTGG - Intronic
1147021416 17:37537006-37537028 TGCCCACCCTAAGCCAAGTGAGG + Intronic
1147758755 17:42784295-42784317 CACCCACCTCAACCCCACTGTGG + Intronic
1148201820 17:45754196-45754218 TGCCGACCCGCTGCCCACTGTGG + Intergenic
1151046338 17:70923909-70923931 TGCCAACCCTCAACCCACTGAGG + Intergenic
1151686793 17:75652279-75652301 TGCCCACCCCCACCCCACATGGG - Intronic
1151765625 17:76132004-76132026 TGCCCACCGCAATCCCGCTGCGG + Intergenic
1152658161 17:81529541-81529563 TGCCCAGGCGACCCCCACTGAGG + Intronic
1156418809 18:36928073-36928095 TGCCAACCCCAACCCCAGTAGGG + Intronic
1156644624 18:39146172-39146194 TCCCCACCTCCACCCCACTGTGG - Intergenic
1158687853 18:59630813-59630835 TGAGCACCTGAATCCCACTGTGG - Intronic
1160854690 19:1211446-1211468 CCCCCCCCAGAACCCCACTGTGG - Intronic
1163827132 19:19530029-19530051 TGCCCACCAGACCACCACGGGGG - Intronic
1165059018 19:33195776-33195798 CGCCCACCCCAACCTCAGTGCGG + Intronic
1165382630 19:35491977-35491999 TGGCCACCTGAACCTCACTGTGG - Intronic
1165443360 19:35843555-35843577 TGCCCTCCAGGACCCCACTGAGG - Exonic
927826434 2:26312906-26312928 TGCCCAGCTGGCCCCCACTGTGG + Intronic
928599985 2:32895067-32895089 TGCCCCCCTTAAGCCCACTGTGG + Intergenic
934943729 2:98521037-98521059 TCCCCACCCCCACCCCAATGGGG + Intronic
936243380 2:110806857-110806879 TGCCCCACACAACCCCACTGTGG - Intronic
938224919 2:129607320-129607342 TGCCCACCCCAACCCAAAAGGGG + Intergenic
938512595 2:131966483-131966505 CGCCCACCCGGACCCCACGCCGG - Intergenic
943691749 2:190876521-190876543 TTCCCACCCAACCCCCACTCCGG + Intergenic
947384888 2:229580999-229581021 TGCCGGCCCCATCCCCACTGGGG - Intronic
948613261 2:239182892-239182914 TGCCCTCCAGAAGCCAACTGAGG - Intronic
949071813 2:242029711-242029733 TGAGCACCTGAACCTCACTGTGG + Intergenic
1172233404 20:33352469-33352491 TGACCTCCCCAACTCCACTGTGG - Intergenic
1173874837 20:46364048-46364070 TGCCCGCCCCAATCCCACCGCGG + Intronic
1175767146 20:61599485-61599507 TGACCCCCCTGACCCCACTGTGG + Intronic
1176781168 21:13196312-13196334 CGCCCACCCGGACCCCACGCTGG + Intergenic
1180143868 21:45909104-45909126 GACCCGCCCCAACCCCACTGCGG + Intronic
1180924503 22:19544430-19544452 TGCCCACCCACACCCCTCTGGGG + Intergenic
1180957988 22:19749755-19749777 TGCCCACCCACACCCCCATGTGG - Intergenic
1184445237 22:44543205-44543227 TGCCCACCTGGACCCCACGTGGG + Intergenic
1184453939 22:44598642-44598664 TGGCCAGCCCCACCCCACTGGGG + Intergenic
1184723995 22:46332427-46332449 TTCCCACCCGGAGCCCTCTGAGG - Intronic
952387776 3:32855359-32855381 TGCCCTCCCCCACCCCACAGTGG - Intronic
952528309 3:34237106-34237128 TGCCCAGCCAAACCCAGCTGGGG - Intergenic
953482002 3:43259811-43259833 TGCCCACATGAACCACCCTGGGG - Intergenic
954618868 3:51984466-51984488 GGCCCTCCAGAAGCCCACTGGGG + Intronic
961627767 3:128275534-128275556 TGACCACCCCAGCCCCACTGAGG - Intronic
965648290 3:170908171-170908193 CGCCGCCCCGAACCCTACTGCGG + Intronic
969572196 4:8015634-8015656 TGCCCACCCAAAGCCAACAGTGG - Intronic
969714876 4:8863586-8863608 TGCACTCCCGAACCCCCATGGGG - Intronic
977518581 4:98052930-98052952 TTCCCTCCCTAACCTCACTGAGG + Intronic
982162869 4:152587360-152587382 TGCTCCCCCCATCCCCACTGGGG + Intergenic
984837409 4:184034375-184034397 TGCACACCTGGGCCCCACTGTGG - Intergenic
985351106 4:189062224-189062246 TGCTCACCAGCACCACACTGTGG + Intergenic
992070656 5:73145543-73145565 ATCCCACCCCAACCCCACTGAGG + Intergenic
997352193 5:133239033-133239055 TGCCCACCCGAAACTCACGCTGG - Intronic
998169430 5:139863880-139863902 TCCCCACCCCAACCCCACAGGGG - Intronic
999148195 5:149409620-149409642 TGCCCACCCCGACACCTCTGAGG + Intergenic
1002064332 5:176644515-176644537 TCCCCACCCCCACCCCTCTGAGG - Intronic
1005824595 6:29625155-29625177 TGCCCACCCTACCCTCACTCTGG + Intronic
1017539038 6:155380877-155380899 TTCCAACCCTCACCCCACTGCGG + Intergenic
1022955749 7:35378406-35378428 TGCCCCCCCCACCCCCACAGTGG - Intergenic
1023025787 7:36048574-36048596 TCCCCACCCCCACCCCACTGAGG - Intergenic
1025209342 7:57011897-57011919 TGCCCACCTGGACCCCAGGGAGG + Intergenic
1025662603 7:63564957-63564979 TGCCCACCTGGACCCCAGGGAGG - Intergenic
1033678611 7:143569817-143569839 TGCCCACCTGAACCATGCTGAGG - Intergenic
1033693231 7:143759633-143759655 TGCCCACCTGAACCATGCTGAGG + Intergenic
1037293737 8:17379299-17379321 TGCCCGCTCAAACCCCACTTTGG - Intronic
1037755725 8:21709025-21709047 TGCCCACCTGCAGCCCACTCCGG - Intronic
1049225059 8:141446456-141446478 TGCTCACCCGCACCTCACTGAGG - Intergenic
1052993512 9:34536806-34536828 TGCCCACCCTTCCCCCACTGCGG - Intergenic
1055330987 9:75183722-75183744 TCCCCACCGGGTCCCCACTGGGG - Intergenic
1058102424 9:100931964-100931986 TGCCCACCCTAGGCCCCCTGGGG + Intergenic
1061231556 9:129318767-129318789 TGCCCAACCTATCCCCACTGTGG + Intergenic
1061585892 9:131568134-131568156 TGGCCACCATAACACCACTGGGG + Intergenic
1062320917 9:135990241-135990263 TGCCCCCCCGCCCCCCGCTGTGG + Intergenic
1062688415 9:137828175-137828197 TGCCCGCCAGCACCCCCCTGGGG - Intronic
1193575161 X:83186561-83186583 TGCTCAACCCAACCCCACTGTGG + Intergenic
1198372643 X:136005894-136005916 TCTCCACCAGAATCCCACTGAGG - Intronic