ID: 922188946

View in Genome Browser
Species Human (GRCh38)
Location 1:223300124-223300146
Sequence GGTCAGAGCAGACCAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 416}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922188932_922188946 27 Left 922188932 1:223300074-223300096 CCTGAGTTCTGGTAAGCAGTCAT 0: 1
1: 0
2: 0
3: 9
4: 131
Right 922188946 1:223300124-223300146 GGTCAGAGCAGACCAGGGGCAGG 0: 1
1: 0
2: 3
3: 39
4: 416
922188931_922188946 28 Left 922188931 1:223300073-223300095 CCCTGAGTTCTGGTAAGCAGTCA 0: 1
1: 0
2: 1
3: 16
4: 178
Right 922188946 1:223300124-223300146 GGTCAGAGCAGACCAGGGGCAGG 0: 1
1: 0
2: 3
3: 39
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922188946 Original CRISPR GGTCAGAGCAGACCAGGGGC AGG Intronic
900322249 1:2090558-2090580 GGTCAGAGCCCACCCTGGGCTGG + Intronic
900486001 1:2923108-2923130 GGCCAGAGGTGACCAGGGCCTGG - Intergenic
900768260 1:4520004-4520026 GGTCAGGGCAGGCCTGGGGCAGG - Intergenic
901035631 1:6334429-6334451 AGGCAGAGCAGCCCAGGGGAGGG + Intronic
901199190 1:7457099-7457121 AGTCAGAGAAGGCCAGGGGTGGG - Intronic
901324584 1:8358999-8359021 TGTCAGAGCAGGCCAGGAGCAGG - Intronic
902077856 1:13801934-13801956 GGTCTGAGCAGCCCAGGGTGGGG + Intronic
902096569 1:13950655-13950677 GGCCTGAGCAGACCAGGAGAGGG + Intergenic
902394011 1:16122604-16122626 GGTCAGGCCAGGCCAGGGTCAGG + Intergenic
902583944 1:17426520-17426542 GGGCTGAGCAGAGCTGGGGCAGG - Intronic
902626582 1:17680082-17680104 GGGCAGGGCAGGGCAGGGGCAGG - Intronic
902824440 1:18963300-18963322 AGTCAGAGCAGGAGAGGGGCTGG - Intergenic
903346260 1:22686020-22686042 GGGCATAGGAGAGCAGGGGCAGG - Intergenic
903858145 1:26349303-26349325 GGTCAGAGAAGACGAGTGACTGG + Intronic
904163634 1:28538728-28538750 GGGCAGAGCAGAGCAGGGTATGG + Intronic
904266389 1:29320627-29320649 GCTCAGCCCAGGCCAGGGGCCGG + Intronic
904396644 1:30226968-30226990 GGGCAGAGCAGAGCAGGACCAGG + Intergenic
904467756 1:30718415-30718437 GGCCAGAGCAGGCAGGGGGCGGG - Intronic
904479045 1:30782780-30782802 GGTCAGGGCAAAGCAGGGGCTGG + Intergenic
905572113 1:39014324-39014346 AGGCAGAGCAGACCAGAGGCAGG + Intergenic
905629870 1:39512448-39512470 AGTCAGAGTAAACCAGGGCCAGG + Intronic
905667889 1:39773742-39773764 AGTCAGAGTAAACCAGGGCCAGG - Intronic
905709129 1:40086077-40086099 GCCCAGAGCAGACCTGGGGAAGG + Intronic
905737473 1:40339765-40339787 GGTCAGATGAAACCAGGGTCAGG - Intergenic
906953276 1:50351198-50351220 GATCAGACCAGACCAGGGCCTGG + Intergenic
907188705 1:52631874-52631896 GGTCTGAGCAGACTGGGAGCTGG - Intergenic
907275501 1:53314634-53314656 AGGAAGAGCAGTCCAGGGGCGGG + Intronic
907872330 1:58454519-58454541 TGTCAGGGCAGGCTAGGGGCGGG + Intronic
908471410 1:64447530-64447552 AGTCAGAGCAGAGCAGGGGAGGG + Intergenic
909730333 1:78881047-78881069 AGTAAGAGCAGAACAAGGGCTGG + Intergenic
915006744 1:152645304-152645326 CGTCAGAGCAGATGAGGTGCTGG + Intergenic
915012232 1:152698335-152698357 AGTCAGAGCAGATGAGGTGCTGG - Intergenic
915598548 1:156908605-156908627 GGTCTGAGCTGGGCAGGGGCAGG - Intronic
916500634 1:165384016-165384038 GGGCAGAGAAGTCCTGGGGCGGG - Intergenic
918321380 1:183368400-183368422 AGACAGCGCAGCCCAGGGGCAGG - Intronic
919927705 1:202200884-202200906 TGCCAGAGCAGGCCATGGGCAGG + Intronic
920095937 1:203486890-203486912 GGTCAGAGCAGATCCGGTGGCGG - Exonic
920506867 1:206521440-206521462 GGTCACAGGAGGCCAGGAGCAGG - Intronic
921365408 1:214369018-214369040 GGTGAGAGGTTACCAGGGGCTGG - Intronic
921941030 1:220839909-220839931 GGTATGAGCAGAGCTGGGGCAGG + Intergenic
922188946 1:223300124-223300146 GGTCAGAGCAGACCAGGGGCAGG + Intronic
922473184 1:225888998-225889020 GGTCAGGGCGGCCCCGGGGCTGG + Exonic
924032421 1:239899900-239899922 GATAGGGGCAGACCAGGGGCAGG - Intronic
924613474 1:245592349-245592371 GGGAAGAGCAGTCCAGGGCCAGG + Intronic
924624390 1:245687402-245687424 GACCAGAGCAGAGCAGGAGCAGG + Exonic
924954082 1:248910682-248910704 GGTCAGAGCAGAAGGGGAGCTGG + Intronic
1062925838 10:1314822-1314844 GTTCAGAGCAGCCCAGGTGCAGG - Intronic
1063058181 10:2525060-2525082 TGGCAGAGCAAACCAGGAGCAGG - Intergenic
