ID: 922172419

View in Genome Browser
Species Human (GRCh38)
Location 1:223166957-223166979
Sequence GAAAATGCCAAGATCTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922172419_922172425 18 Left 922172419 1:223166957-223166979 CCCAGCTAGATCTTGGCATTTTC No data
Right 922172425 1:223166998-223167020 TCACTTCCAAGCAGGAAGAAAGG No data
922172419_922172423 10 Left 922172419 1:223166957-223166979 CCCAGCTAGATCTTGGCATTTTC No data
Right 922172423 1:223166990-223167012 TCCTGTGGTCACTTCCAAGCAGG No data
922172419_922172422 -5 Left 922172419 1:223166957-223166979 CCCAGCTAGATCTTGGCATTTTC No data
Right 922172422 1:223166975-223166997 TTTTCTTCATGGTTGTCCTGTGG No data
922172419_922172427 24 Left 922172419 1:223166957-223166979 CCCAGCTAGATCTTGGCATTTTC No data
Right 922172427 1:223167004-223167026 CCAAGCAGGAAGAAAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922172419 Original CRISPR GAAAATGCCAAGATCTAGCT GGG (reversed) Intergenic
No off target data available for this crispr