ID: 922189944

View in Genome Browser
Species Human (GRCh38)
Location 1:223309494-223309516
Sequence GTGGTGCTCAGGACTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 469}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922189934_922189944 19 Left 922189934 1:223309452-223309474 CCTCTCTAGGTTCTACTCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 52
Right 922189944 1:223309494-223309516 GTGGTGCTCAGGACTGGGGAGGG 0: 1
1: 0
2: 6
3: 44
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922189944 Original CRISPR GTGGTGCTCAGGACTGGGGA GGG Intronic
901011955 1:6207181-6207203 GGAGTGCCCAGGACTGGGCAAGG + Intronic
901137798 1:7009100-7009122 CAGGAGCTCAGGGCTGGGGAGGG + Intronic
901194870 1:7434735-7434757 GTGGTGGACAGTAGTGGGGAGGG + Intronic
901296084 1:8161817-8161839 GGGGTGCTCAGGTTTGGGGGTGG + Intergenic
902263441 1:15244530-15244552 GTGGTGTTCAGGCCTGGGCAGGG + Intergenic
902709673 1:18230207-18230229 ATGGTGAGCAGGACTGGGGCAGG + Intronic
903233411 1:21935426-21935448 GTGGTGCTAGGGGCTGGGGTGGG - Intronic
903392669 1:22975726-22975748 CTAATGCTCAGGATTGGGGATGG + Intergenic
903947311 1:26972010-26972032 CTGGTGCCATGGACTGGGGATGG + Intergenic
904521683 1:31100781-31100803 CTGGTGCAGAGGACTGGGCAGGG - Intergenic
904818936 1:33227830-33227852 ATGGTGCTCAGAAATGGAGAGGG + Intergenic
905371251 1:37483687-37483709 GTGGGCCTCAGGGCTGGGAATGG - Exonic
905869231 1:41393691-41393713 GTGGGGCTGAGCACTGGGGTGGG + Intergenic
905875125 1:41427442-41427464 TTGCTGCTCAGCCCTGGGGAGGG - Intergenic
906683725 1:47749027-47749049 GTTGGGCTCGGGACTGGGGGTGG + Intergenic
907115027 1:51960607-51960629 GTGTTGCTAAGGACAGGGGTGGG - Intronic
907297401 1:53464164-53464186 GCGCTGCTCTGCACTGGGGAAGG - Intronic
907381601 1:54095397-54095419 GGTGTGGTCAGGATTGGGGAGGG + Intronic
907518414 1:55007787-55007809 TTGGTGCTCAGTAATGTGGATGG - Intronic
908556030 1:65257012-65257034 GTGGTGGTGAGGGCAGGGGAGGG - Intronic
910840688 1:91558439-91558461 GTGATGCCTAGGATTGGGGAGGG - Intergenic
911105032 1:94122960-94122982 GTGGTGCTCATAACTGAGGAGGG + Intergenic
911553160 1:99308825-99308847 GTGGTGGTGAGAAGTGGGGAAGG - Exonic
911665115 1:100543070-100543092 GTGGGGCTGAGGAAGGGGGAAGG + Intergenic
912582368 1:110732248-110732270 GTGATGATTAGGAATGGGGATGG + Intergenic
912697568 1:111852919-111852941 GTGGTGCTCAGGACTTGGGGAGG - Intronic
913233792 1:116763421-116763443 GTGGGGCTCGGGTCAGGGGACGG - Intronic
913275357 1:117132440-117132462 CTGGAGCACTGGACTGGGGAGGG + Intergenic
913342462 1:117772323-117772345 GTGGCGCCCAAGACTCGGGAGGG - Intergenic
914248964 1:145906496-145906518 GAGGGGCACAGGCCTGGGGATGG + Exonic
914443198 1:147724813-147724835 GTGGTTACCAGGAGTGGGGAGGG - Intergenic
915534417 1:156526375-156526397 CTAGAGCTCAGGACTGGGCAAGG - Exonic
915650604 1:157307659-157307681 GTGTAGCTCAGCTCTGGGGAGGG - Intergenic
915934216 1:160081432-160081454 GTGGTACCCAGGACTGGGGAGGG + Intergenic
917300694 1:173570899-173570921 GTGGTGGGGAGGACTGGGGAGGG + Intronic
918105103 1:181410088-181410110 GAGATGCTAAGGCCTGGGGAGGG + Intergenic
918302144 1:183214293-183214315 GTAGGGCTGAGGACTGGGGAAGG + Intronic
918622986 1:186625888-186625910 GTGAAGCTCAGGAATGGGGTAGG - Intergenic
918623945 1:186636777-186636799 TTTCTGTTCAGGACTGGGGACGG - Intergenic
921329353 1:214020002-214020024 AAGGTGGTCAGGAGTGGGGAAGG - Intronic
921834648 1:219765275-219765297 GTGGTGCATTGGACAGGGGAGGG + Intronic
922189944 1:223309494-223309516 GTGGTGCTCAGGACTGGGGAGGG + Intronic
922753487 1:228082032-228082054 GTGGGGCCCAGGGTTGGGGACGG - Intergenic
923035021 1:230279686-230279708 GGGGCGCTCCGGCCTGGGGAAGG - Exonic
923103830 1:230838866-230838888 GTGGTGGTCAGGGCTGGGGAAGG + Exonic
924104370 1:240635748-240635770 GTGGTGCTGAGGAATGGGGGCGG - Intergenic
924658830 1:245997698-245997720 GAGGTGCTGAGGTCTGGGGAAGG - Intronic
1063355513 10:5395181-5395203 TGGGTGCTCAGAACTGGGGAGGG - Intronic
1064601270 10:16996014-16996036 GTGGAGGTCAGGATCGGGGAGGG - Intronic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1066328397 10:34390617-34390639 GGGATTGTCAGGACTGGGGAAGG - Intronic
