ID: 922176970

View in Genome Browser
Species Human (GRCh38)
Location 1:223204565-223204587
Sequence TGAGGGGCAAGTGCCCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922176970_922176982 10 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176982 1:223204598-223204620 CTGCTCCAGTCCTGGGGTAGGGG No data
922176970_922176979 4 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176979 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
922176970_922176981 9 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176981 1:223204597-223204619 GCTGCTCCAGTCCTGGGGTAGGG No data
922176970_922176987 26 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176987 1:223204614-223204636 GTAGGGGACAGAGTGGCTATGGG No data
922176970_922176980 8 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176980 1:223204596-223204618 TGCTGCTCCAGTCCTGGGGTAGG No data
922176970_922176986 25 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176986 1:223204613-223204635 GGTAGGGGACAGAGTGGCTATGG No data
922176970_922176977 3 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176977 1:223204591-223204613 GCCTCTGCTGCTCCAGTCCTGGG No data
922176970_922176976 2 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176976 1:223204590-223204612 TGCCTCTGCTGCTCCAGTCCTGG No data
922176970_922176984 19 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922176970 Original CRISPR TGAGGGGCAAGTGCCCATGT GGG (reversed) Intergenic
No off target data available for this crispr