1063076989 10:2727183-2727205 GGTCAGAGAAGAGTAGAGGCTGG - Intergenic
1063225815 10:4013726-4013748 GGTAACAGCAGACCGTGGGCGGG + Intergenic
1063664591 10:8053721-8053743 GGTCGGTGCAGACCGAGGGCTGG + Intronic
1064188776 10:13187149-13187171 GGTTAGTGCTTACCAGGGGCTGG - Intronic
1066065710 10:31759727-31759749 GGTCTGGGCATCCCAGGGGCGGG + Intergenic
1067287273 10:44915660-44915682 GATCAGAACTGACCAAGGGCAGG - Intronic
1067532693 10:47086010-47086032 GGTCATTCCAGACCAGGTGCTGG - Intergenic
1067681255 10:48442697-48442719 GGTAAAAGGAGACAAGGGGCAGG - Intergenic
1070526965 10:77303642-77303664 GGTCAGAGCACAGCATGGGAGGG - Intronic
1070783484 10:79150355-79150377 GGTCAGCGCAGGCCAGAGGCAGG - Intronic
1072633765 10:97164484-97164506 GGTCAGAGCTGACAAGCCGCTGG - Intronic
1072696451 10:97607304-97607326 TGTCAGAGCAGGCCAGGGGGAGG - Intronic
1073206240 10:101770881-101770903 GGCCAGAGCAGGCCAGGCTCTGG - Intronic
1073280397 10:102349729-102349751 CTTCAGAGCAGACCTAGGGCAGG + Intronic
1074424883 10:113342124-113342146 GGTCATAGCAAAACTGGGGCAGG + Intergenic
1074435262 10:113428664-113428686 AGACAGAGCAGAGCAGGGCCTGG + Intergenic
1075463174 10:122632199-122632221 ACTCAGAGCAGCTCAGGGGCAGG - Intronic
1075733676 10:124651379-124651401 GGACAGAGCAGAGCAGGCTCAGG - Intronic
1075790621 10:125081980-125082002 GGTCAGCGCTGCCCAGGGGCAGG + Intronic
1076365071 10:129916412-129916434 TGCCAGGGCAGATCAGGGGCTGG - Intronic
1076372666 10:129965053-129965075 CGTAAGAACAGGCCAGGGGCCGG - Intergenic
1076494188 10:130886056-130886078 GGTCAGAGCATCACAGGTGCCGG - Intergenic
1076861480 10:133140168-133140190 GGGCAGGGCAGGGCAGGGGCAGG - Intergenic
1077035954 11:494610-494632 GGTGAGAGCATGGCAGGGGCTGG + Exonic
1077122135 11:914420-914442 GGACAGAGTAGGGCAGGGGCAGG + Intronic
1077147359 11:1052188-1052210 GGGCAGAGCAGAGCAGGGCAGGG - Intergenic
1077220885 11:1415675-1415697 GGGCAGAGCAGGCCCCGGGCAGG - Intronic
1077435120 11:2535240-2535262 GGTGAAAGTGGACCAGGGGCAGG + Intronic
1077446298 11:2592546-2592568 AGCCAGAGCACAGCAGGGGCTGG + Intronic
1077472584 11:2770933-2770955 GGGCAGAGGAGACCATGGGAAGG + Intronic
1077865000 11:6214783-6214805 GGAAAGAGCGGAGCAGGGGCTGG + Exonic
1078448262 11:11421235-11421257 GGTGAGAGCAGAGAAGAGGCTGG + Intronic
1078467610 11:11561785-11561807 GGGCAGAGCCAACAAGGGGCAGG + Intronic
1078532580 11:12148521-12148543 GGTCAGAGCTGGCCAGGTCCTGG + Intronic
1079393432 11:20041782-20041804 GGGCAGAGCATACCAGGGAGAGG - Intronic
1079442931 11:20533751-20533773 AGTCAGAGAAGGCCTGGGGCAGG - Intergenic
1080426847 11:32162921-32162943 GGTAGGAGGAGACCTGGGGCGGG + Intergenic
1080746914 11:35116448-35116470 AGTCAGAGCAGGGCTGGGGCAGG - Intergenic
1080903268 11:36515622-36515644 GCTCAGAGCAGTGGAGGGGCAGG + Intronic
1080945705 11:36971788-36971810 GGTCAGAGAAGAGCTGGGGCTGG + Intergenic
1081668497 11:44930323-44930345 AGTCAGAGCAGTCCAAAGGCAGG - Exonic
1081993230 11:47348564-47348586 CGTCAGGGGACACCAGGGGCCGG + Intronic
1082808151 11:57462780-57462802 GGCCAGAACTGACCAGGGGAGGG - Intronic
1082899289 11:58228287-58228309 TGTCAGCGCAGGCCAGGCGCAGG + Exonic
1083595310 11:63916098-63916120 GGTGAGGGCAGGGCAGGGGCCGG + Intronic
1084020033 11:66411805-66411827 GGTCAGAGAAGGTCAGGGACTGG - Intergenic
1084258062 11:67955894-67955916 GCTCAGCGCAGGCCAGGGCCCGG - Intergenic
1084366961 11:68708015-68708037 GGGCAGAGCAGGGCAGGGGAGGG - Exonic
1084489708 11:69471709-69471731 GGTGAGAGCAGGGAAGGGGCCGG - Intergenic
1085445376 11:76597690-76597712 GGGCAGAGCACCCCAGTGGCAGG + Intergenic
1085456349 11:76667585-76667607 GGTGAGAGCAGAGCAGCTGCAGG - Intronic
1085475950 11:76788994-76789016 GCTGGGAGCAGGCCAGGGGCAGG + Intronic
1085894676 11:80624404-80624426 GGTTAAAGTAGGCCAGGGGCAGG - Intergenic
1086666631 11:89491458-89491480 GGGCAGAGCTGACCCGGTGCGGG - Exonic
1088869196 11:113876753-113876775 AGTCAGACCAGACCAGGGCAAGG - Intergenic
1089868433 11:121651829-121651851 GGTCAGAGCAGGCCTGGGGAAGG + Intergenic
1091563498 12:1631233-1631255 GATAAGGGCAGACCAGGAGCCGG - Intronic
1091639489 12:2224491-2224513 GGGTGGAGCAGAACAGGGGCTGG - Intronic