1067829187 10:49600325-49600347 TTTGTGCTCAGGAATGGGGCTGG - Intergenic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1068201173 10:53786293-53786315 CTGGATCTCAGGACTGAGGAGGG - Intergenic
1069167631 10:65182687-65182709 GTGGTTGCCAGGATTGGGGAGGG - Intergenic
1069281763 10:66663273-66663295 TTGATGGTCATGACTGGGGAGGG - Intronic
1069784474 10:70979009-70979031 GTGGTGCTCAGGGTAGGGAAGGG - Intergenic
1069866389 10:71506212-71506234 GTGGTTGCCAGGGCTGGGGAAGG + Intronic
1070805406 10:79267915-79267937 GTGGTGGTGAGGGCTTGGGAGGG - Intronic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071507919 10:86243883-86243905 ATGGTGGCGAGGACTGGGGAAGG - Intronic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1072157670 10:92738596-92738618 GAGGTGCCCAAGAGTGGGGAAGG + Intergenic
1074422570 10:113322356-113322378 GTTGTGCTGAGGCCTGGGGTGGG + Intergenic
1074549951 10:114433458-114433480 GTAGTGCTCTGCTCTGGGGAGGG - Intronic
1075078653 10:119368371-119368393 GTGGTGCTGGGGGCGGGGGATGG + Intronic
1075418960 10:122286807-122286829 GGGGTGGTCAGGACTGGAAAAGG - Intronic
1075575251 10:123572960-123572982 CTGGTGTTCAGTACTGGTGAAGG - Intergenic
1076228427 10:128799778-128799800 GTGGTGGTCAGAACTGGGGAGGG + Intergenic
1076762825 10:132614057-132614079 AGGGTGCTCACGACTGGCGATGG - Intronic
1076849459 10:133086009-133086031 GTGGTGGTCAGGACCCGGGAGGG - Intronic
1077087342 11:760546-760568 GTGTTGATCAGGACAGAGGAAGG - Intronic
1078463263 11:11531372-11531394 AGGGCACTCAGGACTGGGGAAGG - Intronic
1078543780 11:12231571-12231593 GTTCTCCTCAGTACTGGGGATGG + Intronic
1078624789 11:12945219-12945241 GTGATGCTGAGGACAGGGGTCGG - Intergenic
1079096890 11:17516926-17516948 GTGGAGCTGCGGCCTGGGGAAGG - Intronic
1081859368 11:46323811-46323833 TTGGTGCTCAGGTCTGGGTGAGG - Intergenic
1082160427 11:48883245-48883267 GAGGTGCACAGGGCTGGGGGTGG + Intergenic
1082161939 11:48897161-48897183 GAGGTGCACAGGGCTGGGGGTGG - Intergenic
1083726541 11:64631301-64631323 GTGGAGCTAGGGGCTGGGGAAGG + Intronic
1083749536 11:64753726-64753748 GTGGGGCTGGGGACTGGGGATGG - Intronic
1084531617 11:69731024-69731046 GTGGTGGTCAGGACAGGTGGAGG - Intergenic
1084658768 11:70535120-70535142 GTAGTGCTCATGACCAGGGATGG + Intronic
1085185026 11:74568569-74568591 TAGTTGCTCAGGGCTGGGGAGGG - Intronic
1086936500 11:92751082-92751104 GTGGTGCTGAGGCCAGGGAAAGG + Intronic
1087045837 11:93843227-93843249 CTGGTGCTAGGGATTGGGGAAGG - Intronic
1088352820 11:108909341-108909363 GTGGGGCACAGGACAAGGGAAGG - Intronic
1088352831 11:108909371-108909393 GTGGGGCACAGGACAAGGGAAGG - Intronic
1088352842 11:108909401-108909423 GTGGGGCACAGGACAAGGGAAGG - Intronic
1088352853 11:108909431-108909453 GTGGGGCACAGGACAAGGGAAGG - Intronic
1088497529 11:110446599-110446621 GTGGTGCTCATTACTGAGGTAGG - Intronic
1089173613 11:116533226-116533248 GTGGTCCGCTGGCCTGGGGAGGG + Intergenic
1091131384 11:133149936-133149958 CTTGTACTCAGCACTGGGGAGGG + Intronic
1091455913 12:607782-607804 GTGGCCCACAGGACTGGGGGTGG + Intronic
1091548290 12:1518951-1518973 CTGGAGCCCAGGACTGGGTAGGG + Intergenic
1091778671 12:3200481-3200503 GTGGGGCTCAGCGCTGGGGCTGG + Intronic
1093123332 12:15299621-15299643 GAGGTGCCCAAGGCTGGGGATGG - Intronic
1093646341 12:21589830-21589852 TTGCTGCTCAGTAATGGGGATGG - Intronic
1094092097 12:26661781-26661803 GTGGAGGTCTGGAGTGGGGAAGG - Intronic
1094319948 12:29172907-29172929 GTGGGGCTCCATACTGGGGATGG + Intronic
1095286059 12:40411730-40411752 TTGGGGCTTAGGAATGGGGAAGG + Intronic
1096105655 12:48995837-48995859 GTGGTGGTCTGAGCTGGGGAGGG - Exonic
1096517328 12:52164218-52164240 GGGGAGCTGAGGACTGGAGAGGG - Intergenic
1096547543 12:52350997-52351019 ATGGTCCTCTGGACTTGGGACGG + Intergenic
1096657246 12:53099257-53099279 GGAGAGCTCAGGACTGGGAAGGG - Intronic
1098097167 12:66970679-66970701 GTGGTGGTAAGGAGTGGGGAAGG + Intergenic
1098303392 12:69077572-69077594 GTGGTGACCGGGGCTGGGGATGG + Intergenic
1098916301 12:76260308-76260330 GTGGTGCTGAGCACAGGTGATGG + Intergenic
1100784367 12:98063519-98063541 ATGGTGCTCAGGACTGTACATGG - Intergenic
