ID: 922180954

View in Genome Browser
Species Human (GRCh38)
Location 1:223232252-223232274
Sequence CAGTATTATTAACTGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922180954_922180958 23 Left 922180954 1:223232252-223232274 CCAGACTCCAGTTAATAATACTG 0: 1
1: 0
2: 1
3: 13
4: 151
Right 922180958 1:223232298-223232320 AGAGAGTAGATTTCAGGAAATGG 0: 1
1: 0
2: 6
3: 37
4: 401
922180954_922180956 -10 Left 922180954 1:223232252-223232274 CCAGACTCCAGTTAATAATACTG 0: 1
1: 0
2: 1
3: 13
4: 151
Right 922180956 1:223232265-223232287 AATAATACTGTATTATACACTGG 0: 1
1: 7
2: 25
3: 85
4: 517
922180954_922180957 17 Left 922180954 1:223232252-223232274 CCAGACTCCAGTTAATAATACTG 0: 1
1: 0
2: 1
3: 13
4: 151
Right 922180957 1:223232292-223232314 TCACTAAGAGAGTAGATTTCAGG 0: 3
1: 1
2: 11
3: 83
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922180954 Original CRISPR CAGTATTATTAACTGGAGTC TGG (reversed) Intronic
906895081 1:49762258-49762280 CAGTCTTTCTAACTGGAGTAAGG + Intronic
911233348 1:95383410-95383432 TATTTTTATTAACTGGAGTCAGG + Intergenic
911936693 1:103985320-103985342 CAGTATGAGTAACCCGAGTCAGG - Intergenic
914476227 1:148025062-148025084 AAGTTTTATTAACTGGGGGCGGG - Intergenic
915775776 1:158484403-158484425 CAGTATTAATAACTGCTGTATGG + Intergenic
916236176 1:162591227-162591249 CAGTACTATTAACAGTAGTGAGG - Intronic
922180954 1:223232252-223232274 CAGTATTATTAACTGGAGTCTGG - Intronic
924146428 1:241080606-241080628 CAGTATTTCTAACTGGTGTATGG - Intronic
924655235 1:245968765-245968787 CAGAATTATTAAATGGAATATGG - Intronic
1064917554 10:20477456-20477478 CAATATCATTAACAGGAGTTTGG + Intergenic
1065815737 10:29480935-29480957 CAGGATGTTTAACTGCAGTCAGG + Intronic
1065957192 10:30704269-30704291 CAGGATGTTTAACTGCAGTCAGG - Intergenic
1066160729 10:32724713-32724735 CTGTATTATTAAGGGGACTCTGG - Intronic
1066661825 10:37744114-37744136 CAGGATTGATAACAGGAGTCAGG + Intergenic
1069129794 10:64684743-64684765 CTGTATTTTTTAGTGGAGTCGGG + Intergenic
1072704222 10:97668570-97668592 CATTATTATTATCTTGAGACAGG - Intronic
1072836221 10:98716314-98716336 TAGCATTATTAACAGGAGTTTGG - Intronic
1073227109 10:101931193-101931215 CAGATTTCTTAACTTGAGTCAGG - Intronic
1074635791 10:115315726-115315748 CATTATTATTACCTGGACACTGG - Exonic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1085716083 11:78874820-78874842 CAGTATCATTAATTGTAGTGTGG - Intronic
1085882466 11:80484174-80484196 CACTCTTAGTAACTAGAGTCTGG + Intergenic
1087269540 11:96097485-96097507 CAGTATCATTAACTGTTTTCTGG - Intronic
1089906719 11:122047644-122047666 CAGCATTATTCACTGTAGCCAGG - Intergenic
1090795839 11:130135028-130135050 CAGTATTTAAAACTGGCGTCGGG + Intronic
1092687919 12:11072005-11072027 CACTCTTTTTAACTGGATTCTGG + Intronic
1093635342 12:21459862-21459884 CAGGAGTATTCACTGTAGTCTGG - Intronic
1096151051 12:49312974-49312996 CAGTATTAGTAACTGGATAGTGG + Intergenic
1097885356 12:64723434-64723456 CAGTATTATTTATTCTAGTCTGG - Intronic
1101018564 12:100528169-100528191 CAGTATCAGTCACTGGAGTCTGG + Intronic
1105337935 13:19492073-19492095 CACTATAATTAACTTGAATCAGG + Intronic
1105393133 13:20000967-20000989 CAGCATTATTAACCAGAGTTTGG + Intronic
