ID: 922181537

View in Genome Browser
Species Human (GRCh38)
Location 1:223238479-223238501
Sequence AATGCTAGAAATTTTCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 383}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922181537 Original CRISPR AATGCTAGAAATTTTCATCT AGG Intronic
901621387 1:10590928-10590950 AATGCTATAAATGTTCCTTTGGG - Intronic
901938375 1:12643757-12643779 AATTTTAGAAATTTTAATTTGGG - Intergenic
904201225 1:28820529-28820551 AATATTATAAATTTTCAGCTGGG + Intronic
906962887 1:50430038-50430060 AATGTGAGACATTTCCATCTAGG + Intergenic
907228586 1:52973137-52973159 AGTGCTAGAAACTTTTCTCTAGG + Intronic
909713292 1:78676696-78676718 AATGCAAAATATTTTCATCCTGG + Intergenic
910233948 1:85015318-85015340 AATGCTATAAATTTTCCTCTAGG + Intronic
910315765 1:85881968-85881990 AGTGCTATAAATTTCCCTCTAGG + Intronic
910633560 1:89382483-89382505 AATGCTAGAAATTCTCTTCAAGG - Intronic
911001316 1:93169416-93169438 AATGTTATAAATTTCCCTCTAGG - Intronic
911008180 1:93249856-93249878 ATTGCTATAAACTTTCCTCTTGG + Intronic
911041738 1:93596704-93596726 AATGTTAGAGAATTTGATCTTGG - Intronic
911885641 1:103295643-103295665 AATTCTGGTAATTTTTATCTGGG + Intergenic
913475561 1:119233763-119233785 TAAGCTAGAATTTTTCATTTTGG + Intergenic
915032358 1:152892778-152892800 AATGTTAGAAATTTTTCTTTAGG + Intergenic
915543989 1:156585520-156585542 ACTTCTAGAACTTTGCATCTTGG + Intronic
916173732 1:162021309-162021331 AATGCTAAACATTTCCTTCTGGG + Intronic
916935323 1:169621661-169621683 AAGCCTAGAACTTTTCATCTGGG + Intronic
917775121 1:178325639-178325661 AAAGCTAGAAAGTTTCATAGTGG + Intronic
917860936 1:179143218-179143240 ATTGCTGGAAATTTTCCTTTAGG - Intronic
919571625 1:199256155-199256177 AATGCTATGAACTTTCCTCTTGG + Intergenic
920919423 1:210286018-210286040 AATGCTAGAATTTTTCTCCATGG - Intergenic
921782031 1:219176071-219176093 AAAGCTTGAGATTTTCTTCTAGG + Intronic
921888821 1:220333401-220333423 TATGCTCAAAAGTTTCATCTAGG + Intergenic
922131703 1:222786789-222786811 AAGGGTAGAAATCGTCATCTGGG - Intergenic
922181537 1:223238479-223238501 AATGCTAGAAATTTTCATCTAGG + Intronic
922183792 1:223256787-223256809 CCTGCTGGAAATTTTGATCTGGG - Intronic
922893236 1:229077768-229077790 AATGCTAGAACATTTCTTATAGG + Intergenic
923801607 1:237215197-237215219 AATGCTACATATTTTCCTCCTGG - Intronic
923836887 1:237621264-237621286 AGTGTTAGAAATTTCCCTCTTGG - Intronic
923904463 1:238368156-238368178 AGTGCTATAAATTTCTATCTAGG + Intergenic
1063817914 10:9798127-9798149 AATGGTAGAAGTTCTCATCATGG - Intergenic
1064864863 10:19867956-19867978 AATATTAGAAAGTTTCAACTAGG + Intronic
1064910619 10:20397872-20397894 AATGATAGAAAATTTCGGCTGGG + Intergenic
1065449078 10:25837117-25837139 AATGCAAGAAATATTCCTATAGG + Intergenic
1067191736 10:44076059-44076081 AATGCTATAAATTTTAGTCTTGG + Intergenic
1067675697 10:48374247-48374269 AGTGCTATAAATTTTCCTCTAGG - Intronic
1068084010 10:52351874-52351896 AATGAAAGTAATTTTCCTCTAGG + Intergenic
1068281443 10:54875954-54875976 ATTGAAAGAAATTATCATCTAGG + Intronic
1069001176 10:63267675-63267697 AGTGTTAGTAATTTTCATTTTGG - Intronic
1070994593 10:80765257-80765279 AGTGCTACAAATTTTCCCCTTGG + Intergenic
1071148631 10:82606163-82606185 AATGCTATAAATTTACTGCTAGG + Intronic
1071926308 10:90414090-90414112 CATGCTCCAAATTTTGATCTAGG - Intergenic
1072234857 10:93445023-93445045 AATGCTTAAAATTTTTACCTAGG + Intronic
1072449465 10:95528320-95528342 AAAATTAAAAATTTTCATCTGGG - Intronic
1072482025 10:95818298-95818320 AATGTCAGGAATTCTCATCTTGG + Intronic
1073997279 10:109329914-109329936 AATGCTATAAATCTTCTTCCTGG - Intergenic
1074235269 10:111578434-111578456 AATGCTAGAACATTCCAGCTGGG + Intergenic
1074806834 10:117062211-117062233 AATCTTAGAACTTTTCAGCTAGG + Intronic
1075652839 10:124140771-124140793 AAGGCTACACATTTTCCTCTGGG + Intergenic
