ID: 922176988

View in Genome Browser
Species Human (GRCh38)
Location 1:223204620-223204642
Sequence GACAGAGTGGCTATGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922176983_922176988 -6 Left 922176983 1:223204603-223204625 CCAGTCCTGGGGTAGGGGACAGA No data
Right 922176988 1:223204620-223204642 GACAGAGTGGCTATGGGACCTGG No data
922176972_922176988 16 Left 922176972 1:223204581-223204603 CCCCTCACCTGCCTCTGCTGCTC No data
Right 922176988 1:223204620-223204642 GACAGAGTGGCTATGGGACCTGG No data
922176978_922176988 5 Left 922176978 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
Right 922176988 1:223204620-223204642 GACAGAGTGGCTATGGGACCTGG No data
922176975_922176988 9 Left 922176975 1:223204588-223204610 CCTGCCTCTGCTGCTCCAGTCCT No data
Right 922176988 1:223204620-223204642 GACAGAGTGGCTATGGGACCTGG No data
922176973_922176988 15 Left 922176973 1:223204582-223204604 CCCTCACCTGCCTCTGCTGCTCC No data
Right 922176988 1:223204620-223204642 GACAGAGTGGCTATGGGACCTGG No data
922176974_922176988 14 Left 922176974 1:223204583-223204605 CCTCACCTGCCTCTGCTGCTCCA No data
Right 922176988 1:223204620-223204642 GACAGAGTGGCTATGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922176988 Original CRISPR GACAGAGTGGCTATGGGACC TGG Intergenic
No off target data available for this crispr