ID: 922180673

View in Genome Browser
Species Human (GRCh38)
Location 1:223230610-223230632
Sequence CAACCCTGCTTCACACGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922180673_922180676 -8 Left 922180673 1:223230610-223230632 CCGATGCGTGTGAAGCAGGGTTG 0: 1
1: 0
2: 0
3: 9
4: 89
Right 922180676 1:223230625-223230647 CAGGGTTGGAGGCACACTACAGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922180673 Original CRISPR CAACCCTGCTTCACACGCAT CGG (reversed) Intronic