1076436300 10:130445428-130445450 AATATTAGCAATTTTAATCTAGG - Intergenic
1076805310 10:132854142-132854164 AGTGCTGTAAATTTCCATCTCGG + Intronic
1078118200 11:8477283-8477305 AATGCAAAACATTTTCTTCTAGG - Intronic
1078161153 11:8840633-8840655 GATGGTAAAAACTTTCATCTTGG - Intronic
1078852222 11:15175183-15175205 AATGTTAGAAAGCTCCATCTAGG - Intronic
1079287604 11:19152677-19152699 AATGCGAGGTATTTTCATATGGG + Exonic
1079785633 11:24667923-24667945 CATGATAGATATTTTCCTCTTGG + Intronic
1080580670 11:33640768-33640790 AATTCTAAAAATATTCATCGAGG - Intronic
1080752916 11:35167062-35167084 AAGCCCAGAAGTTTTCATCTGGG - Intronic
1081202585 11:40235773-40235795 GATTCTAGATATTTTCTTCTTGG - Intronic
1081234280 11:40627143-40627165 AAATGTAGACATTTTCATCTAGG + Intronic
1081800659 11:45856859-45856881 ATTGATAGAAATCTTCATTTTGG + Intronic
1082574264 11:54783705-54783727 AATGGAAGAAATTTTTAACTGGG - Intergenic
1082721457 11:56682465-56682487 ATTGCTATAAACTTTCCTCTTGG - Intergenic
1083542236 11:63520215-63520237 AATGGCAGCAATTTTCTTCTAGG + Intergenic
1084368277 11:68717975-68717997 AATTCTAGATATTTTCTCCTGGG - Intronic
1086288798 11:85280891-85280913 TATGATAGAAATTTTTATTTAGG - Intronic
1086909697 11:92458068-92458090 AAAACTAGAAGTTTTCTTCTGGG - Intronic
1087395529 11:97592026-97592048 AATGCTATGAACTTTCCTCTTGG - Intergenic
1087460699 11:98442606-98442628 ATTGCTATAAACTTTCCTCTTGG + Intergenic
1087893962 11:103566838-103566860 AATGCTAGAAATTTGGATGTAGG - Intergenic
1088052473 11:105534170-105534192 ACTGCCAGAAATTCTCATCCCGG + Intergenic
1088551512 11:111018161-111018183 AATCCTAAAAATTTTCATGAAGG - Intergenic
1089102956 11:115979516-115979538 AATGTTCTAAATTTTGATCTGGG - Intergenic
1089901440 11:121989954-121989976 AATGCTAGACAATTTCCTGTGGG + Intergenic
1089958397 11:122594032-122594054 AAAGCAAGCAATTCTCATCTTGG - Intergenic
1090534067 11:127621124-127621146 GATGCTATAAATTTGCATGTTGG - Intergenic
1090887190 11:130888344-130888366 ATTACTAGAAATTTCCCTCTAGG + Intronic
1093296867 12:17402121-17402143 TAAGGTAGAAATTTTCATCCTGG - Intergenic
1093310492 12:17576316-17576338 ATTGCTATAGATTTTCATTTGGG + Intergenic
1093589900 12:20889824-20889846 AATGCTACAAACTTCCCTCTTGG + Intronic
1094459632 12:30680896-30680918 AATACTAGAAACATTCATGTAGG - Intronic
1094730323 12:33167074-33167096 AGTGCTATAAATTTCCCTCTAGG - Intergenic
1095260789 12:40096837-40096859 AATTCTAGAAAGTATCATCTTGG + Intronic
1095730724 12:45504143-45504165 AATGCCATGAATATTCATCTAGG - Intergenic
1096438194 12:51613720-51613742 AATGCTACAAATTTCCCTCTAGG + Intronic
1097502698 12:60425819-60425841 CATGCAAGAAATTTTCTTCCAGG - Intergenic
1097911713 12:64977299-64977321 AATGATGGAAATTGTCATTTTGG - Intergenic
1098020336 12:66149138-66149160 GATGATAGAAATTTTTTTCTGGG + Intronic
1098088201 12:66871302-66871324 AATGCTAGAAATATATAACTGGG - Intergenic
1099243915 12:80171992-80172014 AATGCTATAAGTTTTTATCTAGG + Intergenic
1099522791 12:83684540-83684562 AGTGCTATAAATTTTCCTCTAGG - Intergenic
1099524072 12:83697369-83697391 AGTGCTATAAATTTTCCTCTAGG - Intergenic
1100269267 12:93008300-93008322 AATTCTAAAATTTTTGATCTGGG - Intergenic
1101276517 12:103207723-103207745 AAATCCAGAGATTTTCATCTGGG + Intergenic
1102358681 12:112263495-112263517 ACTGCTATAAATTGTCATGTGGG + Intronic
1104225859 12:126832419-126832441 AATCCTGGATATTTTTATCTCGG + Intergenic
1106546139 13:30732422-30732444 AAAACTGGAAATTTTAATCTGGG + Intronic
1106727349 13:32499538-32499560 AAAGCTAGAAGTCTTCTTCTGGG + Intronic
1106938863 13:34754068-34754090 AGTGGGAGAAATTTTCTTCTAGG - Intergenic
1107623597 13:42259530-42259552 AAAACTGTAAATTTTCATCTTGG - Intergenic
1107937047 13:45353838-45353860 AATTCTCCAACTTTTCATCTTGG - Intergenic
1108441436 13:50457150-50457172 AATGATAGTAATTTTCATTATGG + Intronic