1100979726 12:100154795-100154817 GTGGAGCTCAGGGGAGGGGAAGG + Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101899764 12:108782940-108782962 GTGGAGCTCCTGATTGGGGAAGG + Exonic
1103703130 12:122858292-122858314 CCGCTGCTCAGGGCTGGGGATGG - Intronic
1103717751 12:122955520-122955542 GAGGGGCTCAGGACCTGGGAGGG + Intronic
1103862171 12:124024220-124024242 GAGGAGATCAGGAATGGGGAAGG - Intronic
1105292408 13:19061423-19061445 GTGGTGCTGGGGTCTGGGGCAGG - Intergenic
1107418584 13:40223953-40223975 GTGGTGGTATGGAGTGGGGAGGG - Intergenic
1111590205 13:90336790-90336812 GAGGTGATCAGGACAGGTGAGGG + Intergenic
1111951771 13:94713493-94713515 GTGGAGCCCAGGACTCGGGGAGG + Intergenic
1112180063 13:97069673-97069695 GTGAGGCTGAGGGCTGGGGAGGG - Intergenic
1112572700 13:100608254-100608276 GTGGTGCTGAAGACAGGGAAGGG + Intronic
1113312469 13:109144455-109144477 CTGGTGCTCAGCACTGGGGCTGG + Intronic
1113474602 13:110571604-110571626 GTGATGCTTAGAACTGGGGGAGG + Intergenic
1113526707 13:110984809-110984831 GAGGTGCACAGGACAGGGCATGG + Intergenic
1113937653 13:114002925-114002947 CTGGGACACAGGACTGGGGACGG - Intronic
1114402939 14:22426547-22426569 GTGGTGCTCAGGAGTGTGAGTGG - Intergenic
1114456826 14:22860598-22860620 GTGGGGGTCAAGACTGGGCATGG - Intergenic
1114567931 14:23646114-23646136 GTGGTGCTCAGGGCCACGGATGG - Intergenic
1117047628 14:51828835-51828857 CAGGGGCTCAGGGCTGGGGACGG + Intronic
1117180189 14:53183466-53183488 GTGGTGCCCAGGAGAGGGCATGG + Intergenic
1119178904 14:72590867-72590889 CTGAGGATCAGGACTGGGGAAGG + Intergenic
1119189898 14:72674145-72674167 GTGGTGCTGGAGACTGGAGAGGG - Intronic
1119765417 14:77184555-77184577 GTGGTGCTCAGGCCATGGGCAGG + Intronic
1121433420 14:93903231-93903253 GGAGTGCTCAGGACTGGGAAGGG + Intergenic
1121561864 14:94881891-94881913 TTGCTGCTCAGGACTAGGGCTGG + Intergenic
1122093169 14:99353245-99353267 GTCGTGCCCTGGGCTGGGGAGGG - Intergenic
1122254298 14:100465366-100465388 GTGGTGGCCAGGGCTGGGGGAGG - Intronic
1122405187 14:101496572-101496594 GGGGTGTTCATGACGGGGGAGGG + Intergenic
1122844172 14:104481657-104481679 GTGCTGCTGAGGGCTGTGGAGGG - Intronic
1122913707 14:104846134-104846156 GTTCTGCTCAGGACTGGAGGTGG - Intergenic
1122925812 14:104899272-104899294 GTGGTGCACAGGACACTGGATGG + Intergenic
1122982460 14:105197812-105197834 TGGGTGCTCAGGCCTGGGGATGG - Intergenic
1122984832 14:105207264-105207286 GTGGGGCTCAGGACTGGGTCAGG - Intergenic
1123937340 15:25200370-25200392 GTGGTGCTGAGGTCTGGCCATGG + Intergenic
1125100074 15:35902354-35902376 GTTGTGATCAGGTATGGGGAAGG + Intergenic
1125327333 15:38549218-38549240 GTGGTGCTCATGAACTGGGAAGG + Intronic
1125543502 15:40486518-40486540 GTGGGGCTCAGTGATGGGGAGGG - Intergenic
1126786277 15:52179956-52179978 GCGGTGCTCGGGGCCGGGGACGG - Intronic
1127286195 15:57535782-57535804 GTGGGGGTGAGGACTGGAGAAGG + Intronic
1128212852 15:65914467-65914489 TTGGTGCTCACGACTGGGGAGGG - Intronic
1128891403 15:71335013-71335035 ATGGAGCTCAGGTCTGGGGAGGG + Intronic
1128939794 15:71778703-71778725 TTGGTGCTCAAGTCTGGGGGTGG - Exonic
1129186988 15:73914316-73914338 GTGGGGCTCAGGGCTGGGCAGGG - Intergenic
1129800171 15:78407821-78407843 GTGGTGCTGAGAAATGAGGAAGG - Intergenic
1129961902 15:79694194-79694216 GTTATGCTCAGGGCTGGGCATGG - Intergenic
1130073556 15:80669400-80669422 GTGGTGATCAGGACCCAGGATGG + Intergenic
1130886395 15:88096223-88096245 GGGCTGGTCAGGATTGGGGATGG - Intronic
1130910057 15:88264800-88264822 CTGGTGCTGTGGGCTGGGGAGGG - Intergenic
1130964330 15:88685916-88685938 GATGTGCTCAGGATTGGGGTGGG + Intergenic
1131008199 15:88995731-88995753 TGGGTGCTGAGCACTGGGGATGG + Intergenic
1131788298 15:95936609-95936631 GTGGAGCTGAGTATTGGGGAAGG - Intergenic
1132214198 15:100050674-100050696 TAGGTGCTCAGGACTAGGGATGG + Intronic
1132503728 16:296631-296653 GTCCTGCTGAGGGCTGGGGAAGG - Intronic
1132576987 16:668706-668728 GTGGTGCGCGGGACGAGGGAGGG + Intronic
1132702591 16:1228471-1228493 AGGGTCCTCAGGACAGGGGAAGG + Exonic
1132705736 16:1242397-1242419 AGGGTCCTCAGGACAGGGGAAGG - Exonic
1132709092 16:1258667-1258689 GAGGGGCTCAGGATGGGGGAGGG - Exonic
