ID: 922176973

View in Genome Browser
Species Human (GRCh38)
Location 1:223204582-223204604
Sequence GGAGCAGCAGAGGCAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922176973_922176986 8 Left 922176973 1:223204582-223204604 CCCTCACCTGCCTCTGCTGCTCC No data
Right 922176986 1:223204613-223204635 GGTAGGGGACAGAGTGGCTATGG No data
922176973_922176981 -8 Left 922176973 1:223204582-223204604 CCCTCACCTGCCTCTGCTGCTCC No data
Right 922176981 1:223204597-223204619 GCTGCTCCAGTCCTGGGGTAGGG No data
922176973_922176984 2 Left 922176973 1:223204582-223204604 CCCTCACCTGCCTCTGCTGCTCC No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data
922176973_922176987 9 Left 922176973 1:223204582-223204604 CCCTCACCTGCCTCTGCTGCTCC No data
Right 922176987 1:223204614-223204636 GTAGGGGACAGAGTGGCTATGGG No data
922176973_922176982 -7 Left 922176973 1:223204582-223204604 CCCTCACCTGCCTCTGCTGCTCC No data
Right 922176982 1:223204598-223204620 CTGCTCCAGTCCTGGGGTAGGGG No data
922176973_922176988 15 Left 922176973 1:223204582-223204604 CCCTCACCTGCCTCTGCTGCTCC No data
Right 922176988 1:223204620-223204642 GACAGAGTGGCTATGGGACCTGG No data
922176973_922176980 -9 Left 922176973 1:223204582-223204604 CCCTCACCTGCCTCTGCTGCTCC No data
Right 922176980 1:223204596-223204618 TGCTGCTCCAGTCCTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922176973 Original CRISPR GGAGCAGCAGAGGCAGGTGA GGG (reversed) Intergenic
No off target data available for this crispr