ID: 922183792

View in Genome Browser
Species Human (GRCh38)
Location 1:223256787-223256809
Sequence CCTGCTGGAAATTTTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922183792_922183802 28 Left 922183792 1:223256787-223256809 CCCAGATCAAAATTTCCAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 228
Right 922183802 1:223256838-223256860 GTAGTGTCAGTAGAAGGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 149
922183792_922183801 27 Left 922183792 1:223256787-223256809 CCCAGATCAAAATTTCCAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 228
Right 922183801 1:223256837-223256859 AGTAGTGTCAGTAGAAGGTGTGG No data
922183792_922183800 22 Left 922183792 1:223256787-223256809 CCCAGATCAAAATTTCCAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 228
Right 922183800 1:223256832-223256854 AGAAGAGTAGTGTCAGTAGAAGG 0: 1
1: 0
2: 1
3: 23
4: 213
922183792_922183798 -4 Left 922183792 1:223256787-223256809 CCCAGATCAAAATTTCCAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 228
Right 922183798 1:223256806-223256828 CAGGTAGTCTGGGTCTTAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922183792 Original CRISPR CCTGCTGGAAATTTTGATCT GGG (reversed) Intronic
900799528 1:4728712-4728734 CTTGCTGGAAACTTCTATCTTGG + Intronic
902076875 1:13794068-13794090 CCTTCAGGAAATTCTGAACTTGG - Intronic
905794738 1:40809338-40809360 CCGGCTGGAAATGCAGATCTGGG - Intronic
909501026 1:76336082-76336104 CCTGCTGTGCATTTTAATCTTGG - Intronic
909536405 1:76741401-76741423 GCTGCCGGGAATTTTGAACTGGG - Intergenic
909988468 1:82191812-82191834 CCTGCTGGAAACTATGTTCATGG + Intergenic
910213848 1:84821790-84821812 CCTGATGAATATTTGGATCTAGG + Intronic
910805715 1:91188404-91188426 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
916001484 1:160620443-160620465 CCATCTGGAAATTTTGCTCAGGG + Intronic
916430934 1:164727719-164727741 GCTGCTGGAAATTTGGATACAGG + Intronic
916523740 1:165589832-165589854 CCTCCTTGAAATTTTCCTCTTGG + Intergenic
916631487 1:166618679-166618701 CCTGCTGGTACCTTAGATCTGGG + Intergenic
919596704 1:199572965-199572987 CGTGCTGGAAAATTACATCTAGG - Intergenic
921340297 1:214128027-214128049 CCTCCTGGAAATTTTGCACCAGG + Intergenic
922074119 1:222225867-222225889 CTTGCTGGATATTTTTATGTTGG + Intergenic
922181537 1:223238479-223238501 AATGCTAGAAATTTTCATCTAGG + Intronic
922183792 1:223256787-223256809 CCTGCTGGAAATTTTGATCTGGG - Intronic
922661982 1:227438037-227438059 CCTGCCAGAAATCTTAATCTGGG - Intergenic
923630202 1:235644755-235644777 CCTGCTGGAAATTTCCATCCAGG + Intronic
1063262464 10:4405834-4405856 CCTAAAGGAAAGTTTGATCTGGG + Intergenic
1071119044 10:82256655-82256677 TCTTCTGAAAATTTTGAACTGGG + Intronic
1071696265 10:87875800-87875822 ACTTAAGGAAATTTTGATCTAGG + Intronic
1071786875 10:88910738-88910760 CCTGCTGGAAAGTTATATTTTGG + Intronic
1071926308 10:90414090-90414112 CATGCTCCAAATTTTGATCTAGG - Intergenic
1072099293 10:92214359-92214381 CCCACTGGCAACTTTGATCTTGG + Intronic
1072283069 10:93887789-93887811 GCTGCAGGAAATATTGACCTTGG + Intergenic
1073822354 10:107278952-107278974 ACTGCAGGAGATTTTGTTCTGGG + Intergenic