1132846615 16:2003750-2003772 GTGGTGAGCAGGACTGGGATGGG + Intronic
1133071422 16:3249132-3249154 GGGGTGCTCAGGAAAGAGGAGGG + Intronic
1133091892 16:3411166-3411188 TTGGTTGTTAGGACTGGGGAAGG + Intronic
1133339848 16:5029073-5029095 GTGATGCTCTGCACTGTGGAAGG - Intronic
1133927837 16:10207710-10207732 TTGGTCCTCAAGACTGGGGGTGG + Intergenic
1134592199 16:15463715-15463737 ATGGGGGTCAGGATTGGGGAGGG - Intronic
1135339654 16:21634952-21634974 GTGGGGATCTGTACTGGGGACGG + Intronic
1136062356 16:27735291-27735313 GATGGGCTCTGGACTGGGGAAGG + Intronic
1136240037 16:28937966-28937988 ATGGGGCTCAGGATGGGGGATGG - Intronic
1136509706 16:30729285-30729307 GTAGTGCTTAGGGCTGGTGAAGG + Intronic
1136780572 16:32897960-32897982 GGGGTGCTCAGGACACGGGGGGG + Intergenic
1138318929 16:56094401-56094423 GTGGGGCCCAGAACAGGGGAAGG - Intergenic
1138532201 16:57640598-57640620 TGTGTGCTCAGGAGTGGGGATGG + Intronic
1139961526 16:70720804-70720826 CTGGAGCTCAAGACTGGGGCCGG + Intronic
1140287052 16:73613745-73613767 ATGGTGCTCAGGATTGGTGCCGG + Intergenic
1140723896 16:77794903-77794925 TTGCTGATGAGGACTGGGGATGG + Intronic
1141186500 16:81791262-81791284 GAGGTGGTGAGGAATGGGGAGGG + Intronic
1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG + Exonic
1203083202 16_KI270728v1_random:1161926-1161948 GGGGTGCTCAGGACACGGGGGGG + Intergenic
1142967107 17:3588488-3588510 GTGGTGGTCAGGAGTGGGTGGGG - Intronic
1143334978 17:6165394-6165416 GTGGGGCTCAGAGCTGGGGCGGG + Intergenic
1143502990 17:7349820-7349842 GTGGTAATCAGGAGTGTGGAAGG - Intronic
1143666548 17:8365338-8365360 GAGGAGGTCAGCACTGGGGAGGG + Intergenic
1143768974 17:9155877-9155899 TTGGTTATCATGACTGGGGAGGG - Intronic
1144004970 17:11091384-11091406 GTGGTGCTGGGGGCTGAGGAGGG + Intergenic
1144371430 17:14595191-14595213 GTGGTTGCCAGGACTGGGGGAGG + Intergenic
1144573578 17:16415686-16415708 TTAGTGCTCAGAGCTGGGGAGGG + Exonic
1144850747 17:18242707-18242729 ATGGTGCTCAGGGGTGGGGGCGG - Intronic
1146724728 17:35147927-35147949 GGTGTGCCCTGGACTGGGGAGGG + Intronic
1147110490 17:38257517-38257539 GCGCCGCTCAGGACTGGGGGCGG + Intergenic
1147142122 17:38465848-38465870 GTGGAGGCCAGGACTGGGGGAGG + Intronic
1148073236 17:44920919-44920941 GTGGGGCTCAAGTCTAGGGATGG - Intergenic
1148332522 17:46820847-46820869 GTGGTGCTGAGAGCTGGGGAGGG + Intronic
1148419020 17:47530914-47530936 GCGCCGCTCAGGACTGGGGGCGG - Intronic
1148687505 17:49509014-49509036 GTGGAGCATTGGACTGGGGAGGG - Intronic
1148783746 17:50135258-50135280 GGGGTGTTGAGGACAGGGGAGGG + Exonic
1148860173 17:50600517-50600539 GGGGTCCTCAGGGATGGGGAGGG + Intronic
1148888708 17:50792299-50792321 GAGGTTCTCAGGCCTGGGGAAGG - Intergenic
1149525368 17:57351366-57351388 GTGTTGATGAGGACTGGGGAGGG - Intronic
1149657792 17:58319402-58319424 CTGGTGCCCAGGCCTGGGGCTGG - Intronic
1149997677 17:61413206-61413228 GAGGTGGTGGGGACTGGGGAGGG + Exonic
1150119433 17:62587584-62587606 GTGGTGCTCAGCACTGGAGAAGG + Intronic
1150201307 17:63360783-63360805 AGGGTAGTCAGGACTGGGGAGGG - Intronic
1151527625 17:74681732-74681754 GTGGTGGTCAGGACAGGTGATGG - Intronic
1151576592 17:74955557-74955579 GTGGAGCTCATAGCTGGGGATGG - Intronic
1152391440 17:80006156-80006178 CTGGTGCTCTGGGGTGGGGAGGG - Intronic
1152472125 17:80495489-80495511 GGGGTGCCCAGGCCTGGGGGAGG - Intergenic
1152519339 17:80846147-80846169 GTGGTGCTCACGACAGTGGCTGG - Intronic
1152841414 17:82571045-82571067 CTGGTGCTTATGCCTGGGGAGGG + Intronic
1153618784 18:6957003-6957025 GGGGTGCTCAGGAATGGCCAGGG - Intronic
1153704513 18:7732205-7732227 GTGATGGCCAGGGCTGGGGAAGG - Intronic
1153819868 18:8824094-8824116 GTGGTGGTCAGGAACGGGGCTGG - Intronic
1154026105 18:10708580-10708602 GCGGGGCTCAGGGATGGGGATGG + Intronic
1154129574 18:11725050-11725072 GTGGTGCCCAGAACAAGGGAAGG - Intronic
1155066929 18:22276124-22276146 GTGGTGCACAGGCCTGGGAAGGG - Intergenic
1155241778 18:23870813-23870835 GTGGTGCCAGGGGCTGGGGAGGG + Intronic
1155845007 18:30695168-30695190 TTGCTGCTCAGGTCAGGGGAGGG + Intergenic
1156454459 18:37285189-37285211 GGGATGGGCAGGACTGGGGAGGG - Intronic