1108886843 13:55196646-55196668 AATGCTATACATTTCCCTCTGGG + Intergenic
1109856703 13:68138755-68138777 AATGAAAGAAATTTACATCTTGG - Intergenic
1110133241 13:72033288-72033310 AGTTCTAGAGATTTTCATCAGGG - Intergenic
1110504956 13:76274687-76274709 AATGCTATGAACTTTCTTCTTGG - Intergenic
1110577511 13:77075988-77076010 AATGCTACAAATAATCACCTTGG - Intronic
1110595189 13:77313216-77313238 AAAGCTATGAATTTTTATCTGGG - Intronic
1112534166 13:100234068-100234090 AATGTTAAAAGTTTTCTTCTAGG + Intronic
1112601902 13:100864664-100864686 ATTGCTATAAACTTTCTTCTTGG + Intergenic
1112703962 13:102044790-102044812 AATGCTTGAAATTTTGATGTTGG - Intronic
1112931692 13:104747694-104747716 TAGGGTAGAAATTTTCACCTTGG - Intergenic
1113443300 13:110346565-110346587 AATGCAGGCAATTTCCATCTCGG - Intronic
1113643278 13:111973592-111973614 AATGGAAGAAAATTTCACCTGGG - Intergenic
1114943017 14:27639873-27639895 AATGATAAATATTTTCATATAGG - Intergenic
1114990485 14:28280814-28280836 AAAGCAAGATATCTTCATCTCGG - Intergenic
1115140404 14:30164486-30164508 CCTGCTAGAAATTTACACCTCGG + Intronic
1118268038 14:64314361-64314383 AGTGCTATAAATTTCCCTCTTGG - Intronic
1119652278 14:76392340-76392362 AGTGCTAGAATTTATCAACTTGG + Intronic
1120249097 14:82040362-82040384 AATGGAAAAAATTTACATCTTGG + Intergenic
1120394369 14:83949996-83950018 ATTGCTATAAATTTCCCTCTAGG + Intergenic
1120534392 14:85675935-85675957 AATGCTTTAAAATTTCATTTAGG - Intergenic
1125788955 15:42348412-42348434 AATGACAGAAATGTTCCTCTTGG + Intronic
1126480483 15:49113610-49113632 ATTGCTACAAAATTTCCTCTTGG - Intronic
1127516833 15:59703330-59703352 AATGATAGAACATTTCATTTTGG + Intergenic
1127553708 15:60066404-60066426 GGTTCTAGAAATTTTCCTCTAGG + Intergenic
1128397570 15:67243802-67243824 AATGGAAGATATTTTTATCTGGG - Intronic
1130544965 15:84849757-84849779 AATGCTATACATTTTCTTCAAGG - Intronic
1130845642 15:87742134-87742156 AATGCTAGAATGTAGCATCTAGG - Intergenic
1131503914 15:92998781-92998803 AATAATAGAAATGTTCATTTAGG + Intronic
1133890811 16:9877019-9877041 AATGATGGAAATTTTCATATAGG - Intronic
1137245480 16:46699968-46699990 AAAGCTAGAAATCTGTATCTTGG - Intergenic
1137471755 16:48766775-48766797 AATGATAGAAACTTTCATAATGG + Intergenic
1139099913 16:63753311-63753333 AATGATAGAAATTTATATTTTGG + Intergenic
1139106562 16:63834078-63834100 ATTGCTAGAAATGATCATTTTGG + Intergenic
1139171293 16:64632854-64632876 AATGCTTGAAATTGTATTCTAGG + Intergenic
1139573705 16:67828556-67828578 GATGCTGGAAATATTTATCTAGG + Exonic
1140706793 16:77638198-77638220 ACTGCTGGGAATGTTCATCTAGG + Intergenic
1141404360 16:83778821-83778843 AATCCAAGACATTTTCTTCTGGG - Intronic
1143937485 17:10501964-10501986 AATGTTTAAAAATTTCATCTGGG - Intronic
1145387673 17:22428134-22428156 AATGACATAAATTTTCCTCTAGG + Intergenic
1149075354 17:52590998-52591020 ATTGCTATAAATTTTCCTGTTGG + Intergenic
1149151086 17:53564671-53564693 AATGAAAGAAATTTTCATCATGG + Intergenic
1150981151 17:70143240-70143262 AATGCCAGAATTCTTAATCTAGG + Intergenic
1151250177 17:72828332-72828354 AATGCAAGAAAGATTCAACTGGG + Intronic
1153478946 18:5528031-5528053 AATGCTAGAAATAGTGATGTGGG + Intronic
1153765311 18:8369041-8369063 AATGCAAAAAATCTTCAACTGGG + Intronic
1155369769 18:25085798-25085820 AATGCTTCATATTTTCAACTGGG + Intronic
1155851907 18:30784549-30784571 CATGCCAGAAATTTCCATTTAGG + Intergenic
1156380484 18:36555167-36555189 AATGCTGTAAATTTCCTTCTAGG + Intronic
1156619913 18:38838548-38838570 AATGTTATAAATTTTCCTCTAGG - Intergenic
1156808388 18:41215879-41215901 AATTCTAGAAATTTACAGCAAGG - Intergenic
1156953935 18:42938348-42938370 ATTTCAAGAAATTTTGATCTTGG + Intronic
1158056559 18:53287101-53287123 AATGCTAGAGAATTTCTTTTAGG - Intronic
1158572388 18:58607896-58607918 AATGCAAATAATTTCCATCTAGG + Intronic
1159232573 18:65628316-65628338 AATGCTAGAAATATACAAATTGG + Intergenic