1091918213 12:4284144-4284166 AGTGAGAGCAGAGGAGGGGCAGG + Intronic
1095956396 12:47808768-47808790 GGGCAGAGCAGTGCAGGGGCAGG - Intronic
1096149719 12:49301266-49301288 TGGCAGAGCAGGCCAGGGGAAGG - Intergenic
1096464159 12:51838970-51838992 GGTCAGAGCAGCCAGGGGTCAGG - Intergenic
1096882458 12:54684223-54684245 GCTAAGAGCACACCAGGGGCTGG - Intergenic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1102060443 12:109926947-109926969 AGCCAGAGCAGACCAGAGGATGG + Intronic
1102115654 12:110401258-110401280 AGTCAGAGAAGACCAGGTCCAGG + Intronic
1102297301 12:111747155-111747177 GGTCATAGCAAAACAGGAGCGGG - Exonic
1102463959 12:113117190-113117212 GGGCAGGGCAGGCCAGGGCCCGG - Intronic
1102803299 12:115756442-115756464 TGTCAGATCTGCCCAGGGGCAGG - Intergenic
1103725299 12:122994779-122994801 GGTGAGAGCCCAGCAGGGGCAGG - Exonic
1103725367 12:122995111-122995133 GGGCAGAATGGACCAGGGGCAGG - Intronic
1104978100 12:132561067-132561089 GCTGAGAGCAGAACAGGGGCCGG - Intronic
1105330748 13:19412886-19412908 GGTGAGAGGTGGCCAGGGGCAGG - Intergenic
1105708226 13:22981913-22981935 GATCAAAGGAGACTAGGGGCTGG - Intergenic
1105752520 13:23434525-23434547 GGTCAGACCAGTGCAGGGCCAGG - Intergenic
1105914480 13:24900406-24900428 GGGCAGATCAGGCCAGGAGCTGG + Intronic
1105918825 13:24941660-24941682 GGTGAGAGGTGGCCAGGGGCAGG - Intergenic
1108624186 13:52211230-52211252 GGTGAGAGGCGCCCAGGGGCAGG - Intergenic
1108661866 13:52595193-52595215 GGTGAGAGGCGCCCAGGGGCAGG + Intergenic
1110369816 13:74727457-74727479 GGGCAGAACAGAGCAGGGGAGGG + Intergenic
1110872459 13:80468340-80468362 GGTCACAGCAGAACAAGGGGAGG - Intergenic
1111852620 13:93596133-93596155 CCTCAGAGCAGACCAGGGCTAGG + Intronic
1112299115 13:98214032-98214054 GGACAGAGCAGCCTGGGGGCCGG + Intronic
1113758828 13:112833424-112833446 GGACAGAGCAGAGCTGGTGCGGG + Intronic
1113807571 13:113118534-113118556 GGTCAGTGAGGACCACGGGCTGG - Exonic
1115669678 14:35596072-35596094 TGTCAGAGCACACCAAGGCCAGG + Intronic
1116901495 14:50366293-50366315 GGTCTGACCAAACCAAGGGCAGG + Intronic
1118318440 14:64739377-64739399 GCTGAGATCAGACCTGGGGCTGG + Intronic
1118734185 14:68690348-68690370 AGTCAGAGGGGAGCAGGGGCTGG + Intronic
1119851021 14:77866855-77866877 GGTTAGAGCAGAAGCGGGGCAGG + Intronic
1121517073 14:94559790-94559812 GTCCAGAACATACCAGGGGCAGG + Intergenic
1122087665 14:99318739-99318761 TTTCAGAGCACAGCAGGGGCAGG - Intergenic
1122723271 14:103734288-103734310 TGTGAGGGCAGACCAGGGCCAGG - Exonic
1122814157 14:104304066-104304088 GGGCAGAGCAGACCTTGGGCAGG - Intergenic
1122931732 14:104936230-104936252 GGTGAGTGCAGCCCAGGGGGAGG - Exonic
1122971783 14:105155158-105155180 CGGCAGAGCAGACCAGTGGTGGG - Intronic
1123042564 14:105496394-105496416 GGGCGGAGCAGAGCAGAGGCAGG - Intronic
1123953252 15:25305831-25305853 GGTCAGAGCAGTCCCAGGTCTGG - Intergenic
1124003842 15:25780560-25780582 GGCCAGGGCACACCAGAGGCAGG + Intronic
1125506465 15:40270529-40270551 GGGCAGAGCAGCCCAGGGCTGGG + Intronic
1125727166 15:41874009-41874031 GGTAAAAGCTCACCAGGGGCAGG - Exonic
1127381507 15:58434481-58434503 GGTCAGGGCAGAGCAGGGAGAGG + Intronic
1127873010 15:63088876-63088898 GGTCAAAGGAGCCCAGAGGCAGG + Intergenic
1128580340 15:68805538-68805560 GGTGTGAGCAGAGCAGTGGCCGG + Intronic
1128749712 15:70140250-70140272 TGCCAGAGCAGAGGAGGGGCTGG + Intergenic
1128978176 15:72168154-72168176 GGGCAGAGCAGAGCAGGGAAAGG - Intronic
1129005376 15:72368603-72368625 GGCCAGAGGAGTCCTGGGGCAGG + Intronic
1130970382 15:88727573-88727595 AGACAGGGCAGACCAAGGGCTGG + Intergenic
1131326983 15:91457031-91457053 GGTCATGGCAGACGAGAGGCAGG - Intergenic
1131452930 15:92561202-92561224 GGGCAGATCAGACCAGGTGCTGG - Intergenic
1131931938 15:97452354-97452376 GGTCAGAGCAGTTCAGTGGATGG + Intergenic
1132513566 16:355312-355334 GGTAGGAGGAGACCAGAGGCAGG + Intergenic
1132536717 16:485268-485290 GGACCCAACAGACCAGGGGCAGG - Intronic
1132727981 16:1346990-1347012 GATCAGAGCAGCCCTGAGGCGGG - Intronic
1132836346 16:1955049-1955071 GGACAGGGCAGACGAGGGGGAGG + Intronic
1132882730 16:2169643-2169665 GGCGAGAGCAGAGCAGGAGCTGG - Intronic