1156913494 18:42438823-42438845 ATGGTGATGAGGGCTGGGGAGGG - Intergenic
1157187023 18:45549404-45549426 GTGGGGCTCAGGATTTGAGAAGG - Intronic
1157239709 18:45997712-45997734 AAGCTGCTCAGGACTGGGGTGGG - Intronic
1157844854 18:50993770-50993792 GTGGTGTGCAGGGCTGGGGAGGG - Intronic
1158437120 18:57441509-57441531 GTGGTGCAGAGGTCGGGGGAGGG - Intronic
1158547758 18:58410481-58410503 ATGGTGCTGGGGAATGGGGATGG + Intergenic
1159071297 18:63626469-63626491 GTGCTGCCGAGGATTGGGGAAGG - Intergenic
1159114805 18:64102025-64102047 TTGGTTGTCAGGACTTGGGAAGG - Intergenic
1160516998 18:79484141-79484163 GTGGTGCCCAGGGCAGGGGAGGG - Intronic
1160697027 19:489658-489680 GTGGTTGTCACGACTGGGAAGGG - Intronic
1160940592 19:1618838-1618860 GCAGCGCTCAGCACTGGGGAAGG - Intronic
1160955424 19:1689176-1689198 GGGGTGCTGAGGACTGCGGAGGG + Intergenic
1160990883 19:1859863-1859885 GTGATTGTCACGACTGGGGAGGG + Intronic
1161016700 19:1986996-1987018 GGGAGGCTCAGGCCTGGGGAGGG + Intronic
1161021614 19:2014000-2014022 GAGGTGGTGAGGACTGGGGACGG + Intronic
1161079412 19:2303136-2303158 GTGGGGGTCCGGGCTGGGGAGGG - Intronic
1161356701 19:3823120-3823142 GTGCAGCTCAGGAACGGGGATGG + Intronic
1161480442 19:4507771-4507793 TTGGCCCTCAGGACTGGGGACGG + Intronic
1161620652 19:5295283-5295305 GGGCTGCCCAGGACTCGGGACGG + Intronic
1162145470 19:8610538-8610560 GTGGTGCCCTGGATGGGGGAGGG - Intronic
1162184833 19:8896813-8896835 GTGGGGCTGGGGACGGGGGATGG + Exonic
1162336103 19:10061527-10061549 TAGGTGATCAGGACTGGGCATGG + Intergenic
1162560834 19:11417448-11417470 GTGGTGCTAGGGGCTGGGCACGG - Intronic
1163294202 19:16401716-16401738 GTTGTGATCAGGCCTGGGGCAGG - Intronic
1163468764 19:17484958-17484980 GTGTTGGTCAGGGCTGGGCAGGG + Intronic
1164977608 19:32585304-32585326 CTGGTGATGGGGACTGGGGATGG + Intronic
1165072153 19:33261723-33261745 CTGGTGCTCAGGGCTGGGACAGG - Intergenic
1165156680 19:33793008-33793030 GTGGTGCCAGGGACTGGGCAAGG + Intergenic
1165447616 19:35865102-35865124 GAAGTGCTCTGGCCTGGGGATGG - Intronic
1166226581 19:41399420-41399442 GAGGTGGGCAGGACTGGGGCAGG + Intronic
1166256146 19:41606284-41606306 GTCCTGGCCAGGACTGGGGAGGG + Intronic
1166547209 19:43640476-43640498 CTGGGGCTCAGGAGTGGGGTGGG + Intergenic
1166686708 19:44800705-44800727 GTGGGGACCAGGCCTGGGGACGG - Intergenic
1166952323 19:46437757-46437779 GTGGTGATCAGGATTGGTTACGG + Intergenic
1167214599 19:48156136-48156158 GTAGAGCGCAGGATTGGGGATGG - Intronic
1167253027 19:48410983-48411005 GAAGTGCCCAGGGCTGGGGATGG - Intronic
1167271635 19:48509501-48509523 GGGGTGGTCATGTCTGGGGAGGG + Exonic
1167590534 19:50402231-50402253 GTGATGCGCAGGAACGGGGAGGG - Exonic
1167646049 19:50705636-50705658 TTGGTTGTCATGACTGGGGAGGG - Intronic
1168185060 19:54695315-54695337 GTGGTGCCCAGGACATGGGAGGG - Intronic
1168486276 19:56765004-56765026 GTGATGCTCAGATTTGGGGAAGG - Intergenic
926125236 2:10267860-10267882 GTGGAGGGCAGGGCTGGGGAGGG - Intergenic
926737751 2:16086807-16086829 GTAGTGCTGAGAACTGGGCATGG + Intergenic
928121093 2:28584085-28584107 GATGTGCTCAGGGCTGGGGTGGG - Intronic
928342022 2:30452077-30452099 GTGGTGGTAATGACTGGGAAAGG + Intronic
928375412 2:30769532-30769554 GTTGTGTGCAGGACTGTGGATGG - Intronic
929451725 2:42042489-42042511 GTGGGGCTGAGGACTAGAGAGGG - Intergenic
930942368 2:57028169-57028191 GGTGTGCTCAGGCATGGGGATGG + Intergenic
931551370 2:63450295-63450317 GTGCTGCTCAGCAATGGGGGAGG - Intronic
931649488 2:64454776-64454798 GCGGGGCTCTGGGCTGGGGAGGG + Intronic
931846810 2:66212432-66212454 GTGGTGCTCGGGGCTGGGGTTGG - Intergenic
931891633 2:66679474-66679496 GAGGTGGTCAGGGATGGGGAAGG + Intergenic
932498512 2:72159805-72159827 GTGGTGGCAGGGACTGGGGAGGG + Intergenic
932580239 2:72988743-72988765 ATGGTGCTTAGGGCTGGGGTGGG - Intronic
934502989 2:94873709-94873731 GTGGAGCGCAGGACTGGGTGGGG + Intronic
934773155 2:96920874-96920896 GAGGAGCTGAAGACTGGGGAGGG + Intronic
935231028 2:101095962-101095984 GTGGTGGTCAGGTATGGGGGAGG - Intronic
935755067 2:106270463-106270485 GGGGTGATCAGGATTGGGAAGGG - Intergenic
