ID: 922188291

View in Genome Browser
Species Human (GRCh38)
Location 1:223295485-223295507
Sequence GAGTGTGCCATAATAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922188289_922188291 -6 Left 922188289 1:223295468-223295490 CCACAGAAGGGCAAGATGAGTGT 0: 1
1: 0
2: 1
3: 13
4: 163
Right 922188291 1:223295485-223295507 GAGTGTGCCATAATAGAGGATGG 0: 1
1: 0
2: 1
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922188291 Original CRISPR GAGTGTGCCATAATAGAGGA TGG Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
902767173 1:18625066-18625088 GAGTGAACCATGATAGAGGAGGG + Intergenic
908857708 1:68448579-68448601 GAGACTGACATAAAAGAGGATGG + Intronic
911365584 1:96933745-96933767 GAGTGTGGCATAATGAAGAAAGG - Intergenic
911436349 1:97864279-97864301 GAGTGGGCTATATTAGAGGGAGG + Intronic
917603072 1:176596811-176596833 GGGTTGGACATAATAGAGGAGGG + Intronic
918250065 1:182695381-182695403 GAGTGTGCTAAAATGGAGGAAGG - Intergenic
919194666 1:194267848-194267870 GAGTGTGGAATAATAGATAATGG + Intergenic
919412531 1:197264149-197264171 GAGTGTGAAATGATAGATGATGG - Intergenic
919576872 1:199321264-199321286 GAGTGTGGAATAATAGAGATTGG + Intergenic
920197128 1:204236119-204236141 GAGTGTGGGATAATGGTGGAAGG + Intronic
921892219 1:220365116-220365138 GTGTGAGCCATAATGGAGGAGGG + Intergenic
922188291 1:223295485-223295507 GAGTGTGCCATAATAGAGGATGG + Intronic
924819866 1:247478795-247478817 GAGTGTGAAATAATAGTGAATGG - Intergenic
1062770777 10:98916-98938 GAGTGTGGGATAATGGTGGAAGG - Intergenic
1064539066 10:16387824-16387846 AGGTGTGGCATATTAGAGGATGG - Intergenic
1070341797 10:75504745-75504767 GAGTGTGGCATAAGAGGGGTAGG + Intronic
1073819397 10:107243670-107243692 AAGTGTGACATAACAAAGGAAGG + Intergenic
1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG + Intronic
1085367726 11:75966942-75966964 AAGTATACCAGAATAGAGGAAGG - Intronic
1086278334 11:85158209-85158231 GGGTGTGCGATAATGGTGGAAGG + Intronic
1088461166 11:110084631-110084653 GAGAGAGCCATAAAAGATGAGGG + Intergenic
1091325401 11:134683153-134683175 GTCTGTCCCATAAGAGAGGAAGG - Intergenic
1092012722 12:5128390-5128412 GAGTGTGGCATCACAGTGGAAGG - Intergenic
1096406598 12:51348416-51348438 GAGTGTGCCAGAATGCTGGAGGG - Intergenic
1096947951 12:55430713-55430735 GAGTGTGGAATAATAGACAATGG - Intergenic
1097257341 12:57689274-57689296 GAGTGTGGAATAATAGACAATGG + Intergenic
1097634567 12:62106932-62106954 GAGAGGGTGATAATAGAGGAAGG - Intronic
1097639409 12:62161515-62161537 GAGAGTGGAATGATAGAGGATGG + Intronic
1101263828 12:103063850-103063872 GAGTGTGGGATAATGGTGGAAGG + Intergenic
1102045239 12:109825761-109825783 GAGTTTGCCAAATCAGAGGAGGG + Intronic
1106483401 13:30153770-30153792 GAGAGAGCCATGATGGAGGACGG + Intergenic
1106962990 13:35023494-35023516 AAGTATGCGATCATAGAGGAGGG + Intronic