1133256224 16:4518052-4518074 GCTCAGAGCATCCCAGGGCCTGG - Intronic
1133345241 16:5065552-5065574 GGAGAGAGGAGGCCAGGGGCTGG - Intronic
1133815257 16:9192480-9192502 TGTCAGAGCAGAACAGGTACAGG - Intergenic
1136284584 16:29233519-29233541 GGTCAAATCGGAGCAGGGGCAGG + Intergenic
1137056046 16:35747113-35747135 TGCCTGAGCAGACCGGGGGCTGG + Intergenic
1137589390 16:49684518-49684540 GGTCTGGGCAGACCATGGGGAGG - Intronic
1137731451 16:50693523-50693545 GGTCCCGGCAGAGCAGGGGCGGG + Intergenic
1138448131 16:57077549-57077571 GCCCAGAGAAGAGCAGGGGCTGG - Intronic
1139516555 16:67455639-67455661 CCACAGAGCAGAACAGGGGCTGG - Intronic
1139958298 16:70703764-70703786 GTTCAGAGCAGGCCGAGGGCAGG - Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1142186030 16:88695113-88695135 GGGCAGAGCAGAGCAAGGGGAGG + Intergenic
1142317237 16:89355520-89355542 GTTCAGAGCAGAGCATGTGCCGG - Intronic
1203146650 16_KI270728v1_random:1807726-1807748 GGCCAGAGCAGGCCTGGGACAGG + Intergenic
1142702320 17:1670774-1670796 GATGAGAGCAGGCCAGGCGCGGG - Intronic
1142717582 17:1755434-1755456 GGTCAGAGGGGACCACGGGGTGG - Intergenic
1142967630 17:3591135-3591157 GGTCAGGGCAGGCCAGGGCTGGG + Intronic
1143106341 17:4532324-4532346 GGCCTGTCCAGACCAGGGGCAGG - Intronic
1143377629 17:6476800-6476822 AGTCAGAGCAGGGCAGGGACAGG + Intronic
1143918891 17:10315158-10315180 GGACAGAGGAGGCCAGGGGATGG + Intronic
1144057896 17:11558335-11558357 TGGCAGAGCAGAGCGGGGGCCGG + Exonic
1144721182 17:17470893-17470915 GGACGGAGCACACCAGGGGCTGG - Intergenic
1144729527 17:17518529-17518551 GGTCAGGGGAGGCCCGGGGCAGG - Intronic
1144831370 17:18133147-18133169 GGTCAGGGCAGAGCAGGACCTGG + Intronic
1145000593 17:19301998-19302020 GCTCACAGCCGCCCAGGGGCAGG - Intronic
1146693921 17:34894745-34894767 GGACAGAGAAGACAAGGGGCTGG + Intergenic
1146927816 17:36757233-36757255 AGCCAAAGCAGGCCAGGGGCAGG - Intergenic
1147119912 17:38329857-38329879 GGTCAGCGCTGCCCAGGGACTGG + Exonic
1147360132 17:39925133-39925155 GGACAGAGAAGAACGGGGGCAGG - Intronic
1147597220 17:41724941-41724963 TGTCAGAGGAGACCGAGGGCTGG - Exonic
1147652684 17:42071388-42071410 GGACAGAGCAGACCAGGGAGGGG - Intergenic
1147847215 17:43412979-43413001 GCTGAGAGCGGACCAGGGGAAGG - Intergenic
1148491277 17:48025322-48025344 GCTCAGCGCACTCCAGGGGCGGG + Intergenic
1150199095 17:63334937-63334959 GGCCAGAGCAGAGCAGGAGGTGG + Intronic
1151231936 17:72691088-72691110 GGTGAGGGCAGACTAGGGGTGGG + Intronic
1151561583 17:74872780-74872802 GGTCGGAGCAGAGCTGGGGCAGG - Intronic
1151747365 17:76018653-76018675 GGCCAGGGCAGAGTAGGGGCTGG + Intronic
1152208615 17:78990836-78990858 GGCCAGAAGAGACCAGGGGAGGG + Intergenic
1152681968 17:81673101-81673123 AGGCAGAGCAGGCCACGGGCAGG + Exonic
1152684106 17:81685386-81685408 CGTAAGAGCACACCAGGTGCTGG - Intronic
1153313818 18:3702771-3702793 AGTCAGGGCAGCCCAGTGGCAGG + Intronic
1153444128 18:5153094-5153116 GGGCAGGGCAGACAAGCGGCTGG + Intronic
1153732649 18:8029860-8029882 GGTCAGATCACACAGGGGGCAGG - Intronic
1153980468 18:10304529-10304551 GGTCAGAGCAGAACAGAGGTGGG - Intergenic
1154415060 18:14171957-14171979 GGCCAGAGCAGGGCCGGGGCAGG + Intergenic
1154502896 18:15005368-15005390 GGACAGAGCAGATCTGTGGCTGG - Intergenic
1155025709 18:21938728-21938750 GAGCAGAGGTGACCAGGGGCTGG + Intergenic
1155708382 18:28845024-28845046 GGTGAGAGCAGACCAGGCAGAGG + Intergenic
1157283395 18:46360697-46360719 GGTGAAGGCAGGCCAGGGGCAGG - Intronic
1157489810 18:48115090-48115112 GGTTAGAGGTTACCAGGGGCTGG - Intronic
1157564848 18:48672916-48672938 GATCAGAACAGATCAGGGGAGGG - Intronic
1157761303 18:50267499-50267521 GGTCACAGTGGACCAGGGTCAGG + Intronic
1159912772 18:74162090-74162112 GAGCAGAGCTGACCAGAGGCAGG + Intergenic
1160411442 18:78677888-78677910 GGTCACCGCAGACCTGGGGGAGG - Intergenic
1160513201 18:79463859-79463881 GGACAGGGCAGGCCAGCGGCTGG - Intronic
1160559834 18:79749329-79749351 GCACTGAGCAGAGCAGGGGCAGG - Intronic
1160665323 19:325435-325457 GGACAGAGCTGGGCAGGGGCAGG + Intronic
1160757106 19:763608-763630 GGTCAGGGCAGGGCAGGGGGTGG - Exonic
1160889255 19:1368680-1368702 TGTTAGAGCAGCCCAGGTGCTGG + Intronic
