ID: 922171992

View in Genome Browser
Species Human (GRCh38)
Location 1:223163284-223163306
Sequence TGAAAAAGATCCTGCATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922171991_922171992 -6 Left 922171991 1:223163267-223163289 CCTGGGAGGAACTTATCTGAAAA No data
Right 922171992 1:223163284-223163306 TGAAAAAGATCCTGCATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922171992 Original CRISPR TGAAAAAGATCCTGCATGCA AGG Intergenic
No off target data available for this crispr