1107142315 13:37014388-37014410 GAGTGTTCCATATTAGATCAAGG - Intronic
1107966213 13:45600550-45600572 CAGTGTGGAATAATAGACGATGG - Intronic
1109202235 13:59443648-59443670 GAGAGTGGCATAAAAGATGAGGG - Intergenic
1112091199 13:96085908-96085930 GAATGTGGGATAAAAGAGGAAGG - Intergenic
1112603400 13:100879475-100879497 GAGTGTGCAGTTATAGAGAAAGG - Intergenic
1113225079 13:108150793-108150815 GAGAATGTCATAATAAAGGATGG + Intergenic
1115156802 14:30350170-30350192 GAGTTTCCCATAATAAAAGAAGG + Intergenic
1115257419 14:31417825-31417847 CAGTGTGTAATGATAGAGGAAGG - Intronic
1120929858 14:89837327-89837349 GAGTGTGGGAGAAGAGAGGATGG + Intronic
1121753795 14:96384319-96384341 GAGAGTGCAGTAATAGAGCATGG + Intronic
1121851905 14:97228986-97229008 GACTGTGGCATAAAAGAGTAAGG + Intergenic
1122058563 14:99121649-99121671 GAGTGTGCTATGAAAGAGCAAGG - Intergenic
1124938488 15:34195397-34195419 CAGTGTGGAATAATAGAGAATGG + Intronic
1126339975 15:47629099-47629121 GAGTGTGTGGTATTAGAGGAGGG - Intronic
1130444498 15:83987622-83987644 GAGTTTGCCAGAAAGGAGGAAGG + Intronic
1134586894 16:15419355-15419377 GAGTGTGGAATGATAGATGATGG - Intronic
1134784099 16:16925308-16925330 GGGTGTGGGATAATAGTGGAAGG - Intergenic
1135779027 16:25282716-25282738 AAGTGGACCATGATAGAGGAAGG - Intergenic
1137023809 16:35454454-35454476 GAGTGAGCCAGAAGAGGGGAAGG + Intergenic
1140229206 16:73103525-73103547 GAAAGTGCTGTAATAGAGGAAGG - Intergenic
1140269268 16:73448648-73448670 GAATGTGCCTTAAAAGGGGAAGG + Intergenic
1143627517 17:8118931-8118953 GACTGTACCATAGTAGAGGCTGG - Exonic
1144852520 17:18251201-18251223 GACTGAGCCATCTTAGAGGAAGG + Intronic
1149056509 17:52373485-52373507 GAATGTGCAATCATGGAGGAAGG + Intergenic
1149259720 17:54865496-54865518 GAGTGAGCCGTCAAAGAGGAGGG + Intergenic
1150549988 17:66201546-66201568 AACTGTGCAAAAATAGAGGATGG + Intergenic
1150964828 17:69956210-69956232 GAGTGTGTAATAATAGACAATGG + Intergenic
1151244812 17:72786249-72786271 AAGTGTGCCAGAATAGTTGATGG + Intronic
1152989688 18:351407-351429 GTGAGTCCCATAATAGAGAAAGG - Intronic
1157845885 18:51003700-51003722 GAGTGTGGGATAATGGAGGAAGG + Intronic
1159706667 18:71697991-71698013 GAGTGTGGAATAATAGACAATGG - Intergenic
1159736982 18:72112486-72112508 GATTGTACCATAATAGGGGTGGG - Intergenic
1159798820 18:72871468-72871490 GAGTGTGCCATCCTGGAAGATGG + Intergenic
925341641 2:3142162-3142184 GAGTGTGGGGTAGTAGAGGAAGG - Intergenic
930295442 2:49547811-49547833 GAGTGTGGGATAATGGTGGAAGG - Intergenic
931794240 2:65694069-65694091 TTGTGTGTCAAAATAGAGGAGGG + Intergenic
932419083 2:71590868-71590890 CAGTGTGACATTAAAGAGGAGGG - Intronic
933263011 2:80151084-80151106 GAGTGGGGCATAAAAGAGAATGG - Intronic
935502002 2:103852830-103852852 GAGTGTGAAATAATAGACAATGG + Intergenic
938532831 2:132207006-132207028 GAGTGGGCCATAATTCAGTATGG - Intronic