1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG + Exonic
1108126760 13:47252864-47252886 CAAAAATAGTAACTGGAGTCAGG - Intergenic
1112540820 13:100310923-100310945 CATAATTATTAAATGGCGTCAGG - Intronic
1114781619 14:25544781-25544803 CAATATTACTAACAGGAGACAGG - Intergenic
1117105199 14:52391239-52391261 CAGTATTAAGAAATGGAGTTGGG + Intergenic
1118268657 14:64320583-64320605 CATTATTATTAACTAAAGTCCGG - Intronic
1124601665 15:31137810-31137832 GAGTATTATTTCCTGGAGTTTGG - Intronic
1125635259 15:41182647-41182669 CAGATTTATAAACTGGACTCTGG + Intergenic
1128549433 15:68588738-68588760 CAGTTTTATAATCTGGAATCTGG + Intronic
1131409520 15:92195196-92195218 CTGTGTCATTAACTGGAATCAGG - Intergenic
1131954487 15:97717600-97717622 CCTTATTATTCACTGGATTCGGG - Intergenic
1135914828 16:26596399-26596421 CATTATTATTAACTAAATTCTGG + Intergenic
1138433940 16:56986608-56986630 CAGAATTAGTAACTGGGGTTGGG - Intergenic
1140429209 16:74887294-74887316 CTTTATGATCAACTGGAGTCAGG + Intronic
1148424360 17:47579833-47579855 CAGTATTATTAGCTGTTTTCTGG + Intronic
1149606294 17:57927335-57927357 CAGGAGTGTTAACTGGGGTCAGG - Intronic
1149820361 17:59771177-59771199 TTGAATTATTAACTGGAGACAGG + Intronic
1159357489 18:67357002-67357024 GAGTCTTATTGACTGTAGTCTGG - Intergenic
1164254362 19:23514303-23514325 CAGAATTTTTAACTGCAGTTGGG + Intergenic
1166534337 19:43562850-43562872 ATGTATTATTAGCAGGAGTCTGG - Intronic
926842880 2:17102861-17102883 CAATATTATTAACTACAGTTGGG + Intergenic
930868775 2:56149108-56149130 CAGTCTTCATCACTGGAGTCAGG - Intergenic
933617752 2:84500435-84500457 CTGTAGTATAAACTGAAGTCAGG + Intergenic
934610398 2:95731243-95731265 CAGTTTTGATAACTGGAGGCTGG + Intergenic
935412190 2:102776183-102776205 CATTATTATTAACTAAAGTCAGG + Intronic
936226273 2:110656282-110656304 TAGTACTATTAACTGTAGTTTGG + Intronic
936543734 2:113372822-113372844 CAGTTTTGGTAACTGGAGGCTGG + Intergenic
939207310 2:139123542-139123564 CTGTATTGCTAACTGGAGTAGGG + Intergenic
939485286 2:142803841-142803863 CAGTATTCTTATCTGCAGTATGG - Intergenic
940608386 2:155957912-155957934 CAGTATTATAAACAGGAACCAGG - Intergenic
940634758 2:156285284-156285306 CATTATTATTAACTATAGTCAGG + Intergenic
942758920 2:179374910-179374932 CTGGACTACTAACTGGAGTCAGG + Intergenic
943913752 2:193601805-193601827 CTTAACTATTAACTGGAGTCTGG + Intergenic
944050881 2:195468151-195468173 AAGTATTTGTAGCTGGAGTCAGG + Intergenic
947631995 2:231659852-231659874 AAGTCTTATTAATAGGAGTCAGG + Intergenic
1171722411 20:28577579-28577601 TATTATTATTATTTGGAGTCAGG + Intergenic
1171755664 20:29105873-29105895 TATTATTATTATTTGGAGTCAGG - Intergenic
1171787009 20:29477017-29477039 TATTATTATTATTTGGAGTCAGG + Intergenic
1175088555 20:56482691-56482713 CAGTGTTATGAACTGGATTTTGG + Intronic
1176415553 21:6472595-6472617 CAGTATTAGTAACTGAAGGTGGG - Intergenic
1176735693 21:10544137-10544159 CACTATAATTAACTTGAATCAGG - Intronic
1178392583 21:32211344-32211366 CAGGATTATTAATTGGAGAAAGG + Intergenic
1179691053 21:43080928-43080950 CAGTATTAGTAACTGAAGGTGGG - Intergenic
1180295964 22:10936264-10936286 TATTATTATTATTTGGAGTCAGG + Intergenic