1159504687 18:69320249-69320271 ATTGCTATAAACTTTCCTCTTGG + Intergenic
1159669463 18:71205052-71205074 CATGCAGTAAATTTTCATCTAGG - Intergenic
1159832577 18:73294906-73294928 ATTCCTAGATATTTTCATCCAGG - Intergenic
1162685665 19:12381757-12381779 AATGTTAAAAATGTACATCTAGG - Intronic
1164209554 19:23087110-23087132 AATGCTAGTAATTTTTGGCTGGG + Intronic
1166407960 19:42535954-42535976 AGGGCTATAAATTTCCATCTTGG + Intronic
926878140 2:17508537-17508559 ATCGCTAGAACTTTTCTTCTAGG - Intergenic
929197344 2:39198840-39198862 AATGCTATAAACTTTCCTCTTGG - Intronic
929888602 2:45900639-45900661 AATGGTAGAGATTTTCAGTTTGG + Intronic
930213246 2:48665456-48665478 AATGCTGTAAATTTCCCTCTAGG + Intronic
930570380 2:53078541-53078563 ATTGCTATAAACTTCCATCTTGG - Intergenic
930718433 2:54615177-54615199 AAAGTTAGAAACTTTCAACTAGG - Intronic
931068332 2:58613442-58613464 AAACCAAGAAATTTTCATCAAGG + Intergenic
931128924 2:59310310-59310332 AATGCTATAAATTTTCCTCTAGG - Intergenic
932652539 2:73574299-73574321 GATACTTGAAATTTTCCTCTTGG - Intronic
932852107 2:75197883-75197905 AATGCTAGGAATTCTCATTCAGG - Intronic
933410978 2:81924668-81924690 AATGCTATGAACTTTCTTCTTGG - Intergenic
935430705 2:102972911-102972933 AAGGATGGAAATTCTCATCTAGG - Intergenic
935873374 2:107476832-107476854 ACAGCTATAAATTTTCCTCTTGG - Intergenic
935894120 2:107715352-107715374 AATGTTCTATATTTTCATCTTGG - Intergenic
936747561 2:115596911-115596933 AATGCTAGAAAGTTGTATTTTGG + Intronic
936918138 2:117661032-117661054 AGTGCTAGGATTTTTCAGCTGGG - Intergenic
936983839 2:118289537-118289559 GATGGTAGAAATTTTTATCTAGG - Intergenic
937746280 2:125419607-125419629 AGTGCTATAAATTTCCCTCTAGG - Intergenic
939133679 2:138268652-138268674 AATTCTACAAATTTTAATTTAGG - Intergenic
939425101 2:142025455-142025477 AAAGCCAGAAATTTGAATCTAGG + Intronic
940010199 2:149045530-149045552 AATGCTATACATTTCCCTCTAGG + Intronic
940142981 2:150514778-150514800 AATGTTACAAATTTTACTCTAGG + Intronic
940402033 2:153258591-153258613 ATTGCTATAAACTTTCCTCTTGG + Intergenic
940440048 2:153703941-153703963 AAACATAGAAATTTTCATCTGGG - Intergenic
940481990 2:154244763-154244785 TATGGTAGAAAATTTCATTTGGG - Intronic
941505077 2:166333071-166333093 AATGCTATAATATTTTATCTTGG + Intronic
941564380 2:167088169-167088191 AAGTTCAGAAATTTTCATCTGGG + Intronic
942006426 2:171704896-171704918 AATGATAGTAATTTTTTTCTAGG + Intronic
942280018 2:174352451-174352473 AATTTTAAAAATTTTCAGCTGGG + Intronic
1168847559 20:955929-955951 ATGGCTTGAAATTTTCCTCTGGG + Intergenic
1169595015 20:7188596-7188618 AAAGCTAGAAGATTTGATCTTGG + Intergenic
1170386740 20:15827028-15827050 AATGGTAGAACTTTTCTTTTGGG + Intronic
1173111573 20:40195715-40195737 AATCTTAGATATTTTCCTCTTGG - Intergenic
1173218633 20:41112411-41112433 AGAGCTAGAAACTTTCTTCTGGG + Intronic
1174232432 20:49057316-49057338 AGTGCTAAGAATTTGCATCTAGG - Intronic
1174314700 20:49689454-49689476 AATGTTAAAAATTTTCACATCGG - Intronic
1175002909 20:55649263-55649285 AATGTAAGAAATTCTCACCTAGG + Intergenic
1175523080 20:59615296-59615318 GCTGTTATAAATTTTCATCTTGG + Intronic
1175792476 20:61749719-61749741 AAGGCTAAACATTTCCATCTGGG - Intronic
1177485631 21:21751670-21751692 CTTGCTAGAAATGTTCATTTGGG - Intergenic
1177508525 21:22050696-22050718 AATACTGAAAATTTTCTTCTTGG + Intergenic
1177934998 21:27334282-27334304 AATGCTATGAAGTTTCCTCTTGG - Intergenic
1178014069 21:28322562-28322584 AGTGCTAGAAATTTCCTTTTGGG + Intergenic
1178560654 21:33636513-33636535 AATACTATAAATTTTTATATTGG + Intronic
1178573784 21:33766132-33766154 AATTCTAGAGACTCTCATCTAGG + Intronic
1180040129 21:45272904-45272926 AATGCTGTGAATTTTCCTCTTGG - Intronic
1180144492 21:45911697-45911719 GCTGCTAGAACTTTCCATCTGGG - Intronic
1182000656 22:26916957-26916979 AATGCTATATATAGTCATCTGGG - Intergenic
