ID: 922172448

View in Genome Browser
Species Human (GRCh38)
Location 1:223167133-223167155
Sequence CTCCATCTTCAATGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922172443_922172448 -3 Left 922172443 1:223167113-223167135 CCAGAGCAGACACTTGGCCACTC No data
Right 922172448 1:223167133-223167155 CTCCATCTTCAATGGGAGCTGGG No data
922172441_922172448 15 Left 922172441 1:223167095-223167117 CCACTTAGAAATCACTGGCCAGA No data
Right 922172448 1:223167133-223167155 CTCCATCTTCAATGGGAGCTGGG No data
922172439_922172448 26 Left 922172439 1:223167084-223167106 CCTGGTGATTTCCACTTAGAAAT No data
Right 922172448 1:223167133-223167155 CTCCATCTTCAATGGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922172448 Original CRISPR CTCCATCTTCAATGGGAGCT GGG Intergenic
No off target data available for this crispr