ID: 922176984

View in Genome Browser
Species Human (GRCh38)
Location 1:223204607-223204629
Sequence TCCTGGGGTAGGGGACAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922176971_922176984 18 Left 922176971 1:223204566-223204588 CCACATGGGCACTTGCCCCTCAC No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data
922176974_922176984 1 Left 922176974 1:223204583-223204605 CCTCACCTGCCTCTGCTGCTCCA No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data
922176978_922176984 -8 Left 922176978 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data
922176975_922176984 -4 Left 922176975 1:223204588-223204610 CCTGCCTCTGCTGCTCCAGTCCT No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data
922176973_922176984 2 Left 922176973 1:223204582-223204604 CCCTCACCTGCCTCTGCTGCTCC No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data
922176970_922176984 19 Left 922176970 1:223204565-223204587 CCCACATGGGCACTTGCCCCTCA No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data
922176972_922176984 3 Left 922176972 1:223204581-223204603 CCCCTCACCTGCCTCTGCTGCTC No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data
922176969_922176984 24 Left 922176969 1:223204560-223204582 CCTTGCCCACATGGGCACTTGCC No data
Right 922176984 1:223204607-223204629 TCCTGGGGTAGGGGACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922176984 Original CRISPR TCCTGGGGTAGGGGACAGAG TGG Intergenic
No off target data available for this crispr