1182865066 22:33597363-33597385 AATACTGGACATTTTCTTCTGGG - Intronic
1183932437 22:41243526-41243548 AATGCTAAAATATTTCTTCTTGG + Intergenic
949800889 3:7903179-7903201 AGTGCTGTAAATTTTCCTCTAGG + Intergenic
950487991 3:13284055-13284077 AAGGCTATAAATTTACCTCTGGG + Intergenic
952280605 3:31919546-31919568 AATTCTAGAAGGTGTCATCTTGG - Intronic
952724119 3:36564094-36564116 ATTTCTAGAATTTGTCATCTAGG + Intergenic
953560814 3:43991249-43991271 AGTGCTATAAATTTCCCTCTTGG - Intergenic
953750261 3:45603215-45603237 AATGCTCGATTTTTTAATCTAGG - Intronic
953873731 3:46650993-46651015 AATACTAGAAATTTCCCTGTAGG - Intergenic
956362563 3:68464631-68464653 AACTGTAGATATTTTCATCTAGG + Intronic
956490406 3:69765435-69765457 AATTATAGATATTTCCATCTTGG + Intronic
956550297 3:70450849-70450871 ATTGCTATAAACTTTCCTCTTGG - Intergenic
956954557 3:74321416-74321438 AATGACATAAATTTTCCTCTAGG - Intronic
957161240 3:76611894-76611916 ACTGCTATAAACTTTCCTCTTGG + Intronic
957402146 3:79730187-79730209 AATGCTATACTTTTTCCTCTAGG + Intronic
957860973 3:85948591-85948613 AATGCAAGAAAATTTCTTTTAGG - Intronic
957966482 3:87327987-87328009 AATGATAAAAGTGTTCATCTTGG - Intergenic
958699671 3:97572031-97572053 AATGCAAGCTATCTTCATCTTGG + Intronic
958701966 3:97603222-97603244 CCTGCTAGAAATTATCATATAGG - Intronic
958804239 3:98790505-98790527 AAAGTTATAAATTCTCATCTTGG + Intronic
958859274 3:99425910-99425932 AATGCGGGAAATTTTCCTCTTGG + Intergenic
959000171 3:100955149-100955171 CATGCTAGAAATATGCAGCTGGG - Intronic
959138977 3:102461721-102461743 AAGAATAGAAATTTTCTTCTAGG - Intronic
960264300 3:115602674-115602696 AATGCTAGAAACTGGCTTCTGGG - Intergenic
962029708 3:131586938-131586960 AATCCTCCAAATTTTCATATAGG - Intronic
962176650 3:133162423-133162445 AATGAGAGCATTTTTCATCTTGG - Intronic
962634054 3:137311405-137311427 AAGGCTATCAATTTTCCTCTGGG + Intergenic
963074409 3:141333025-141333047 AATTCTAGAAGTTTGCATTTTGG + Intronic
963541214 3:146591684-146591706 AATGAAAGAAGTTTTCATTTAGG - Intronic
963586915 3:147203845-147203867 AATGCTATATATTTTTTTCTAGG + Intergenic
965176389 3:165339394-165339416 AATGTTTGAAAGTTTTATCTAGG + Intergenic
965728947 3:171749492-171749514 AAAGCTAGACATTGTGATCTTGG - Intronic
965908070 3:173735231-173735253 ATTGCTAGAACTTTGCATTTTGG - Intronic
966000792 3:174945660-174945682 AATTCTAGGAATTTTAATATAGG - Intronic
966246246 3:177810914-177810936 AATGCTAGAAATATGTATGTCGG - Intergenic
966650383 3:182294427-182294449 AATGTTAGGAATCTTCATCCTGG + Intergenic
970196599 4:13557153-13557175 AATGCTAGAAATATAAATCTGGG + Intergenic
971226403 4:24756572-24756594 AAAGCTATAAATTTTCCTGTTGG + Intergenic
971354367 4:25881472-25881494 AATTCTATAAATTTTCAACATGG + Intronic
971538846 4:27789595-27789617 GATGCTTCAAATTATCATCTTGG + Intergenic
971601787 4:28601203-28601225 AGTGCTAAAAATGGTCATCTGGG - Intergenic
972047685 4:34688657-34688679 AATGCTATAAATTTCTCTCTTGG - Intergenic
972162971 4:36247416-36247438 ATTCCCAGTAATTTTCATCTAGG + Intergenic
972229172 4:37050519-37050541 AATGCTGGAGATTTTCACCATGG - Intergenic
972451911 4:39209340-39209362 AGTGCTATAAATTTTCTTCTAGG - Intronic
972912850 4:43839776-43839798 AATGCTAGAAATTTCCCTCTAGG + Intergenic
973025896 4:45270352-45270374 ATTGCTATAAATTTTCCTCATGG - Intergenic
974100518 4:57411196-57411218 AAGGCTAGAGATATTCATTTTGG - Intergenic
974773873 4:66454099-66454121 ATTGCTAAAAATTATCCTCTTGG - Intergenic
975360556 4:73465095-73465117 ATTGCTATAAACTTTCCTCTTGG - Intergenic
975494791 4:75025727-75025749 TATGCTAGAAATATTAATCTTGG - Intronic
976694939 4:87909385-87909407 AAAGGTTGAAATTTTCATTTGGG - Intergenic
977444494 4:97112471-97112493 AATTTTAAATATTTTCATCTTGG + Intergenic
977534465 4:98240949-98240971 AATGCTGTAAATCTTCATGTGGG + Intergenic
977912509 4:102554414-102554436 AATGTTCAAAATTTTCATTTCGG - Intronic