1161047803 19:2145592-2145614 GGCCAGAGCACACCCAGGGCTGG + Intronic
1161087336 19:2341150-2341172 TGTCAGAGCAGCCCGGGGCCAGG - Exonic
1161329719 19:3680749-3680771 GGTCAGAGGAGATCAGGCGGAGG + Intronic
1161466158 19:4431789-4431811 GGGCAGAGCACACCATGCGCTGG - Intronic
1161767239 19:6214466-6214488 GTCCAGAGCAAACCAGGGTCAGG - Intronic
1162344872 19:10113237-10113259 GGTCAGGGCAGAGTGGGGGCTGG + Intronic
1162345102 19:10114189-10114211 GGGGACAGCAGACCACGGGCTGG + Exonic
1162367547 19:10258529-10258551 GCACAGGGCAGAGCAGGGGCAGG + Intronic
1162566200 19:11446871-11446893 GGGAGGAGGAGACCAGGGGCTGG - Intronic
1163082636 19:14954606-14954628 GCTCAGAGCAGGGCATGGGCTGG + Intronic
1163176349 19:15566478-15566500 GGTCAGAGGAGACCAGGGAATGG - Intergenic
1163314615 19:16533254-16533276 GGCCAGAGCAGCCCAGAGTCCGG - Intronic
1163365934 19:16876228-16876250 GGTGAGAGGAGGCCTGGGGCTGG + Exonic
1163513519 19:17749441-17749463 GGTCACAGCTGACCAGGAGGAGG + Intronic
1163579897 19:18132088-18132110 GGCCAGAGAGGATCAGGGGCGGG + Intronic
1165325673 19:35113181-35113203 CGTCAGAGCAGCACAGAGGCAGG + Intergenic
1165363735 19:35351686-35351708 GGTCGGAGCAGCCCAGGTTCAGG - Exonic
1166108635 19:40609972-40609994 GGGCAGAGCAGTCCTGGGGCGGG - Intronic
1166366103 19:42279297-42279319 GGGCTGAGCAGTCCTGGGGCAGG + Intronic
1166407281 19:42529936-42529958 GAACAGAGCATACCAGAGGCTGG + Intronic
1167109939 19:47454266-47454288 GGACAGTGCGGACCAGGGGTGGG + Intronic
1167254973 19:48421945-48421967 GGTCAGCGCAGACTCGGGCCGGG + Exonic
1167408155 19:49327929-49327951 GATCAGATCAGAGCAGTGGCAGG + Intergenic
1168105769 19:54164887-54164909 GGGCAGGGCTGACCAGGGGCGGG - Intronic
1168148882 19:54434490-54434512 GGTCAGTGCAGGGCAGGGGTAGG - Intronic
1168708067 19:58480856-58480878 GGGGAGACCAGACCAGGGGCAGG - Exonic
924979921 2:210254-210276 GGTCAGAACAGCCCAGGAGTAGG + Intergenic
926009918 2:9399707-9399729 GGGCTGAGCAGACTCGGGGCGGG + Intronic
926198695 2:10778418-10778440 GGTCAGACCAGCCCTGGGTCAGG - Intronic
927255259 2:21035685-21035707 GATCAGAGTTGACAAGGGGCGGG + Exonic
927846739 2:26476167-26476189 GGTCAAGGCAGCCCAGGGCCTGG - Exonic
927857691 2:26537597-26537619 GCTCAGAGCAGGCCAGTGCCTGG + Intronic
930073696 2:47389902-47389924 GGGCAGAGATGACCAAGGGCTGG - Intergenic
931872654 2:66477585-66477607 GCTCCGTGGAGACCAGGGGCTGG + Intronic
932292148 2:70590849-70590871 TGTCAGAGAAGGCCTGGGGCAGG + Intergenic
932466082 2:71925322-71925344 GTTCTGGGCAGAGCAGGGGCCGG - Intergenic
932623970 2:73283995-73284017 GGGCAGGCCAGACCAGAGGCAGG - Intronic
933761089 2:85672637-85672659 GGTCAGAGGTTACCAGGGGCTGG + Intergenic
934149012 2:89127397-89127419 GACCAGAGCAGTGCAGGGGCTGG - Intergenic
934218282 2:90054649-90054671 GACCAGAGCAGTGCAGGGGCTGG + Intergenic
934620323 2:95799566-95799588 GCTGAGAGCAGGCCAGGAGCTGG - Intergenic
934640568 2:96024997-96025019 GCTGAGAGCAGGCCAGGAGCTGG + Intronic
936117035 2:109710770-109710792 GGTGAGAGGAGACCTGGGGAAGG + Intergenic
937299525 2:120830596-120830618 GCTCAGGGCAGAGCAGGGACGGG + Intronic
937828264 2:126391199-126391221 GGTCAGAGCAGTCCATGCCCAGG + Intergenic
938307687 2:130266193-130266215 GGTCACTGCAGACCATGGGTCGG + Intergenic
938502060 2:131835538-131835560 GGACAGAGCAGATCTGTGGCTGG - Intergenic
946165118 2:217858978-217859000 GGTGAGAGTTGAGCAGGGGCTGG - Intronic
946226589 2:218267102-218267124 GGACTGAGCAGAACAGGTGCTGG + Intronic
946336103 2:219037664-219037686 GCTCAGAGCAGAGCAGGGAAGGG + Intronic
946408010 2:219502441-219502463 GGTGAGAGCAGAGTGGGGGCTGG + Exonic
947558785 2:231126323-231126345 GGTCAGGGGAGACCTGAGGCAGG + Intronic
948693905 2:239723099-239723121 GGCCAGCACAGACGAGGGGCAGG + Intergenic
1171951148 20:31423738-31423760 GGTCAGGGCACACCAGGGCCTGG - Intergenic
1172183392 20:33016990-33017012 GGTTAGGGCAGCCCTGGGGCTGG - Intronic
1172438022 20:34944008-34944030 CGTCACAGCAGACCAGTGGGGGG + Intronic
1172482269 20:35277987-35278009 GGTGAGGGCAGAGCCGGGGCGGG - Intergenic
1172590524 20:36114496-36114518 GGTCAGTGCTGTCCATGGGCAGG - Intronic
1173295195 20:41749446-41749468 GGTCAGAGCAGGGAAGGAGCAGG - Intergenic
