ID: 922176982

View in Genome Browser
Species Human (GRCh38)
Location 1:223204598-223204620
Sequence CTGCTCCAGTCCTGGGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922176972_922176982 -6 Left 922176972 1:223204581-223204603 CCCCTCACCTGCCTCTGCTGCTC No data
Right 922176982 1:223204598-223204620 CTGCTCCAGTCCTGGGGTAGGGG No data
922176970_922176982 10 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176982 1:223204598-223204620 CTGCTCCAGTCCTGGGGTAGGGG No data
922176969_922176982 15 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176982 1:223204598-223204620 CTGCTCCAGTCCTGGGGTAGGGG No data
922176973_922176982 -7 Left 922176973 1:223204582-223204604 CCCTCACCTGCCTCTGCTGCTCC No data
Right 922176982 1:223204598-223204620 CTGCTCCAGTCCTGGGGTAGGGG No data
922176971_922176982 9 Left 922176971 1:223204566-223204588 CCACATGGGCACTTGCCCCTCAC No data
Right 922176982 1:223204598-223204620 CTGCTCCAGTCCTGGGGTAGGGG No data
922176974_922176982 -8 Left 922176974 1:223204583-223204605 CCTCACCTGCCTCTGCTGCTCCA No data
Right 922176982 1:223204598-223204620 CTGCTCCAGTCCTGGGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922176982 Original CRISPR CTGCTCCAGTCCTGGGGTAG GGG Intergenic
No off target data available for this crispr