1183533516 22:38379603-38379625 CACTATAATTAACTTGAATCAGG + Intronic
949330340 3:2915762-2915784 CAGTATTATTCACAATAGTCAGG + Intronic
950118483 3:10466492-10466514 CAGTTTTACTACCTGGAGTGGGG + Intronic
950818006 3:15727635-15727657 TATTATTATTAACAGGAGTTTGG + Intronic
951785556 3:26414814-26414836 CTGAATTATTAACTGGAGGGAGG + Intergenic
957553505 3:81736409-81736431 GAGTGTTGTTAACAGGAGTCTGG - Intronic
958670129 3:97193044-97193066 CTGTAGTATAACCTGGAGTCAGG + Intronic
965372875 3:167886388-167886410 CAGTATTATTGACTAGAATTTGG + Intergenic
965895600 3:173571813-173571835 CAGTATTATTAATAGGAGAAAGG - Intronic
967397992 3:189028200-189028222 CAATATGATTGACTGGAGTTAGG - Intronic
967756109 3:193170541-193170563 CAGTTTTATTATTTGGTGTCTGG + Intergenic
970775187 4:19666108-19666130 CAAAATTATTAAATGCAGTCAGG + Intergenic
971356040 4:25896045-25896067 CATTATTATGAACTGGTGACTGG - Intronic
973660780 4:53104555-53104577 CAGTATTATTAACTAAAGTGTGG - Intronic
976909924 4:90290168-90290190 CATTACCATTAACTGTAGTCTGG + Intronic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
981241611 4:142483154-142483176 GAGTAATAATGACTGGAGTCAGG + Intronic
982977491 4:162084272-162084294 GAGTATCATCACCTGGAGTCAGG + Intronic
983729278 4:170973048-170973070 CAGTTTTATTCACTGGAATGTGG + Intergenic
984524553 4:180842631-180842653 AACTATTAGGAACTGGAGTCCGG - Intergenic
985439820 4:189972831-189972853 TATTATTATTATCTGGAGTCAGG - Intergenic
985983242 5:3489383-3489405 CTGTATAATTAAGTGGAGGCCGG + Intergenic
988893047 5:35640091-35640113 CAGGCTTATTAACTGCATTCTGG + Intronic
991234030 5:64373237-64373259 TAGTATTATTAATTATAGTCAGG - Intergenic
992344007 5:75857514-75857536 CTGTATTATTATTTGAAGTCAGG + Intergenic
993822227 5:92632597-92632619 CATTATTATTAACTATAGTGTGG + Intergenic
994479692 5:100318120-100318142 CATTATTGTTAACTATAGTCAGG - Intergenic
995143374 5:108759109-108759131 CAGTATAATTAATTGTAGTAAGG + Intronic
996261670 5:121478599-121478621 AAGTAGTATTAACATGAGTCAGG - Intergenic
996485811 5:124032835-124032857 CAGTCTTATTAATTGAAGCCAGG + Intergenic
996918829 5:128743172-128743194 CAGTATTGTCAACTGAAATCTGG + Intronic
998659897 5:144224715-144224737 CATTATTTCTATCTGGAGTCAGG - Intronic
998740158 5:145191470-145191492 CAGTAATATTAACTGAATTGAGG + Intergenic
999753217 5:154645775-154645797 CAGGCTTATTAGCTGGAGTGTGG - Intergenic
1000557765 5:162747828-162747850 TATTATTATTAACTGTAGTTTGG - Intergenic
1003483509 6:6554736-6554758 CAATATAATTAACTGGATACAGG + Intergenic
1004002516 6:11608099-11608121 CAGAAGTATTCACTGGTGTCTGG + Intergenic
1007364068 6:41378050-41378072 CAGTATCCTTATCTGGAGTATGG + Intergenic
1008100562 6:47386026-47386048 CTGTAGTATTATCTGAAGTCAGG + Intergenic
1008815864 6:55565399-55565421 GAGTATTATTAATAGGAATCTGG - Intronic
1009696243 6:67107596-67107618 CTGTATTATTATTTGAAGTCAGG - Intergenic
1011836603 6:91438789-91438811 CAGCATGATTAACAGGAATCAGG + Intergenic
1016320193 6:142834554-142834576 AAGTGATATTAGCTGGAGTCTGG - Intronic
1021408955 7:20306415-20306437 CACAATCATTAACTCGAGTCTGG + Intergenic
1021896275 7:25239154-25239176 CATTATTAATAACTTGAGACAGG + Intergenic