1174208438 20:48858004-48858026 GAGCAGAGCAGACCTGGGGAGGG + Intergenic
1174343046 20:49909917-49909939 GGTAACAGCACTCCAGGGGCCGG - Intronic
1175143095 20:56875005-56875027 GGTCAGAGCAGAGCAAGGCAAGG + Intergenic
1175221589 20:57420525-57420547 GGTTGGAGGTGACCAGGGGCAGG + Intergenic
1175536249 20:59716175-59716197 GGGAAGAGCAAAGCAGGGGCAGG - Intronic
1175596726 20:60240590-60240612 GCTCAGGGCAGACCAGGGCTTGG - Intergenic
1175764851 20:61585152-61585174 TTTCAGAGCAGACCTGTGGCTGG - Intronic
1175815473 20:61881143-61881165 GGTCACAGCAGAGCAGGGTCAGG + Intronic
1176084744 20:63290830-63290852 GGTCAGAACAGAGCAGGGCCAGG - Intergenic
1176181707 20:63752515-63752537 GGGCAGAGCAGACAGGGGCCCGG + Intronic
1177160853 21:17546506-17546528 GGCCAGAGCAGAGAAGGGGGAGG + Intronic
1179243349 21:39610564-39610586 GGACAGAGCAGACCACTGCCTGG + Intronic
1179804154 21:43826481-43826503 CGTCAGAGCAGACCTGGCGCCGG - Intergenic
1180568667 22:16696765-16696787 GGTGCCAGCATACCAGGGGCAGG + Intergenic
1180941749 22:19663998-19664020 AGTCAGTACAGACCAGGAGCAGG + Intergenic
1181306727 22:21921338-21921360 GGTCAGAGCAGTGCAGGGGGAGG - Exonic
1182338354 22:29600383-29600405 GGTCACACCAGACCAGGAGTTGG - Intergenic
1182415503 22:30218568-30218590 TGTCAAGGCAGACCTGGGGCTGG - Intergenic
1182769994 22:32787899-32787921 GGTCAGGGCAGTCCTGGAGCTGG + Intronic
1183074678 22:35419402-35419424 GGTGACTGCAGTCCAGGGGCTGG - Intronic
1183382379 22:37496605-37496627 GAGTAGAGCAGCCCAGGGGCTGG + Intronic
1183895634 22:40966333-40966355 AGTCAGAGCATACCACGCGCTGG - Intronic
1184104432 22:42359337-42359359 GATCAGGGCAGCCCAGGGGAGGG + Intergenic
1184244875 22:43230872-43230894 TGTCAGTGCAGCTCAGGGGCTGG - Intronic
1184416954 22:44357801-44357823 GCTCAGAGAAGGCAAGGGGCTGG - Intergenic
949494549 3:4619591-4619613 GGGCAGAGGAGAGCAGGGGAGGG - Intronic
949494591 3:4619771-4619793 GGGCAGAGGAGAGCAGGGGAGGG - Intronic
949494597 3:4619791-4619813 GGGCAGAGGAGAGCAGGGGAGGG - Intronic
949836492 3:8275482-8275504 TGTCAGAGCAGCCCAGGGAAGGG + Intergenic
950007098 3:9698443-9698465 CGGCAGAACAGGCCAGGGGCAGG - Intronic
950232457 3:11288110-11288132 AGTCAGACAAGACCAGGGTCTGG - Intronic
950462445 3:13133549-13133571 GGTCAGGGCAGAGCCGGGCCTGG - Intergenic
950691098 3:14658684-14658706 TGGCAGAGCAGACATGGGGCAGG + Intronic
950831181 3:15877922-15877944 GGGCTGGGCAGGCCAGGGGCGGG - Intergenic
952269104 3:31815152-31815174 GGGAAGAGCAAGCCAGGGGCTGG - Intronic
952269116 3:31815210-31815232 GGGAAGAGCAAGCCAGGGGCTGG - Intronic
952886048 3:38011471-38011493 GCTCAGAGCAGGCCTTGGGCCGG + Intronic
953024671 3:39138002-39138024 GGTCAGAGCAGGCCAGGAATGGG + Intronic
953406679 3:42663292-42663314 GGCCAGAGAAGAGTAGGGGCTGG - Intronic
954387756 3:50253204-50253226 GGGCAGGGCAGGGCAGGGGCTGG + Intronic
954418732 3:50407375-50407397 GGTCAGAGCCCACGAGTGGCAGG - Intronic
954458161 3:50611214-50611236 GGACAGAGGGGGCCAGGGGCTGG + Intronic
955928595 3:64032593-64032615 GAACAGAGGATACCAGGGGCTGG + Intergenic
956311455 3:67885110-67885132 GGTAAGAGGAGAGCAGGGGAAGG + Intergenic
956717076 3:72088143-72088165 AGGCAGAGCAGGCTAGGGGCAGG + Intergenic
957313389 3:78547090-78547112 GGTGAGGGCAGGGCAGGGGCAGG - Intergenic
961449168 3:126994786-126994808 AGGCAGGGCAGCCCAGGGGCCGG - Intronic
961476672 3:127151042-127151064 GGTTTGGGCAGAGCAGGGGCAGG + Intergenic
961743086 3:129046216-129046238 GGCCAGCGCAGACCAGGCGAGGG - Intergenic
961789672 3:129366549-129366571 GGTCAGCCCTGACCAGGGGCCGG - Intergenic
961824155 3:129590036-129590058 GGTCAGAGCAGACACCCGGCAGG - Intronic
962250326 3:133832284-133832306 GTTGAGAGCAGACCAGTGGAGGG + Intronic
963093035 3:141504567-141504589 GGGCAGAGCAGACACGGGTCTGG - Intronic
964472315 3:157068573-157068595 TGTCACAGCATACAAGGGGCTGG + Intergenic
966239975 3:177745168-177745190 GGTCAGTGTAGACCAAGGGAGGG - Intergenic
967807537 3:193728966-193728988 GGACAGAGCAGCCCATGGGCAGG - Intergenic
968460699 4:723454-723476 GGGCAGGGCAGACCAGAGGAGGG + Intronic
968525990 4:1057445-1057467 GGTCTGAGAAGAGCAGGGGGAGG + Intronic
968639449 4:1704899-1704921 GGTCAGTGCAGAACAGGAGGAGG - Intronic