937216567 2:120316995-120317017 GCGGGGCTTAGGAATGGGGAGGG - Intergenic
937424143 2:121783896-121783918 TGGTTGCTGAGGACTGGGGAAGG + Intergenic
937435733 2:121879644-121879666 GTGGTGGTAAGGAGTGGGGAAGG + Intergenic
937556856 2:123168566-123168588 GTGTTGGTCAGCACTCGGGAGGG + Intergenic
938244993 2:129769531-129769553 GTGATGCACAGGTGTGGGGAGGG - Intergenic
938383441 2:130849078-130849100 GAGGTGCTCTTGGCTGGGGATGG - Intronic
938688320 2:133762666-133762688 GTGGTACTCGGGGGTGGGGAGGG + Intergenic
939143088 2:138379120-138379142 TTGCTGCCCAGGACTGGGAAAGG - Intergenic
940159840 2:150699808-150699830 GTGATGCTCAGGTAGGGGGAAGG - Intergenic
941166725 2:162090805-162090827 GTGGTGACCAGGTTTGGGGATGG + Intergenic
941613201 2:167686851-167686873 GTGCTGCTCAGGAATGAGCACGG - Intergenic
942612162 2:177753729-177753751 GTGCTGCTGAGGGATGGGGAGGG - Intronic
947396268 2:229689655-229689677 GGGGTGCTGGGGAGTGGGGAGGG + Intronic
948185858 2:236020839-236020861 GTGCTGCTCATCACTGAGGAGGG - Intronic
948774543 2:240277022-240277044 CTGCTGCTCAGGGTTGGGGAAGG - Intergenic
948787106 2:240358477-240358499 AGGGTGTTCAGGACTAGGGAGGG - Intergenic
948929033 2:241119019-241119041 GTGGGCCTCAGGGCTGGGAACGG - Intronic
949037120 2:241821020-241821042 CAGCTGCTCAGGACCGGGGAAGG + Intergenic
1169279556 20:4255390-4255412 TTGGTGCTCAGGACCGGTCATGG + Intergenic
1169661361 20:7981941-7981963 GTGCTGATTAGGACTGGGAATGG + Exonic
1170557477 20:17526334-17526356 GTGGTTGTCAGGGCTGGGGATGG - Intronic
1170580949 20:17699215-17699237 CTGGTGCTTGGGATTGGGGATGG - Intronic
1170693853 20:18639519-18639541 GTGGAAGTCAGGACTGGAGAAGG + Intronic
1172264185 20:33596712-33596734 GTGGAGCTGAGGCCTGGGGTGGG - Intronic
1172612544 20:36262586-36262608 CTGGTGCTCCAGACTGAGGAAGG - Intronic
1172633248 20:36393021-36393043 GTTGGGCTGAGGACTGGGAAAGG + Intronic
1172716882 20:36970899-36970921 GTGGTGGTCAGCACTTGGGAGGG + Intergenic
1174085766 20:48006225-48006247 ATGAGGCGCAGGACTGGGGATGG + Intergenic
1174107325 20:48171982-48172004 GTGGGGGTCAGGACTGGGCAGGG - Intergenic
1174213880 20:48901119-48901141 TTGGTTGTCATGACTGGGGATGG - Intergenic
1174729008 20:52896159-52896181 GTGGTGCTAAGGACAGGGAGGGG - Intergenic
1175024074 20:55883012-55883034 TTGGTGCTCAGGCCCGGTGAAGG - Intergenic
1175159878 20:57000332-57000354 TTGGTTGTTAGGACTGGGGATGG - Intergenic
1175427889 20:58881486-58881508 GTGGTGCCCTGGTCTGGAGAGGG - Intronic
1175442616 20:59002134-59002156 GCGGTCCTGAGGGCTGGGGAAGG + Intronic
1175828853 20:61951158-61951180 GGGGTGCCCAGGGCTGGGGGAGG - Intergenic
1175968655 20:62672914-62672936 GTGGTCCCCAGCACTGAGGATGG + Intronic
1176023136 20:62972822-62972844 GTGGTGCCCCAGGCTGGGGACGG - Intergenic
1176058984 20:63163850-63163872 CTGCTGCACAGGCCTGGGGAGGG + Intergenic
1176179456 20:63742553-63742575 ACGGTGCTCAGGACAGGGGGCGG - Exonic
1176204919 20:63883073-63883095 GTGGTGCTCGGGGTTGGTGAGGG + Intronic
1178687046 21:34720178-34720200 GTGGTGGTGGGTACTGGGGATGG - Intergenic
1178914328 21:36698473-36698495 GGGGCGCTCAGGCCAGGGGAAGG - Intergenic
1179831871 21:44001900-44001922 GTGGGGTTCGGGACTGGGGCAGG - Intergenic
1180012159 21:45058481-45058503 GTGGGGCTCAGGGAGGGGGAGGG + Intergenic
1180864661 22:19110243-19110265 CTGATGCTCAGAAATGGGGATGG + Intronic
1181011217 22:20041734-20041756 GTGGTGCTCACAGCTGGGTACGG - Intronic
1181047886 22:20224166-20224188 GCGGTGGTCAGGCCCGGGGATGG + Intergenic
1181068580 22:20318756-20318778 TTGGTTTTCAGGACTAGGGAGGG + Intronic
1181391256 22:22583287-22583309 GTGGGTGTCAGGACTGGGGAGGG - Intergenic
1181459306 22:23076845-23076867 GAGGAGCTCAGGGCAGGGGAAGG + Intronic
1181752825 22:25001544-25001566 GTGGTGGTCTGGACTGGGGTGGG + Intronic
1181934685 22:26429822-26429844 GTGATGCTGAGGGCTGGGGGAGG - Intronic
1182462940 22:30495156-30495178 TGGGTGCTGAGGGCTGGGGAGGG + Intronic
1183251392 22:36732846-36732868 GTGTTTCCCAGGACTGAGGAGGG - Intergenic
1183299243 22:37050831-37050853 GTGGACCTCAGGATGGGGGAAGG - Intergenic
1183322369 22:37172882-37172904 GTGGTTCTCAAGACAGGGCAGGG - Intronic
1183346720 22:37312179-37312201 GGGGTGCCCAGGTCTGGGGACGG + Intronic
