ID: 922177248

View in Genome Browser
Species Human (GRCh38)
Location 1:223206229-223206251
Sequence CACTAGGAGTGGAGGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922177242_922177248 -9 Left 922177242 1:223206215-223206237 CCTAGATAGGCCCACACTAGGAG No data
Right 922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922177248 Original CRISPR CACTAGGAGTGGAGGGAGCT TGG Intergenic
No off target data available for this crispr