941432991 2:165434392-165434414 GTGTGTGCCAGAATAGAAAATGG + Intergenic
942970013 2:181947292-181947314 GAGTATTCCATACTAGATGAGGG - Intergenic
943318132 2:186413912-186413934 GGGTGTGGGATAATAGTGGAAGG - Intergenic
945424863 2:209688030-209688052 AAGTGTGCCTTAATACAGGGTGG + Intronic
949080492 2:242094432-242094454 GAGTGGGCCAGAATTAAGGATGG - Intergenic
1169618663 20:7479479-7479501 GAGTGTATCATAATGGAAGAAGG - Intergenic
1170958718 20:21005219-21005241 CAGAGTGACATAATAGATGATGG - Intergenic
1174029930 20:47615311-47615333 TAGTGTGCCAAAATAGCAGATGG - Intronic
1174821196 20:53727826-53727848 GAGTGTGGCATAATAGACTGGGG - Intergenic
1175522230 20:59609278-59609300 CAGAGTGGCATAAAAGAGGAAGG - Intronic
1176922795 21:14708650-14708672 GATTGTGGCATAATTGAAGAGGG - Intergenic
1178012343 21:28302652-28302674 GGGTGTGGGATAATAGTGGAAGG + Intergenic
1180970256 22:19811511-19811533 GAGGGTGTCATAGTGGAGGAGGG - Intronic
1184851227 22:47122380-47122402 CAGTGTCCCATCACAGAGGAGGG + Intronic
949751069 3:7353334-7353356 GGGTGTGGGATAATAGTGGAAGG + Intronic
952110869 3:30122756-30122778 AAGTGTCCCTTAATGGAGGAAGG + Intergenic
956598977 3:70998536-70998558 GAGTTTGCCGTAATGGAAGAAGG - Intronic
957634158 3:82759870-82759892 GGGTGTGGGATAATAGTGGAAGG + Intergenic
961137118 3:124521514-124521536 GAGTGTGACATATTAGGGTAGGG - Intronic
963054133 3:141170751-141170773 TAGTCTGCCATAATAGATTATGG + Intergenic
963461489 3:145619411-145619433 GAGTGTGGCATAATTGGTGAGGG - Intergenic
965316725 3:167200815-167200837 AAGTGTGCCACAAAAGTGGAAGG + Intergenic
965448067 3:168800690-168800712 TAGTGTGACATAATAGAAAAAGG - Intergenic
966332961 3:178835796-178835818 GACTGTACCATCATAGAGGTGGG - Intronic
966662890 3:182434347-182434369 TAGTGTGCCATCATACAGCATGG + Intergenic
972095228 4:35340421-35340443 GGGTGTGGTATAATGGAGGAAGG + Intergenic
977250543 4:94683864-94683886 GAGTGTGCCATGATAGTGTTGGG + Intergenic
978040310 4:104052520-104052542 AAATGTTCCATAATACAGGAAGG + Intergenic
978635495 4:110800170-110800192 GAATGTGACATCCTAGAGGAGGG + Intergenic
980035637 4:127880447-127880469 GAGTTTGCCAAAATAAAGAATGG + Intergenic
980082942 4:128363532-128363554 GAGTGTGCAAGAAGAGAAGAAGG + Intergenic
981156715 4:141446035-141446057 GAGTGTGGCATAATGAATGAGGG + Intergenic
981160699 4:141495319-141495341 GAGTGTGAGATAATAGAGGAAGG + Intergenic
983648078 4:170011976-170011998 GTGTGTGCAAGAACAGAGGAGGG + Intronic
983886160 4:172982949-172982971 GAGAGTGCAATAATAGACAATGG + Intronic
984212507 4:176867766-176867788 GAGTGTGTCATAAATGAAGATGG - Intergenic
988222326 5:28364222-28364244 GAGTGTGAAATGATAGACGATGG + Intergenic
988603641 5:32662059-32662081 GAGGGGGCAATGATAGAGGAAGG - Intergenic
989145261 5:38243139-38243161 GAGTGTGTTATGATGGAGGAAGG - Intergenic
991488596 5:67163365-67163387 GAGTGTCCCAGAAGAGGGGATGG - Exonic