1023321780 7:39006156-39006178 CTGTATTATTAACTAGAATGGGG - Intronic
1024194872 7:47048960-47048982 AAGTTTTATTAACTGCAGTAGGG + Intergenic
1025076497 7:55948172-55948194 CAGTATTATTATTTTGGGTCTGG - Intergenic
1026351248 7:69517254-69517276 CATTATTAGTAACTGGAGGTGGG + Intergenic
1028055556 7:86237302-86237324 CAGTATTATTTACTGTATTCAGG - Intergenic
1028616966 7:92779525-92779547 CATTATTATTAACTTCATTCAGG + Intronic
1031297789 7:120025919-120025941 CAGTATTATTAACTCAACCCTGG + Intergenic
1031772898 7:125868171-125868193 CTTTATTTTTAACTGGACTCTGG - Intergenic
1031799311 7:126223006-126223028 CAGTAATAATCACTGCAGTCTGG - Intergenic
1032895195 7:136242446-136242468 CAGTGTTCTTAACTGGAGTAAGG - Intergenic
1033873618 7:145787367-145787389 CATTATTATTAACTAGAGTTTGG + Intergenic
1036163863 8:6413233-6413255 CAGTCTTATCAACAGCAGTCTGG - Intronic
1037406734 8:18550387-18550409 CTGTATTATTAACTGGACTCAGG + Intronic
1038580656 8:28746566-28746588 CTATAATATTAACTGAAGTCTGG - Intronic
1038585510 8:28785207-28785229 CAGAAATAGTAACTGGAGTTTGG - Intronic
1039532276 8:38273843-38273865 CAGAATTAATTGCTGGAGTCAGG + Exonic
1044171344 8:89056114-89056136 AAGGATTATTCACTGGAGTTTGG + Intergenic
1044204253 8:89473774-89473796 CAGTGTTATTCACTGAAGGCTGG - Intergenic
1044304130 8:90618053-90618075 CACTATTATAAACTGAAGACTGG + Intergenic
1047477614 8:125249219-125249241 CAGTATAATAAAGTGGACTCTGG - Intronic
1049629362 8:143644348-143644370 CAGTTTTATTTACTGGCTTCTGG + Intronic
1052389532 9:27862969-27862991 CTGTATTATTAACTGGATATTGG - Intergenic
1052790660 9:32872797-32872819 AAATAGTATTAAGTGGAGTCAGG - Intergenic
1055593350 9:77840960-77840982 AAGGAGTATTAACTGGACTCTGG + Intronic
1055650344 9:78400655-78400677 CTGTATTATTATCTGGACTGTGG - Intergenic
1055935159 9:81597908-81597930 TAGTTTTATTAACAGGAGCCTGG - Intronic
1059126443 9:111691090-111691112 CAGTATTATTAGCTCCATTCTGG - Intronic
1061479562 9:130890401-130890423 CAGTGATATCAACTGGAGTGTGG - Intergenic
1202802822 9_KI270720v1_random:17283-17305 TATTATTATTATTTGGAGTCAGG + Intergenic
1203447609 Un_GL000219v1:74501-74523 TATTATTATTATTTGGAGTCAGG + Intergenic
1188768808 X:34128291-34128313 AAGGAATATTGACTGGAGTCGGG + Intergenic
1188795490 X:34458765-34458787 AAGGAATATTGACTGGAGTCAGG - Intergenic
1188835149 X:34946318-34946340 AAGGAATATTGACTGGAGTCTGG - Intergenic
1189007794 X:37013076-37013098 AAGGAATATTAACTGGAGTCTGG - Intergenic
1189040682 X:37539442-37539464 AAGGAATATTGACTGGAGTCTGG + Intronic
1189059145 X:37734207-37734229 CACAATTGTTAACTGGAGTATGG - Intronic
1193462259 X:81805652-81805674 CAGTATTATAATTTGAAGTCAGG + Intergenic
1193494699 X:82196947-82196969 CAGTATTGTGAACAGCAGTCTGG - Intergenic
1193837508 X:86363015-86363037 CAATATTATGAACTAGATTCTGG - Intronic
1194306251 X:92253347-92253369 CAGTAGTATAAACTGAAGTCAGG + Intronic
1195684300 X:107571652-107571674 CAGAATTACTGACTGGAGGCTGG - Intronic
1197078680 X:122385257-122385279 AACTATTTTTAACTGGAGTGAGG - Intergenic
1198096167 X:133381944-133381966 CACTTTTATTAACTTGATTCTGG - Intronic
1198294121 X:135268833-135268855 CTGTATTATAATCTGAAGTCAGG - Intronic
1202593933 Y:26516460-26516482 CACTATAATTAACTTGAATCAGG - Intergenic