1073880548 10:107975032-107975054 CCTGCTGAAAACTTTCACCTGGG + Intergenic
1077122988 11:919096-919118 CCCGGTGGACATCTTGATCTTGG + Intergenic
1079799768 11:24854385-24854407 GCTGCTGGGAAGTTTGAACTGGG - Intronic
1080247142 11:30192260-30192282 ACTCCTGGAAATGCTGATCTAGG - Intergenic
1080699701 11:34634296-34634318 CCTGCTGGTAACTTTGATTAAGG + Intronic
1081709087 11:45205523-45205545 CTGGCTGGAGATTTGGATCTGGG + Intronic
1082126040 11:48432256-48432278 CCTGATGGCATTTTTCATCTGGG + Intergenic
1082249604 11:49963850-49963872 GCTGCTGGGAAGTTTGAACTGGG + Intergenic
1082559625 11:54603108-54603130 CCTGATGGCATTTTTCATCTGGG + Exonic
1083258925 11:61512825-61512847 CCTTCTGGAAAGTTTGAGTTTGG + Intergenic
1086846454 11:91755628-91755650 CCTCATGGAAATTTTAGTCTAGG - Intergenic
1087390009 11:97519896-97519918 CCTCCTGAAAATTTTGAGCATGG - Intergenic
1088527029 11:110767812-110767834 TCTGCTGGATATCTTGAACTAGG + Intergenic
1089052880 11:115561307-115561329 CCTACCAGAAGTTTTGATCTTGG - Intergenic
1089393995 11:118123014-118123036 TCTGCTGGCAACCTTGATCTTGG + Intergenic
1089640591 11:119844954-119844976 CTTGCTGGAAACTTGGGTCTCGG - Intergenic
1090074224 11:123569364-123569386 CCTGCTGGTATTTGTGATTTGGG + Intronic
1091392271 12:132784-132806 GCTGCTGGAAATGTGGGTCTAGG + Intronic
1092332169 12:7594589-7594611 GCTGCTGGGAAGTTTGAACTGGG + Intergenic
1092396242 12:8129414-8129436 CTTACTGGAAATATTGATTTGGG - Intronic
1093079233 12:14790118-14790140 CCTGCTGCCAATTTAGAGCTAGG + Intronic
1099071347 12:78048982-78049004 CCCGCTGGGAATTTTGGACTGGG - Intronic
1100804702 12:98269994-98270016 CCTTCTGGTAATTTTGAGTTTGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103170799 12:118817806-118817828 CCCCCAGGAAATTTTGATATAGG + Intergenic
1106409639 13:29502479-29502501 CCTGCTGGAAATGCTGCTCTAGG - Intronic
1107442895 13:40444055-40444077 CCAGCTGAAAATTTTGCTTTTGG + Intergenic
1108221305 13:48235831-48235853 TCTGCGGGATATTGTGATCTGGG - Intronic
1108223499 13:48263423-48263445 CATGCTGGAAACTGTGGTCTTGG + Exonic
1110324702 13:74200481-74200503 CGTCTTGGAAATTTTGTTCTAGG + Intergenic
1110637759 13:77786382-77786404 CCTGCTGGAGATGTTGCTCTTGG + Intergenic
1112308020 13:98292856-98292878 CCTGCTGGTAACTCTGGTCTAGG + Intronic
1112703962 13:102044790-102044812 AATGCTTGAAATTTTGATGTTGG - Intronic
1113273208 13:108698154-108698176 CCAGCTGGAAATTTGGAATTGGG - Intronic
1114531923 14:23401889-23401911 CCAGCTTGACACTTTGATCTGGG + Intronic
1114654051 14:24305366-24305388 CCTGGGGGACATCTTGATCTTGG + Exonic
1114846578 14:26330330-26330352 CCTCCTGGAAATTTCCATGTGGG - Intergenic
1115140404 14:30164486-30164508 CCTGCTAGAAATTTACACCTCGG + Intronic
1116002231 14:39256810-39256832 CCTTCTGGAAATTCTATTCTTGG - Intronic
1117096912 14:52308179-52308201 CCTGCTGTAAATTTTAATTCTGG + Intergenic
1120522173 14:85536188-85536210 CCTGCTGGAGAGTTTGATTTAGG + Intronic
1120725866 14:87940448-87940470 CCTACTTGAAATTTTGTCCTGGG - Intronic
1121081168 14:91109498-91109520 GCTGATGAAAATGTTGATCTAGG - Intronic
1121085968 14:91146368-91146390 CATGCTGGAAATTGTGCTCAGGG - Intronic
1122020379 14:98833314-98833336 CCAGCTGGGAATTTGGTTCTTGG - Intergenic