978930070 4:114299246-114299268 ATTGCTATAAATTTTCCTTTAGG + Intergenic
979128957 4:117015164-117015186 AATACTAGAAATTTTAATGTGGG - Intergenic
979488534 4:121297058-121297080 AATGGTAGAAAGTTTCAGTTAGG + Intergenic
979919074 4:126476506-126476528 AAACCTAGAAAGTTACATCTAGG - Intergenic
980211922 4:129800009-129800031 AGTCATAGAAATTTTCAACTAGG - Intergenic
980655349 4:135775819-135775841 AATGCTAGAGATTTTGGTCTAGG + Intergenic
981226054 4:142295601-142295623 AATGCAAGAAGCTTTCATCATGG - Intronic
981644164 4:146979513-146979535 ACTCTTAGAAATTTTCATGTGGG - Intergenic
982389204 4:154846531-154846553 AATGTAAACAATTTTCATCTTGG - Intergenic
982475870 4:155849895-155849917 AATACTGGAAATATTCATATAGG - Intronic
982538343 4:156635965-156635987 AAAGCTATAAACTTTCAACTTGG + Intronic
983039193 4:162904576-162904598 AATGGCAGAAATTTTAGTCTTGG - Intergenic
983851893 4:172591344-172591366 AATGCTAGTAATTTTAATGAAGG - Intronic
984235677 4:177155406-177155428 AATGCTACAAATTTTCCTACTGG - Intergenic
984718730 4:182950874-182950896 AATGCTATACATTTTCCTCTAGG - Intergenic
985206309 4:187541216-187541238 AATGTTAGCACTTTCCATCTTGG - Intergenic
985323365 4:188739276-188739298 AATGCTAGAAAAATTCAGATTGG + Intergenic
986267832 5:6205656-6205678 AAAAGTAGAAATTTTCACCTTGG + Intergenic
986566230 5:9117729-9117751 AATGCTATGAATTGTCACCTAGG - Intronic
987030170 5:13969452-13969474 AATGCTAGGAACTTTCCTTTTGG + Intergenic
987248413 5:16074257-16074279 AATGCTATGAACTTTCCTCTTGG - Intronic
988414627 5:30930534-30930556 TATGCTGGAAATTTGCATTTGGG + Intergenic
989588446 5:43091651-43091673 AAACCTAGAAATTTATATCTTGG - Intronic
989776562 5:45215410-45215432 CATGCTATAAATTTCCTTCTAGG - Intergenic
990938007 5:61171360-61171382 AATGGTAGAAATTTTAATACTGG + Intergenic
991474785 5:67007711-67007733 TATGGTAGAAATTGTCATCATGG + Intronic
991629540 5:68642369-68642391 TATGCTATAAATTTCCCTCTAGG + Intergenic
994079335 5:95688930-95688952 AATGATAAAATTTTTCAGCTTGG - Intronic
994207714 5:97054298-97054320 AATGCTATGAAATTTCCTCTTGG + Intergenic
994549797 5:101217682-101217704 ATTGTTAGAAATTTTCATTAAGG - Intergenic
994716104 5:103323410-103323432 AATGATGGAAATTTTCCACTGGG - Intergenic
994879851 5:105475968-105475990 AATGCTCACAATTATCATCTGGG - Intergenic
995178345 5:109205117-109205139 AATGCTATAAATTTCCCTCTAGG - Intergenic
995201692 5:109432289-109432311 AATACTATAAATTTCCCTCTAGG - Intergenic
995210907 5:109537504-109537526 AATGCTATAAATTCCCCTCTTGG - Intergenic
996013990 5:118510638-118510660 AATGCCAGAAACTCCCATCTAGG + Intergenic
996110407 5:119559372-119559394 AATGCTATGAACTTTCCTCTTGG - Intronic
996906168 5:128603218-128603240 ATTGCTATAAACTTTCCTCTTGG + Intronic
997123243 5:131198086-131198108 AATTCTAAAAATGTTCATTTGGG - Intronic
999346585 5:150827163-150827185 AAGGCTATAAAATTTCAGCTGGG + Intergenic
1000215784 5:159154469-159154491 TATGCTAGAATTTTGCATTTTGG - Intergenic
1001355172 5:171014270-171014292 AAAGGTAGAGATTTTCATCTAGG - Intronic
1003774900 6:9349252-9349274 AAAGCTATAAATTTTCTCCTAGG + Intergenic
1004173439 6:13317396-13317418 AAAGCTTTACATTTTCATCTAGG + Intronic
1004746877 6:18518799-18518821 AATGCCTGATATTTTCCTCTTGG + Intergenic
1004796373 6:19090454-19090476 AATGTTATATATTTTCATCTTGG + Intergenic
1004947934 6:20636108-20636130 AAGGTCAGAAATTTTCTTCTAGG + Intronic
1005761356 6:28970741-28970763 GATGATTGAAATTTACATCTTGG + Intergenic
1008231756 6:48991131-48991153 AATGCTATGAACTTTCTTCTTGG - Intergenic
1008772442 6:54995106-54995128 AATGCTATAAACTTTCCACTTGG - Intergenic
1009372712 6:62927296-62927318 ATACCTAGAAAATTTCATCTTGG + Intergenic
1009375644 6:62965128-62965150 AAAGCTAGAAATATTTCTCTTGG + Intergenic
1009627152 6:66148885-66148907 AATACTAGGTATTTTCATTTTGG + Intergenic
1009860196 6:69319862-69319884 AAAGCTAGAAACTTTCATATTGG - Intronic
