ID: 922176979

View in Genome Browser
Species Human (GRCh38)
Location 1:223204592-223204614
Sequence CCTCTGCTGCTCCAGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922176971_922176979 3 Left 922176971 1:223204566-223204588 CCACATGGGCACTTGCCCCTCAC No data
Right 922176979 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
922176970_922176979 4 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176979 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
922176969_922176979 9 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176979 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922176979 Original CRISPR CCTCTGCTGCTCCAGTCCTG GGG Intergenic
No off target data available for this crispr