ID: 922170127

View in Genome Browser
Species Human (GRCh38)
Location 1:223147124-223147146
Sequence GTTTATATGGAGACAATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922170120_922170127 24 Left 922170120 1:223147077-223147099 CCATCGAGTGAGCAGTTGAAGTC No data
Right 922170127 1:223147124-223147146 GTTTATATGGAGACAATGGGGGG No data
922170121_922170127 -5 Left 922170121 1:223147106-223147128 CCAGAGCATAGAAAAGATGTTTA No data
Right 922170127 1:223147124-223147146 GTTTATATGGAGACAATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922170127 Original CRISPR GTTTATATGGAGACAATGGG GGG Intergenic
No off target data available for this crispr