992175092 5:74142229-74142251 GAGTGTGCCCTGAGATAGGATGG - Intergenic
992518019 5:77516495-77516517 AAGAGTGCCATAATAGAAGTTGG + Intronic
994761203 5:103856359-103856381 GAGTGAGCCATGATACTGGATGG - Intergenic
997442135 5:133916270-133916292 GAGGGTGCAAGAATAGAGGCTGG + Intergenic
998841268 5:146256857-146256879 AAGTGTGTCATATTAAAGGAAGG - Intronic
1000078899 5:157824814-157824836 CAGTGTGACATAATAGAAAATGG - Intronic
1000206297 5:159062646-159062668 GCGTTTGACATAATAGAGGATGG + Intronic
1000668951 5:164035990-164036012 TAGTCTGCTATAAAAGAGGAAGG - Intergenic
1004648294 6:17584021-17584043 GACTGTGACATACGAGAGGAAGG - Intergenic
1007470009 6:42083696-42083718 GACTCTGCCATCACAGAGGAGGG + Intronic
1010815468 6:80353081-80353103 GAGAGTGGAATAATAGAGAATGG - Intergenic
1012387343 6:98697513-98697535 GAATGTGCCATTGTACAGGAAGG + Intergenic
1013816314 6:114102507-114102529 AATTGTGCCATGATTGAGGAGGG + Intronic
1021623566 7:22571462-22571484 GTGTGTACAATATTAGAGGAAGG + Intronic
1026573291 7:71551001-71551023 GAATGTCCCATAATTGAGGAAGG - Intronic
1027775477 7:82459300-82459322 GAATGTGTCATAATATAGCAAGG + Intergenic
1029927578 7:104333719-104333741 GAGGGTGCCACAAGATAGGATGG - Intronic
1030458388 7:109801477-109801499 GGGTGTGGGATAATAGTGGAAGG - Intergenic
1031779411 7:125942512-125942534 GAGTGTGGGATAATAGTGGAAGG - Intergenic
1034564510 7:151902419-151902441 GAGTCTGCCATGCTGGAGGACGG - Intergenic
1034748984 7:153550889-153550911 GAATGTGACAGAAGAGAGGACGG - Intergenic
1035290183 7:157833026-157833048 GAGTTTACCATCATACAGGATGG - Intronic
1035538544 8:412624-412646 GAGTGGGCCAGAATTAAGGATGG - Intronic
1042020465 8:64368816-64368838 AAGTGTTGAATAATAGAGGATGG + Intergenic
1043232738 8:77823190-77823212 GAGTGTGGGATAATGGTGGAAGG - Intergenic
1043317944 8:78944535-78944557 GAGTGTGGCATTATGGTGGAAGG - Intergenic
1044150517 8:88770855-88770877 GAGTGTGGGATAATGGTGGAAGG + Intergenic
1047015532 8:120719462-120719484 GAGTGTGCCTGAATAGAAAATGG - Intronic
1052542658 9:29830337-29830359 AAAAGAGCCATAATAGAGGATGG - Intergenic
1052894934 9:33738043-33738065 AAGTGAGCCATAAGAGAGAAAGG - Intergenic
1055271263 9:74562035-74562057 CAGTGTGCTATATCAGAGGATGG + Intronic
1058259532 9:102811941-102811963 GAGTGTGGAATAATGGTGGAAGG - Intergenic
1058622561 9:106898730-106898752 GAGTTTGCCATGATGGAGAATGG + Intronic
1059879508 9:118674504-118674526 AGGTGTGCCATAACAAAGGAAGG - Intergenic
1060443006 9:123659131-123659153 TAGTGTGCAAAAAGAGAGGAAGG - Intronic
1186667673 X:11734880-11734902 AAGAGTACCATAGTAGAGGAAGG - Intergenic
1187251762 X:17605350-17605372 GAGAGTGCTGTAATAGAGGTTGG + Intronic
1193098049 X:77575914-77575936 TTATGTGCCATAATAGAGGCAGG - Intronic
1195960823 X:110384653-110384675 GAGTGAGCCATGATACAGAATGG - Intronic
1196372619 X:114996373-114996395 GGGTGTGGAATAATAGTGGAAGG - Intergenic