ID: 922171991

View in Genome Browser
Species Human (GRCh38)
Location 1:223163267-223163289
Sequence TTTTCAGATAAGTTCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922171991_922171992 -6 Left 922171991 1:223163267-223163289 CCTGGGAGGAACTTATCTGAAAA No data
Right 922171992 1:223163284-223163306 TGAAAAAGATCCTGCATGCAAGG No data
922171991_922171993 -5 Left 922171991 1:223163267-223163289 CCTGGGAGGAACTTATCTGAAAA No data
Right 922171993 1:223163285-223163307 GAAAAAGATCCTGCATGCAAGGG No data
922171991_922171994 1 Left 922171991 1:223163267-223163289 CCTGGGAGGAACTTATCTGAAAA No data
Right 922171994 1:223163291-223163313 GATCCTGCATGCAAGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922171991 Original CRISPR TTTTCAGATAAGTTCCTCCC AGG (reversed) Intergenic
No off target data available for this crispr