1009981357 6:70729542-70729564 CCTGCCAGACATTTTCATCTTGG + Intronic
1010890029 6:81295587-81295609 AATGATATAAACTTTCATTTAGG + Intergenic
1011247634 6:85336362-85336384 AATTATACAAATCTTCATCTTGG - Intergenic
1012817083 6:104037652-104037674 AATGCTTCAAATTTTCACTTTGG + Intergenic
1013493388 6:110673059-110673081 AATGGTATAGATTTTCATTTTGG - Intronic
1013748625 6:113375296-113375318 ACTGGTAAAAATTTTCATCATGG + Intergenic
1015022854 6:128497495-128497517 AATACTTGAGATTTTTATCTTGG + Intronic
1015184394 6:130397635-130397657 AAAGCCAGAAATTTTCAGATTGG - Intronic
1017112449 6:150945606-150945628 AAAGCCTGAAATTTTCAACTTGG + Intronic
1018353030 6:162982438-162982460 CATGCTATGAATTTTCCTCTTGG + Intronic
1019831961 7:3339733-3339755 AGTGCTATAAATTTCCCTCTTGG - Intronic
1020462521 7:8441579-8441601 ATTGCTGGTAATATTCATCTGGG - Intronic
1021025006 7:15655506-15655528 ACTGTTATAAATTTCCATCTTGG + Intronic
1021272129 7:18602580-18602602 AATGCTATAAATTTGCCTCTAGG + Intronic
1021564313 7:22001623-22001645 CACTCTAGAAATTTTCATATGGG + Intergenic
1021734302 7:23627997-23628019 AATTAAAGAAATTTTAATCTTGG - Intronic
1023106127 7:36764805-36764827 AATGGTAGAGATTTTCTTTTAGG + Intergenic
1023247865 7:38225751-38225773 AAAGCCATAAATTTTCCTCTAGG + Intronic
1023456966 7:40350081-40350103 AATGCTACAGATTTTCTGCTAGG - Intronic
1023977600 7:45042302-45042324 AATGCTAGAAAATTTAACCTAGG - Intronic
1024368790 7:48555942-48555964 ATAGCTATAAATTTTCTTCTTGG + Intronic
1025754610 7:64325342-64325364 AAAGCTAGAAATAGTCATCCAGG - Intronic
1026439222 7:70429012-70429034 AATGGAAGATATTTTCTTCTGGG + Intronic
1027020560 7:74810503-74810525 AATACTATAAACTTTCAGCTGGG + Intronic
1027067465 7:75135427-75135449 AATACTATAAACTTTCAGCTGGG - Intronic
1028876565 7:95830090-95830112 AAATCTAGAAATTTTCATTAAGG - Intronic
1030366722 7:108655193-108655215 AATGCTAAAAATATAAATCTGGG + Intergenic
1030395858 7:108985976-108985998 AATTCTAGCAAATTTCTTCTTGG + Intergenic
1030429357 7:109423185-109423207 AATGTTATACATTTTCCTCTAGG + Intergenic
1030758968 7:113326685-113326707 AAAGCTATAAAATTTCAACTTGG - Intergenic
1031091662 7:117364309-117364331 TAAGCAAGAAATTTGCATCTGGG - Intronic
1031750512 7:125566389-125566411 AAAACTAGAAATTTTCCTATAGG + Intergenic
1033886593 7:145956156-145956178 AGTGCTATAAATTTTCCTCTTGG + Intergenic
1034720030 7:153283266-153283288 AAGGGTAGAAAATTTCATTTAGG - Intergenic
1034835444 7:154347614-154347636 ATTTCTAGAAATGTTCATGTAGG - Intronic
1035711185 8:1715838-1715860 AGTGCTACAAATTTCCCTCTAGG - Intergenic
1035903484 8:3482984-3483006 ACTGTTATAAATTTTCCTCTTGG - Intronic
1037421222 8:18705078-18705100 AATACAATAAATTGTCATCTAGG - Intronic
1037428417 8:18782941-18782963 AATGCAAGAAATATTCATAAGGG + Intronic
1038625172 8:29185524-29185546 AATCCTAAAGATTATCATCTTGG + Intronic
1039607812 8:38897381-38897403 TAGGCCAGAAGTTTTCATCTTGG + Intergenic
1039731004 8:40277765-40277787 AATACTAGACATTTCCCTCTAGG + Intergenic
1040035765 8:42868364-42868386 AATGTAGGAAATTTTCATATAGG - Intronic
1040420082 8:47231259-47231281 AATGCTATAAATTTTCCTCTAGG - Intergenic
1040884067 8:52240149-52240171 AAAGCTAGCAATTTTTCTCTTGG - Intronic
1042137599 8:65646574-65646596 AGTGCTAAAAATTTTATTCTTGG + Intronic
1044154830 8:88831916-88831938 AATACTATAACTTTTCAGCTAGG + Intergenic
1044906210 8:97006527-97006549 AAAGCTGGAATTTTTCATATAGG - Intronic
1045233387 8:100327700-100327722 GATGCTAGAAATTTCCCTTTAGG + Intronic
1045659513 8:104422693-104422715 AATCCTAGAAATTTTCAAAAGGG - Intronic
1045942214 8:107752242-107752264 AATGCTAGAAATGTTACCCTTGG - Intergenic
1046919447 8:119712870-119712892 ACAGATATAAATTTTCATCTAGG + Intergenic
1047056526 8:121170709-121170731 AAGGCTAGAGATGTACATCTGGG - Intergenic
1047227087 8:122965284-122965306 AATGCTATGAACTTTCCTCTTGG + Intronic