968661087 4:1799116-1799138 GGTCCCACCAGACCAGGGGCTGG - Intronic
968973717 4:3810370-3810392 GGTCAGAGCACACCAGGGCCAGG + Intergenic
968996405 4:3948485-3948507 GGTCAGTGGTGGCCAGGGGCCGG + Intergenic
969310550 4:6350783-6350805 TGTCACAGCAGACCACGTGCTGG - Intronic
969428886 4:7141426-7141448 GGTCAGAGAAACCCAGGGGGTGG + Intergenic
969669370 4:8581279-8581301 GCTGAGCGCAGACCAGTGGCTGG + Exonic
969757577 4:9160203-9160225 GGTCAGTGGTGGCCAGGGGCCGG - Intergenic
969870644 4:10102472-10102494 GGTGAGAGAAGAAGAGGGGCTGG - Intronic
972629260 4:40829237-40829259 GCAGAGAGCAGACCAGGGCCAGG - Intronic
973846476 4:54918015-54918037 GGTCAGAGCAGGGCGGGGGTTGG - Intergenic
978613900 4:110574123-110574145 GGTGAGAGCAGAGTAGGGGAGGG + Intergenic
981162524 4:141515542-141515564 TGTCAGAGGAGAGCAGGGGAAGG + Intergenic
984873245 4:184345743-184345765 GGGCAGAGCAGGCCAAGAGCTGG + Intergenic
986430049 5:7672893-7672915 AGGCGGAGCAGAGCAGGGGCTGG - Intronic
986719566 5:10551421-10551443 GGTCAGAGGACACCCGGGGTGGG + Intergenic
987086761 5:14477195-14477217 GGTGAGAGAAGACCAGAGCCAGG + Intronic
987315573 5:16720106-16720128 TGTCAGGGCAGAGCAGGGACTGG - Intronic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
991000514 5:61778156-61778178 GGAGAGAGCAGACAAGAGGCGGG + Intergenic
991136311 5:63186087-63186109 GGGCAGAGCTGCCCAAGGGCTGG + Intergenic
992160438 5:73995762-73995784 GCAGAGAGAAGACCAGGGGCTGG - Intergenic
996463127 5:123770341-123770363 GGTCTGAGGAGACTAGGGTCTGG - Intergenic
997192966 5:131956525-131956547 GGTCAGACCAGACCAGGGACTGG - Intronic
997364913 5:133319487-133319509 GGGAAGAGCAGGCCAGGAGCAGG + Intronic
997367039 5:133332472-133332494 GCTCAGAGAACACCTGGGGCCGG + Intronic
998039692 5:138944468-138944490 GGTCAGCCCAGCCCAGGAGCAGG + Intergenic
998161019 5:139813094-139813116 GAAAAGAGCAGACCTGGGGCCGG - Intronic
999122427 5:149219542-149219564 CGTCAGGGCAGAGCAGGGCCTGG + Intronic
999235182 5:150086357-150086379 GGTAAGAGCAGAACGGGGGGTGG - Exonic
1001049777 5:168404842-168404864 GGTCAGACCAAACCAGAGACAGG - Intronic
1002051673 5:176575058-176575080 GGGCAGAGCAGACTTGGGTCAGG - Intronic
1002306155 5:178285102-178285124 AGTCAGAGCCGACAAGGGCCCGG - Intronic
1002467928 5:179417080-179417102 TGAAAGAGCAAACCAGGGGCTGG + Intergenic
1002756431 6:164923-164945 GGTCAGAGCAGAAGGGGAGCTGG - Intergenic
1003062651 6:2875353-2875375 GGTCAGGGCAGGCCCCGGGCCGG + Intergenic
1005383531 6:25262655-25262677 GGACAGAGGATACCAGAGGCTGG + Intergenic
1006188526 6:32193591-32193613 GTTTAGTGCAGACAAGGGGCAGG + Intronic
1006406830 6:33850337-33850359 GGTCAGGGCAGAGCTGGGACCGG - Intergenic
1006417861 6:33915474-33915496 GGTCAGAGAAGACCTGGTGGAGG + Intergenic
1006752577 6:36387837-36387859 GGGCAGGGCAGGGCAGGGGCCGG + Intergenic
1006998104 6:38282523-38282545 CATCAGAGCAGAGGAGGGGCAGG - Intronic
1007179066 6:39915487-39915509 GGTCACAGGAGACCAGTGCCTGG - Intronic
1007409268 6:41652422-41652444 GGTCTGAGCAGAGGAGGGCCAGG + Intronic
1007468882 6:42075247-42075269 GTTCAGGCCAGACCAGGTGCCGG - Intronic
1011749727 6:90443008-90443030 GGGCTGAGCTGACCTGGGGCTGG - Intergenic
1012081685 6:94766310-94766332 GGTGAGAGTAGATCAGGGCCTGG + Intergenic
1013126966 6:107193234-107193256 GGAGAGAGCAGTACAGGGGCAGG - Intronic
1013945468 6:115717348-115717370 GGCCAGAGCAGATGAGGAGCTGG - Intergenic
1017317271 6:153046166-153046188 GGACATAGCATACCAGAGGCTGG + Intronic
1017534211 6:155329141-155329163 TGTCAAAGCAGACCTGGGGTGGG + Intergenic
1019264083 7:102640-102662 GCTCAGAGCAGACAAGGCCCCGG - Intergenic
1019595781 7:1857711-1857733 GGCCAGGGCTCACCAGGGGCCGG + Intronic
1019665508 7:2250188-2250210 GGTGGGCGCAGAGCAGGGGCAGG - Intronic
1019668285 7:2263682-2263704 GGGAAGAACAGACCATGGGCTGG - Intronic
1019971839 7:4547824-4547846 GGGGAGAGGGGACCAGGGGCTGG - Intergenic
1020129606 7:5552288-5552310 GGACAGAGCAGGACAGGGCCTGG - Intronic
1020320684 7:6936899-6936921 GGTCAGTGGTGGCCAGGGGCCGG + Intergenic
1020721905 7:11755716-11755738 GCTCAGAGCAGACCAGGGGAAGG + Intronic