1183456556 22:37926088-37926110 GTGGGGCCCGGGCCTGGGGAGGG + Intronic
1183782780 22:40009359-40009381 GTGGAGCTCAGGACTCGGGCGGG - Intronic
1184504678 22:44893595-44893617 GTGGTGCCCAGGGCTTGGCAAGG - Intronic
1185062881 22:48616150-48616172 GGGCTGCTCAGGAGTGGGGTGGG + Intronic
1185078400 22:48695682-48695704 GTGGTTCTCAGGTTTGGGGGTGG + Intronic
1185079812 22:48703494-48703516 GTGGGGCTGAGGATGGGGGAGGG - Intronic
1185142351 22:49109553-49109575 GTGGTGCTGAGGACAGAGGTGGG + Intergenic
1185296349 22:50057148-50057170 GTTGGGGTCAGGTCTGGGGATGG + Intergenic
1203281359 22_KI270734v1_random:132888-132910 TTGGTTTTCAGGACTAGGGAGGG - Intergenic
950634077 3:14302987-14303009 GGGGTGCTGAGGACTGGATAGGG - Intergenic
952778442 3:37069901-37069923 GTGGTTCTTAGGGCTTGGGAGGG + Intronic
952933308 3:38376245-38376267 GTGGTGCCCAGGCCTGTGAAGGG + Intronic
953884017 3:46705464-46705486 GTGGAGCCCAGGACTGGAGTAGG + Intronic
953996777 3:47525842-47525864 GTGGTGATCGGGATTGGGGTGGG + Intergenic
954414622 3:50387149-50387171 GGGGTGCTCAGCACAGGGAAGGG + Intronic
954875502 3:53800522-53800544 GAGGTGCTGATGCCTGGGGAGGG - Intronic
955449266 3:59049853-59049875 GCGGTGCCCGGGTCTGGGGAGGG + Intronic
955780195 3:62476517-62476539 ATGGTGCTGAGACCTGGGGAGGG + Intronic
955999122 3:64709856-64709878 GTGGTGCTGAAGAATGGGAAAGG + Intergenic
960293893 3:115919122-115919144 GTGGGGGTGAGGAGTGGGGAGGG - Intronic
960554873 3:119016766-119016788 CTGGTACACAAGACTGGGGAGGG - Intronic
960872238 3:122261592-122261614 CTGGTGCTCATCATTGGGGATGG - Exonic
961043283 3:123692474-123692496 GTGGGGATCAGGACTGGGAGGGG + Intronic
961378965 3:126484857-126484879 GGAGTGCTCAGGCCTGGGCATGG - Intronic
963074668 3:141334690-141334712 GTGGTGCCGGGGGCTGGGGAAGG - Intronic
963080939 3:141393319-141393341 GTCATGCTCAGCGCTGGGGAAGG - Intronic
963736092 3:149019392-149019414 GAGGTGAGCAGGACTGTGGAGGG - Intronic
964892616 3:161555118-161555140 GTGGTGGGCAGGACTGGAGTGGG - Intergenic
966423496 3:179756936-179756958 GTGGTCCCCAGGAGTGGGGAGGG + Intronic
967036546 3:185652413-185652435 CTGGTGCTCAGGACAGGGACAGG - Intronic
967782781 3:193457874-193457896 ATGGTTCTCAGGGCTGGGGTAGG + Intronic
968088971 3:195888360-195888382 GTGGTCCTGAGGACAGAGGACGG + Intronic
968565681 4:1311419-1311441 ATGGTTCTTACGACTGGGGAAGG + Intronic
968715940 4:2159720-2159742 GTGGTGGTTAGCTCTGGGGAAGG - Intronic
968969442 4:3785941-3785963 GTCATGCTCAGGGCTGAGGAGGG + Intergenic
969414317 4:7048746-7048768 GGGGTGCCAGGGACTGGGGAAGG - Intronic
971125243 4:23746891-23746913 GTGGAGCTCAGGAACAGGGAAGG + Intergenic
972047711 4:34689261-34689283 GTGGTGCTAAGGAGTTAGGAAGG + Intergenic
973216972 4:47680408-47680430 GTGGGGCACATGAGTGGGGAGGG - Intronic
974135862 4:57817118-57817140 GTGGTGGTCAGGGATTGGGAGGG + Intergenic
975420407 4:74157963-74157985 GCGGTTCCCAGGACCGGGGACGG - Intronic
975444617 4:74447724-74447746 CTGGTTCTCAGAACTGGTGAAGG + Intronic
975527390 4:75365463-75365485 GTGGTACTGAGGACTGGCCAGGG - Intergenic
979499731 4:121426265-121426287 TTGGAGCTCAGAAGTGGGGAGGG - Intergenic
982624291 4:157746041-157746063 GTGGTTACCAGGAGTGGGGAGGG + Intergenic
985607355 5:865154-865176 GGGGTGGACAGAACTGGGGACGG + Intronic
986115385 5:4768760-4768782 GTTGATCTCAGGACTGGAGAAGG - Intergenic
986542031 5:8854588-8854610 ATGGTGCTGAGGACAGTGGAGGG - Intergenic
989498018 5:42131906-42131928 AGTGTGCTCAGGCCTGGGGAGGG - Intergenic
991442328 5:66663911-66663933 GTGATACCCAGGAGTGGGGATGG + Intronic
991581676 5:68162116-68162138 GTGGAACTCAGGAATGGGCAGGG + Intergenic
994029791 5:95128648-95128670 TGGTTGCTTAGGACTGGGGAAGG + Intronic
997282665 5:132658526-132658548 GGGGGGCTCAGCACTGTGGATGG + Intronic
997295615 5:132766587-132766609 GTGGGGCTCAGGAATGGAGGAGG - Intronic
997694316 5:135849575-135849597 GTTGTGCCCAGCTCTGGGGATGG + Intronic
998689747 5:144574531-144574553 ATGCTGCTGAGGACTGGGGGAGG - Intergenic
1001248854 5:170129447-170129469 TTGTTGCTTAGGACTGAGGAGGG + Intergenic
1001300724 5:170531795-170531817 GTGGGGCTTAGGACAGGGGGTGG - Intronic
1001560701 5:172667092-172667114 GTGGTGGTAAGGACAGGGTAGGG - Intronic