1122639552 14:103150369-103150391 CCTTCTGTAAAGTTTGTTCTAGG - Intergenic
1123971499 15:25511918-25511940 TCTGCTGGCATTTTTGATCTAGG + Intergenic
1126720104 15:51569316-51569338 GCTGCTGGGAAGTTTGAACTGGG + Intronic
1127326969 15:57905427-57905449 TCTGCTCCAAATTTGGATCTTGG + Intergenic
1127996433 15:64155686-64155708 CCTGCCTGAAATTTTGACCCAGG - Exonic
1129062319 15:72869871-72869893 ACCCCTGGACATTTTGATCTGGG + Intergenic
1129507939 15:76098839-76098861 GCTGCTGGGAAGTTTGAACTGGG - Intronic
1130178516 15:81600692-81600714 CCTGCAGAAAATTTTAAGCTTGG - Intergenic
1130817639 15:87455214-87455236 CCTGCTGCATATTTTCCTCTGGG + Intergenic
1131461993 15:92624075-92624097 CCTGCGGGCAATTTTCATTTAGG - Intronic
1133305140 16:4803830-4803852 CCTTCTGCAAATTATGATTTTGG + Exonic
1133520819 16:6554921-6554943 CCAGCTGGAGAATTTGACCTAGG + Intronic
1135100346 16:19599728-19599750 CCTTCAGGAAATTTTAATGTAGG + Intronic
1137237562 16:46627990-46628012 CCTGCTGGAAAACTTGATGTAGG + Intergenic
1139573705 16:67828556-67828578 GATGCTGGAAATATTTATCTAGG + Exonic
1140706793 16:77638198-77638220 ACTGCTGGGAATGTTCATCTAGG + Intergenic
1143037258 17:4006467-4006489 CTTGCTGGAAAGGTGGATCTGGG + Exonic
1144457968 17:15434323-15434345 CCTGCTGGTCATTTTCATGTTGG - Intergenic
1146521065 17:33525967-33525989 AGTGCAGGAAATTTTGACCTAGG - Intronic
1148371515 17:47103124-47103146 CCCTTTGGAAACTTTGATCTTGG + Intergenic
1149775456 17:59353522-59353544 CCTGCTGGAAATGTGTACCTTGG - Exonic
1150075270 17:62186775-62186797 CCTGCTGGAATCTATGATCTAGG + Intergenic
1151452230 17:74204983-74205005 CCTGCTTCAAATTTTGATCTTGG - Intronic
1153077043 18:1174980-1175002 CCACATGGAAATTTAGATCTTGG + Intergenic
1153660604 18:7322335-7322357 CCTGCTGCAGATTTTTATATGGG + Intergenic
1158845190 18:61434609-61434631 CCTGCTGCAAAATTTGTCCTGGG + Intronic
1159669463 18:71205052-71205074 CATGCAGTAAATTTTCATCTAGG - Intergenic
1160973098 19:1778610-1778632 CCTGCTGGAAATTTAGGACTTGG + Exonic
1163565638 19:18049574-18049596 CCTGCTGGAAAACTAGCTCTGGG + Intergenic
1163738202 19:18994755-18994777 CCTGCTGGAGGTTATGATCGGGG + Intronic
1164492968 19:28731176-28731198 CCTGCTGGAAAACTTGACCTGGG + Intergenic
1166982502 19:46639457-46639479 CCTGGTGGAGATTTGGGTCTCGG + Intergenic
1167603574 19:50468057-50468079 CCTACTTGAAATTTCCATCTGGG + Intronic
1167645790 19:50704155-50704177 ATTGCTGGGAATTTTGAGCTGGG - Exonic
925325879 2:3021753-3021775 CCTCCTGGAAACTTTCCTCTTGG - Intergenic
925566360 2:5258455-5258477 GCCGCTGGGAATTTTGAACTGGG - Intergenic
926197642 2:10773344-10773366 CCTGCTGGAACTTTGGTTTTGGG + Intronic
927417267 2:22892305-22892327 TCTGCTGGCACCTTTGATCTTGG - Intergenic
932110391 2:68994012-68994034 ATTGCTGACAATTTTGATCTTGG - Intergenic
933475580 2:82785801-82785823 TCTTCTGGAATTTTTCATCTAGG - Intergenic
937597570 2:123689208-123689230 CGTGCTGGCAGTTTTGATTTTGG - Intergenic
937672746 2:124556383-124556405 CCAAGAGGAAATTTTGATCTTGG - Intronic
938341695 2:130540334-130540356 CGTGCTCGAGATTTTGATCCAGG - Intronic
938348134 2:130580375-130580397 CGTGCTCGAGATTTTGATCCAGG + Intronic