1022008891 7:26292051-26292073 GGGCAGAACAGAGCAGGGCCGGG - Exonic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1023043914 7:36195306-36195328 GGGCAGAGCAGCCCAGTGGATGG + Intronic
1023168701 7:37369195-37369217 TGACAGTGCAGACCAGTGGCTGG + Intronic
1023735805 7:43235086-43235108 AGCCAGAGCACACCTGGGGCTGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025004735 7:55344946-55344968 GGTCCGAGAAGACCAAGCGCTGG + Intergenic
1032686404 7:134238891-134238913 GGTCAGAGAAGAACAGAGCCAGG - Intronic
1032705203 7:134415262-134415284 GGGCAGAGGAGAGCAGTGGCAGG - Intergenic
1032765809 7:134991905-134991927 GGCCAGAGCAAACAAGGGGCTGG + Intronic
1033466034 7:141590517-141590539 GGTCAGCACAGTCCAGGGGGAGG + Intronic
1033803087 7:144923827-144923849 GATCAGAGCAGACCAGGTAAGGG + Intergenic
1034996359 7:155579793-155579815 GGCCAGGGCAGAACAGGGCCAGG + Intergenic
1035057627 7:156046502-156046524 GGCCAGAGCAGCCCAGGTGCAGG - Intergenic
1035204949 7:157289248-157289270 GGTCAGTGCTGGCCTGGGGCAGG + Intergenic
1035822401 8:2607616-2607638 AGCCAGAGGAGAACAGGGGCTGG + Intergenic
1036182168 8:6594843-6594865 GGTCAGAGCACACCAGGCTGGGG + Intronic
1036380842 8:8235529-8235551 GGTCAGCGGTGGCCAGGGGCTGG - Intergenic
1036471658 8:9057945-9057967 TGTCAGAGAAGTCCAGGGGGTGG + Intronic
1037445019 8:18956825-18956847 GGTCAGAGGAGATTAGGGGTAGG - Intronic
1039893395 8:41699348-41699370 GGACACAGCAGGCCAGGCGCTGG - Intronic
1040478609 8:47803342-47803364 GCTCAGAGCAGCCCTGGGACCGG + Exonic
1040651724 8:49456768-49456790 TGCCAGAGCAGAGCAGGGCCAGG + Intergenic
1041833176 8:62180198-62180220 GGGCAGAGCGGACCTGGGGAGGG - Intergenic
1042430183 8:68697750-68697772 AGTGAGAGCAGTCCATGGGCTGG - Intronic
1042894352 8:73650986-73651008 GGGCAGGGCTGGCCAGGGGCAGG - Intronic
1044873900 8:96645486-96645508 GGCTGGAGCAGGCCAGGGGCGGG + Intronic
1045288291 8:100810586-100810608 GGGCAGTGCAGACCAGAGACAGG - Intergenic
1045499268 8:102732379-102732401 GGTCAGAGCTGACCAGCTCCTGG + Intergenic
1045718279 8:105074486-105074508 GGACAGAGCAGGAAAGGGGCAGG + Intronic
1048022923 8:130557130-130557152 AGTAAGAGCAGGCCAGGGTCAGG - Intergenic
1048300502 8:133247776-133247798 GGGCAGAGGAGAGGAGGGGCAGG + Intronic
1048460423 8:134616740-134616762 GGCCTGAGCAGCACAGGGGCTGG + Intronic
1049190537 8:141285022-141285044 GGCCTGAGCAGAACAGGGTCCGG + Intronic
1051545225 9:18266320-18266342 AGTCACAGCAGACCAGAGCCTGG + Intergenic
1053282188 9:36827662-36827684 GATCAGAGTAGACCAAGAGCAGG + Intergenic
1053305521 9:36981850-36981872 GGTCAGAGCAAACAAGCTGCTGG + Intronic
1055804802 9:80080930-80080952 GGTCAGTGTACACCAGGGGTAGG - Intergenic
1059639077 9:116199130-116199152 GTTCAGAGGAAACCAGGTGCTGG - Intronic
1060213560 9:121724932-121724954 GGTCTGAGAGGGCCAGGGGCAGG + Intronic
1061113696 9:128594313-128594335 GGTCGGAGCAGACTTGGAGCAGG + Exonic
1061934589 9:133850295-133850317 GGTCAGGGCAGAGCAGGGTAGGG - Intronic
1061937220 9:133864500-133864522 GGTCAGAGCAGGCCATGGTTGGG - Intronic
1062039320 9:134396836-134396858 GGTCTGAGCAGGCCACAGGCTGG - Intronic
1062099243 9:134719636-134719658 GGCCAGGGCAGGACAGGGGCAGG + Intronic
1062162008 9:135085923-135085945 GGTTAGAGCAGTCCAAGTGCAGG + Intronic
1062453565 9:136625512-136625534 GATCAGACCAGGGCAGGGGCTGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062624594 9:137437031-137437053 GGGCACAGAGGACCAGGGGCTGG + Intronic
1185446649 X:261374-261396 GGTCAAAGGATAGCAGGGGCAGG - Intergenic
1186501766 X:10056540-10056562 GATCAGTGGTGACCAGGGGCTGG - Intronic
1187058363 X:15762334-15762356 TGTCAGAGTAAACCAGAGGCAGG + Intronic
1190126818 X:47712962-47712984 GCTAAAAGCAGACCAGGGGCGGG + Intergenic
1191817772 X:65266865-65266887 GGTCACAGCACACCAGGGCAAGG + Intergenic
1198551220 X:137747399-137747421 GGACAGAGCAGACGAGCAGCGGG - Intergenic
1199848714 X:151710145-151710167 GGTCAGAGTAGAATAGGGGCTGG + Intergenic
1200181684 X:154154775-154154797 GGGCAGAGCAGCTTAGGGGCAGG - Intronic
1200187333 X:154191889-154191911 GGGCAGAGCAGCTTAGGGGCAGG - Intergenic
1200192982 X:154229029-154229051 GGGCAGAGCAGCTTAGGGGCAGG - Intronic
1200198737 X:154266833-154266855 GGGCAGAGCAGCTTAGGGGCAGG - Intronic