ID: 922176969

View in Genome Browser
Species Human (GRCh38)
Location 1:223204560-223204582
Sequence GGCAAGTGCCCATGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922176969_922176976 7 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176976 1:223204590-223204612 TGCCTCTGCTGCTCCAGTCCTGG No data
922176969_922176981 14 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176981 1:223204597-223204619 GCTGCTCCAGTCCTGGGGTAGGG No data
922176969_922176977 8 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176977 1:223204591-223204613 GCCTCTGCTGCTCCAGTCCTGGG No data
922176969_922176984 24 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data
922176969_922176986 30 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176986 1:223204613-223204635 GGTAGGGGACAGAGTGGCTATGG No data
922176969_922176982 15 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176982 1:223204598-223204620 CTGCTCCAGTCCTGGGGTAGGGG No data
922176969_922176979 9 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176979 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
922176969_922176980 13 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176980 1:223204596-223204618 TGCTGCTCCAGTCCTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922176969 Original CRISPR GGCAAGTGCCCATGTGGGCA AGG (reversed) Intergenic