938421269 2:131148906-131148928 ACTGGTGGTAATTTTGAACTTGG + Intronic
940492695 2:154384831-154384853 CATTCAGGAAATTTTTATCTTGG + Intronic
940964542 2:159822415-159822437 GCTGCTGGGAAGTTTGAACTGGG + Intronic
941135654 2:161715119-161715141 TTTGCAGGCAATTTTGATCTTGG - Intronic
941162084 2:162047023-162047045 ACAACTTGAAATTTTGATCTGGG - Intronic
941180955 2:162258773-162258795 GCTGCTGGAGATTTTCATCCAGG - Intergenic
941862723 2:170300693-170300715 CCTGCTGGCTATTTTCACCTTGG + Intronic
942732607 2:179076280-179076302 CCTGCTGGGAAGTTTGAACTGGG + Intergenic
942986406 2:182148075-182148097 ACTACCTGAAATTTTGATCTTGG - Intronic
943815621 2:192250526-192250548 CCTGATGGACATTTTCATATAGG - Intergenic
944607943 2:201369993-201370015 GCTGCTGGGAAGTTTGAACTGGG + Intergenic
945757331 2:213863337-213863359 TCTTTTGGAAATTTTGTTCTTGG + Intronic
946103100 2:217343935-217343957 CCTCCTGCAATTTTTGAGCTGGG - Intronic
946508260 2:220325039-220325061 CCTGGTGGCTATTTTGGTCTGGG + Intergenic
947966917 2:234289706-234289728 CCTGGAGGAAATTTGGGTCTGGG - Intergenic
948163888 2:235846166-235846188 ACTGTTGGAAATTTCGATCTAGG + Intronic
1169611855 20:7389941-7389963 CATGCTGGAATCTGTGATCTAGG - Intergenic
1173919619 20:46733906-46733928 CCAGCTGGAACTTGTGCTCTGGG - Exonic
1174009349 20:47436983-47437005 CCTTCTGAAAGTTTTGTTCTTGG + Intergenic
1174546440 20:51328846-51328868 CCAGCTAGTAATTTGGATCTAGG - Intergenic
1176243610 20:64086327-64086349 CCTGCTGCAAATTATGGACTAGG - Intronic
1178753273 21:35324192-35324214 CGTGCTGAGAATTTTCATCTGGG - Intronic
1180025420 21:45158389-45158411 CCATCTGGAAGTTTTGCTCTAGG + Intronic
1182227889 22:28813906-28813928 TCTGCTGGGAATTTTGTTCCAGG - Intergenic
949710507 3:6864835-6864857 CTTCCTGGAAATTTGGACCTGGG + Intronic
950317207 3:12013518-12013540 CCTGCTGGACATCTCCATCTGGG + Intronic
950477859 3:13225085-13225107 CCTGCATGAGAATTTGATCTCGG - Intergenic
951441199 3:22726116-22726138 CCTGCATGAAATTCTGCTCTAGG - Intergenic
951844163 3:27067631-27067653 CCTGCTGGAACTTCTGATATAGG - Intergenic
951963712 3:28357585-28357607 TCTGCTTGAATATTTGATCTGGG + Intronic
951972143 3:28458633-28458655 CCTGCTTGAAATTTACATCGGGG + Intronic
952170268 3:30799222-30799244 CCTGCAGCAAACTTTTATCTGGG + Intronic
953668880 3:44946069-44946091 GGAGCTGCAAATTTTGATCTGGG - Intronic
953779178 3:45851104-45851126 CCTTGTTGAAATTTTGAACTCGG + Intronic
956661243 3:71600250-71600272 CTTCCTGGAAAATTTGATGTGGG - Intergenic
956765518 3:72481354-72481376 CCTGCTAGCAGTTTTGATGTTGG - Intergenic
957595596 3:82261256-82261278 CCTGCAAAATATTTTGATCTTGG - Intergenic
958257445 3:91341152-91341174 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
958701966 3:97603222-97603244 CCTGCTAGAAATTATCATATAGG - Intronic
958737453 3:98025722-98025744 GCTTCTGGATATTTTGATTTAGG + Intronic
960040929 3:113149251-113149273 CCTGGAGGAACTTTTGCTCTGGG - Intergenic
961786698 3:129351858-129351880 CCTGCATGAGAATTTGATCTTGG + Intergenic
961998232 3:131269031-131269053 GCTGCTGGGAAGTTTGAACTGGG - Intronic
963013947 3:140803049-140803071 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
