ID: 922176991

View in Genome Browser
Species Human (GRCh38)
Location 1:223204641-223204663
Sequence GGTCGTGATGACCTCTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922176978_922176991 26 Left 922176978 1:223204592-223204614 CCTCTGCTGCTCCAGTCCTGGGG No data
Right 922176991 1:223204641-223204663 GGTCGTGATGACCTCTGAGTGGG No data
922176983_922176991 15 Left 922176983 1:223204603-223204625 CCAGTCCTGGGGTAGGGGACAGA No data
Right 922176991 1:223204641-223204663 GGTCGTGATGACCTCTGAGTGGG No data
922176975_922176991 30 Left 922176975 1:223204588-223204610 CCTGCCTCTGCTGCTCCAGTCCT No data
Right 922176991 1:223204641-223204663 GGTCGTGATGACCTCTGAGTGGG No data
922176985_922176991 10 Left 922176985 1:223204608-223204630 CCTGGGGTAGGGGACAGAGTGGC No data
Right 922176991 1:223204641-223204663 GGTCGTGATGACCTCTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922176991 Original CRISPR GGTCGTGATGACCTCTGAGT GGG Intergenic
No off target data available for this crispr