1047477996 8:125253622-125253644 AATGTTATAAATCTTCATCTTGG + Intronic
1048134315 8:131732633-131732655 AATGCTATATATTTCCCTCTGGG - Intergenic
1050110397 9:2209360-2209382 TGTTCTTGAAATTTTCATCTTGG + Intergenic
1050717980 9:8552004-8552026 ATTGCCAGAACTTTTCAACTTGG - Intronic
1050869877 9:10553899-10553921 TATGCTAAAAATTTACATTTTGG + Intronic
1051000330 9:12274118-12274140 TATGCTAGAAATTTTCCCCTGGG + Intergenic
1051540649 9:18212954-18212976 AATGCTAGTAATTTGCATTTAGG - Intergenic
1052137616 9:24934247-24934269 AATTCTCAAAATTTTCACCTGGG + Intergenic
1055914488 9:81386920-81386942 AATGGTGGAAATATTCATATGGG - Intergenic
1056239568 9:84631050-84631072 AATGCTGGAAATTTCCTTCTGGG + Intergenic
1056687805 9:88780890-88780912 AATGCTAGGAATTTTGAGATTGG - Intergenic
1056785629 9:89590887-89590909 AATACTAGAAGGTTTCAACTGGG - Intergenic
1057370366 9:94466520-94466542 AGTACTATAAATTTTCCTCTTGG - Intergenic
1059956642 9:119522875-119522897 AATGCAAGCAATTTTGATGTGGG - Intronic
1060093863 9:120769402-120769424 AAAACTAGCAACTTTCATCTAGG + Intronic
1060465517 9:123901313-123901335 AAGGCTAGATATTTGCATTTAGG + Intronic
1060809688 9:126604376-126604398 AAAGCCAGAAAATTCCATCTTGG - Intergenic
1060837738 9:126769615-126769637 AATGCTATGAATTTCCCTCTAGG - Intergenic
1186204214 X:7184316-7184338 AATTCTAGCAATTTCCATCGTGG + Intergenic
1186848001 X:13550786-13550808 AATGTTTGAAATTCTCATGTTGG + Intergenic
1186986297 X:15017576-15017598 AATGCTACATATATTCTTCTAGG + Intergenic
1186993916 X:15099603-15099625 AATAATAGATATTTTCATATTGG - Intergenic
1187559617 X:20389611-20389633 AATGCTATAGATTTTCCTCTAGG - Intergenic
1187577508 X:20573684-20573706 AATGCTTGCTATTTTCATTTTGG + Intergenic
1187935618 X:24332943-24332965 TATGATAGATATTTTTATCTAGG - Intergenic
1188280680 X:28264565-28264587 AATGATATAAATTTCCTTCTAGG - Intergenic
1188975432 X:36667789-36667811 AATGCCATAAATTTTCCTCTTGG + Intergenic
1189072705 X:37881632-37881654 AATGTTGGAAATTTGCATTTTGG + Intronic
1190479158 X:50858543-50858565 ACAGCTATAAATTTTCCTCTAGG + Intergenic
1191771856 X:64769133-64769155 AAACTTAGAAATTTTCATTTGGG + Intergenic
1193272064 X:79540809-79540831 ATTGCTACAAACTTCCATCTTGG + Intergenic
1193491650 X:82157513-82157535 AAAAAGAGAAATTTTCATCTGGG - Intergenic
1194745607 X:97624961-97624983 ACTGCTAGAAAGTTGAATCTTGG - Intergenic
1194863598 X:99036499-99036521 AATGCTATAATGTTTCTTCTAGG - Intergenic
1195268567 X:103208738-103208760 AATGCTATAAATTTCCTTCTAGG + Intergenic
1195556104 X:106226656-106226678 ATTTCAAGAAATTTTCTTCTGGG + Intergenic
1195873308 X:109510156-109510178 ACTGCTATAAACTTTCCTCTTGG - Intergenic
1195925467 X:110020403-110020425 AAGGCTAGAAATGTTGATTTAGG + Intronic
1196532297 X:116802917-116802939 ATAGCTATAAATTTTCTTCTTGG + Intergenic
1196542604 X:116926761-116926783 AATAGTAGAAGTTTTAATCTGGG + Intergenic
1197084779 X:122458981-122459003 TATGTAAGAAATTTTCACCTTGG + Intergenic
1197474773 X:126907933-126907955 AGTGCTATATATTTCCATCTAGG - Intergenic
1199371994 X:147060358-147060380 AAAGCTAGTAATTTACATTTTGG + Intergenic
1199372912 X:147072713-147072735 AACTCTATAAATTTTCAACTGGG + Intergenic
1199475619 X:148241884-148241906 ATTGCTAGATATTTTCTCCTGGG - Intergenic
1199653214 X:149968891-149968913 AAGGCTAGAAATATTTATTTGGG - Intergenic
1199895540 X:152123487-152123509 GGTTCTAGAAATTTACATCTGGG + Intergenic
1200346397 X:155453429-155453451 AAAGCTATAAATTTTCCTTTAGG - Intergenic
1201079782 Y:10229018-10229040 AATCAAAGAAATTTTCAACTCGG + Intergenic
1201351254 Y:13044116-13044138 AATGCTGTAAACTTTCCTCTTGG - Intergenic
1201391839 Y:13506117-13506139 AATTCTGTAAATTTTCATCTTGG - Intergenic
1201574563 Y:15448424-15448446 AAAGCTAGAAAGTTTAAGCTTGG + Intergenic
1201666334 Y:16460545-16460567 TATGCTAGAATTTTTTTTCTTGG - Intergenic
1201930987 Y:19347368-19347390 AAAGCTAGAAATATTCTCCTAGG - Intergenic