ID: 922176978

View in Genome Browser
Species Human (GRCh38)
Location 1:223204592-223204614
Sequence CCCCAGGACTGGAGCAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922176978_922176991 26 Left 922176978 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
Right 922176991 1:223204641-223204663 GGTCGTGATGACCTCTGAGTGGG No data
922176978_922176988 5 Left 922176978 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
Right 922176988 1:223204620-223204642 GACAGAGTGGCTATGGGACCTGG No data
922176978_922176990 25 Left 922176978 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
Right 922176990 1:223204640-223204662 TGGTCGTGATGACCTCTGAGTGG No data
922176978_922176984 -8 Left 922176978 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data
922176978_922176987 -1 Left 922176978 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
Right 922176987 1:223204614-223204636 GTAGGGGACAGAGTGGCTATGGG No data
922176978_922176986 -2 Left 922176978 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
Right 922176986 1:223204613-223204635 GGTAGGGGACAGAGTGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922176978 Original CRISPR CCCCAGGACTGGAGCAGCAG AGG (reversed) Intergenic
No off target data available for this crispr