963446340 3:145413947-145413969 CCTTCTGGAAATTTTGTAATTGG + Intergenic
963807693 3:149742128-149742150 CCTTCTGTATATTTTTATCTTGG - Intronic
964003443 3:151804884-151804906 CCTGGAGTACATTTTGATCTTGG - Intergenic
964446521 3:156764840-156764862 ACTGCTGGAAATTCTTACCTAGG + Intergenic
965834713 3:172838597-172838619 CCTGTGGGAACTTTTCATCTGGG + Intergenic
967388470 3:188932282-188932304 CCTTCTGGAATATTTGATTTTGG - Intergenic
968152435 3:196347687-196347709 CCTGTTGTAATATTTGATCTTGG - Exonic
972743257 4:41909272-41909294 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
974096709 4:57372200-57372222 TGTGCTGGAAATATTGATCAGGG + Intergenic
974326285 4:60419124-60419146 GCTGCTGGGAAGTTTGAACTAGG - Intergenic
975577036 4:75873605-75873627 CCTGCTAGAAGCTTTGATCATGG + Intronic
975585780 4:75947209-75947231 CATTCTGCAAATTTTGATGTTGG + Intronic
975887939 4:78987801-78987823 TCTAATGGAAATTTTTATCTAGG + Intergenic
976438311 4:85044022-85044044 GCTGCTGGGAACTTTGAACTGGG + Intergenic
978716328 4:111847417-111847439 ACATCTGGAAACTTTGATCTGGG - Intergenic
979113435 4:116788978-116789000 CCTTCTGGGCATTTTGAGCTAGG - Intergenic
980478170 4:133347518-133347540 CTCGCTGGAAATCTTGATCTTGG + Intergenic
981494827 4:145379324-145379346 GCGGCTGGGAATTTCGATCTGGG - Intergenic
983717754 4:170806082-170806104 CATTCTGCAAATTTTGATGTGGG + Intergenic
984113781 4:175652174-175652196 CCTGCTGGAAAATCATATCTTGG + Intronic
984644581 4:182205757-182205779 CCTTGTGGAAATTTTTATCTTGG + Intronic
984792544 4:183627822-183627844 GCTGTTGGAAGTTTTGGTCTGGG - Intergenic
989767456 5:45104001-45104023 CCTGCAGCAAACTTTTATCTGGG - Intergenic
993381838 5:87217631-87217653 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
995413087 5:111880404-111880426 CCTGCTGACATATTTGATCTTGG - Intronic
996165258 5:120214945-120214967 CCTGCTGGAAATTTAGTTATAGG + Intergenic
996468250 5:123828350-123828372 CCTTCTGCAAATTTTGAGCTTGG - Intergenic
998568433 5:143236369-143236391 TCTGCTCCAAATTTTGATCATGG + Intergenic
999104802 5:149061940-149061962 TCTGCTTGAAGTCTTGATCTAGG - Intronic
1000860401 5:166450292-166450314 GCTGCTGGAGAGTTTGAACTGGG - Intergenic
1001861442 5:175059119-175059141 CCTCCTGGAAGATTTGACCTTGG - Intergenic
1002402183 5:178996893-178996915 CCTGATGGAGATTTGGCTCTTGG + Intergenic
1005198493 6:23316332-23316354 CAGGCAGGAAATTTGGATCTGGG + Intergenic
1008308053 6:49929559-49929581 CTTGCTGGAATTTTTGATAGTGG - Intergenic
1008469646 6:51869452-51869474 CCTCCAGGAACTCTTGATCTAGG - Intronic
1009186349 6:60579209-60579231 GCTGCTGGGAAGTTTGAACTGGG + Intergenic
1009981357 6:70729542-70729564 CCTGCCAGACATTTTCATCTTGG + Intronic
1010002253 6:70958848-70958870 CCTGTTGGAAATTTTAAATTTGG + Intergenic
1010106295 6:72172886-72172908 CCTGCTCGAAATTTCTCTCTAGG + Intronic
1011681168 6:89784626-89784648 CTTAATGGACATTTTGATCTAGG - Intronic
1012103149 6:95117502-95117524 CCTGATAGTAACTTTGATCTTGG - Intergenic
1014466343 6:121760869-121760891 GCTGCTGGGAAGTTTGAACTGGG + Intergenic
1016028066 6:139309069-139309091 CCAGCTGGAACTTTGAATCTGGG + Intergenic
1016272750 6:142307847-142307869 CCTGATGGAAATTCTAAACTAGG - Intronic
1016553519 6:145309380-145309402 GCTGCTGGAGATTTTGCACTAGG - Intergenic
1017109344 6:150917754-150917776 CTTGCTAGAAATTGTGATGTTGG - Intronic
1019126150 6:169841233-169841255 ACTGCAGTAAATTCTGATCTGGG - Intergenic
1020376261 7:7490816-7490838 CCTAGTGGATAATTTGATCTTGG - Intronic
1020694055 7:11392759-11392781 GCTGCTGGGAAGTTTGAACTGGG + Intronic
1023504808 7:40888489-40888511 ACTGCTGGAAAACCTGATCTTGG - Intergenic
1023769066 7:43538124-43538146 CATGCTGAAAATTTAGACCTAGG + Intronic
1024664889 7:51536527-51536549 GCTGCTGGGAAGTTTGAACTAGG - Intergenic
1024800323 7:53070036-53070058 CCTGTTGGCATTTTTTATCTTGG - Intergenic
1024904585 7:54362149-54362171 CCTGCTGACATCTTTGATCTTGG - Intergenic
1028194584 7:87890924-87890946 CATACTGGAAATTTTTATTTTGG + Intronic
1029324737 7:99796477-99796499 GCTGCTGGGAAGTTTGAACTGGG - Intergenic
1029550578 7:101235187-101235209 AGTGCTGGACATTTTGACCTTGG + Intronic
1030512911 7:110506731-110506753 CTTGCTTGAAATCTTGATTTGGG - Intergenic
1031439615 7:121777758-121777780 CCTCCTGGCAATTTCCATCTGGG - Intergenic
1032109811 7:129066396-129066418 CCTGCTGGAAATTTAGAAGCTGG - Intergenic
1032692949 7:134307646-134307668 TCTTCAGGAAATGTTGATCTTGG + Intronic
1033280645 7:140004134-140004156 CAGTCTGGAAATTTCGATCTGGG - Intronic
1033629816 7:143146625-143146647 CTTGCTGGAAATTCAGATGTTGG - Intergenic
1033819990 7:145123803-145123825 ATTGCTGAAAATTTTGACCTTGG + Intergenic
1041502276 8:58552722-58552744 TCTGTTGGAAATTTGGATGTTGG - Intergenic
1042163685 8:65923871-65923893 CCTGCTGGAAAATATAAACTTGG + Intergenic
1042809206 8:72805543-72805565 CCTGCTGCAAATAAAGATCTTGG + Intronic
1044145803 8:88712324-88712346 TTTTCTGGAAATTATGATCTGGG - Intergenic
1048700481 8:137083198-137083220 CCTCCTGGAAGTTTTGGACTGGG + Intergenic
1049125493 8:140783299-140783321 CCTGATGGAAATCTTGATCTTGG - Intronic
1049510742 8:143025564-143025586 CCTGGTGGAAGCTTAGATCTGGG - Intergenic
1051600790 9:18871568-18871590 CCTGATGGATTTTTTCATCTTGG + Intronic
1051609820 9:18950273-18950295 GCTGCTGTAAATTTTGAATTGGG - Intronic
1055511782 9:77002253-77002275 CCTGAAGAAAATATTGATCTTGG + Intergenic
1058551490 9:106120112-106120134 CCTGCTGGAGTTTATGACCTAGG + Intergenic
1059969476 9:119650610-119650632 TCTCCTGGAAATTTGGAACTGGG - Intergenic
1203611628 Un_KI270749v1:12423-12445 CCTGATGGGAATTTTAAACTGGG - Intergenic
1185838835 X:3369808-3369830 TCTGCTCGAAATTTTGAAATAGG - Intergenic
1187441706 X:19326641-19326663 CCAGCTGGAAGTGTTAATCTAGG + Intergenic
1187807693 X:23139187-23139209 CCTGCTGGGCACCTTGATCTTGG - Intergenic
1189228784 X:39435688-39435710 CCTGCAGCAAACTTTTATCTGGG + Intergenic
1189646593 X:43139470-43139492 CCTTCTGGAAATTCTATTCTTGG + Intergenic
1191112003 X:56811519-56811541 GCTGCTGGAAAGTTCGAACTGGG - Intergenic
1192934890 X:75849230-75849252 CCTGCAGCAAACTTTTATCTGGG + Intergenic
1194387250 X:93271229-93271251 CTTCATTGAAATTTTGATCTAGG + Intergenic
1197067391 X:122249754-122249776 CCTACTGGAAATATAGATGTAGG + Intergenic
1197756946 X:130002268-130002290 GCAGCTGGAAATTCTGGTCTGGG + Intronic
1198587159 X:138135058-138135080 CCTCCTGGAGATTTTGAGCCAGG + Intergenic