1002772848 6:304205-304227 TTGGGGCTCAGGACTGGCCAAGG + Intronic
1002832939 6:840433-840455 AGTTTGCTCAGGACTGGGGAGGG + Intergenic
1003425001 6:5993056-5993078 GTGGTGATCAGGGCCTGGGAGGG + Intergenic
1004467691 6:15901231-15901253 GTGTTGCTCAGCACTTGGGAGGG + Intergenic
1005207926 6:23426368-23426390 GTGGAGGTGAGGGCTGGGGAAGG - Intergenic
1006107810 6:31727293-31727315 GTCCTGCTCAGAACTGGAGAAGG - Exonic
1006439094 6:34042346-34042368 GTGGTGCTCAGGGTTGGAGTTGG - Intronic
1006610909 6:35293830-35293852 GTCGGCATCAGGACTGGGGATGG - Exonic
1006940564 6:37749258-37749280 GTGGTGCAAAGGGGTGGGGAAGG - Intergenic
1007171423 6:39866169-39866191 GTGGGGCTCTGGAATGGGAAGGG + Intronic
1007721447 6:43887665-43887687 GCAGTGGTCAGGCCTGGGGAAGG + Intergenic
1011801320 6:91019290-91019312 GAGGGGCTCAGCTCTGGGGAAGG - Intergenic
1012873093 6:104695105-104695127 CTGCTGATCAGGACTTGGGAAGG - Intergenic
1013468617 6:110440365-110440387 GAGGAGCTCTGGGCTGGGGATGG + Intronic
1014943757 6:127474072-127474094 GAGAATCTCAGGACTGGGGAAGG - Intronic
1015181596 6:130366509-130366531 CCGGTGCTCAGGACAGGTGAGGG + Intronic
1015803917 6:137089803-137089825 TTGGTGCTGTGGATTGGGGAAGG + Intergenic
1016402112 6:143692187-143692209 GTGGCTCACAGGACTGGGGAGGG + Intronic
1017032685 6:150238060-150238082 GTTGTGCTCAGCCCTGGGCAGGG - Intronic
1018170033 6:161137309-161137331 GATGTGCTCAGCACTGGGCATGG + Intronic
1018501085 6:164411677-164411699 GGGGTCCTCCGGACTGGGAAGGG - Intergenic
1018899362 6:168043460-168043482 CTGGTGCTCGGGACTCGGGGAGG + Intronic
1018915935 6:168132349-168132371 CTGGTGCCCACCACTGGGGAAGG - Intergenic
1019372529 7:670496-670518 GAGGGGCTCAGGACCGAGGACGG + Intronic
1019372542 7:670552-670574 GAGGGGCTCAGGACCGAGGACGG + Intronic
1019372557 7:670608-670630 GAGGGGCTCAGGACCGAGGACGG + Intronic
1019557248 7:1638707-1638729 GTGATGGGCAGGGCTGGGGAGGG + Intergenic
1020376552 7:7493831-7493853 GTGTTGCTAAGGGCTGGGGTAGG - Intronic
1020437159 7:8176734-8176756 GTGGTGGTAAGGACGAGGGATGG - Intronic
1020751311 7:12145482-12145504 GTGGGGCTCAGAACAGGAGAAGG - Intergenic
1020951257 7:14680699-14680721 GTGGTTCTCATGACTGGAAAGGG + Intronic
1021345718 7:19525571-19525593 GAGGTTCTGAGGACTGGGAAAGG - Intergenic
1021664115 7:22957589-22957611 GTGGTGATGAGGATTGGGAAAGG - Intronic
1023822201 7:43986527-43986549 GGGGTCCTGAGGACTGAGGATGG - Intergenic
1023921656 7:44634759-44634781 GTGGTACTCTGGCCTGGGCAAGG + Intronic
1024470473 7:49764579-49764601 GTGGTGGTAAGGTGTGGGGAGGG - Intergenic
1025936190 7:66039591-66039613 GTGGTGCACAGGATGAGGGATGG + Intergenic
1026544302 7:71308433-71308455 GTGTTTCTCAGGAGTAGGGAGGG + Intronic
1027056468 7:75053106-75053128 GTGGTGCACGGGGCTGGGGGTGG + Intronic
1027056485 7:75053151-75053173 GTGGTGGACAGGGCTGGGGGTGG + Intronic
1027056517 7:75053241-75053263 GTGGTGGACAGGTCTGGGGGTGG + Intronic
1027198010 7:76044529-76044551 GTGGAGATGAGGACTTGGGAGGG + Intronic
1027628968 7:80578921-80578943 GTGAAGCTCAGGAATGGGCAAGG + Intronic
1028629133 7:92914626-92914648 AAGATGCTCAGGACTGGGGGGGG - Intergenic
1029707107 7:102281957-102281979 CTGGAGGTCAGGGCTGGGGATGG - Intronic
1029750467 7:102539941-102539963 GGGGTCCTGAGGACTGAGGATGG - Intronic
1029768419 7:102639049-102639071 GGGGTCCTGAGGACTGAGGATGG - Intronic
1030923323 7:115420021-115420043 GTGGTGGTAAGGTGTGGGGAGGG + Intergenic
1032068648 7:128791065-128791087 GTCATGCTCAGCAATGGGGACGG - Intronic
1032147876 7:129400414-129400436 GTAGGGGTCAGGAATGGGGATGG + Intronic
1032476280 7:132213632-132213654 ATGGAGCTCAGAACTGGGGCGGG + Intronic
1032884554 7:136123738-136123760 AGGGTCCTCAGGACTGGGTAGGG + Intergenic
1033151466 7:138918411-138918433 GTTGTCCACAGGACCGGGGAGGG + Exonic
1033224140 7:139547415-139547437 TTGGAGCTCAGAGCTGGGGAAGG + Intergenic
1033639666 7:143249352-143249374 CTGGTGTTCTGCACTGGGGATGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034263840 7:149772353-149772375 GCGGTTCTGGGGACTGGGGACGG - Intronic
1034264233 7:149773471-149773493 TGGGAGCTCAGGACGGGGGAGGG + Exonic
1034373951 7:150627197-150627219 GTGGTGCTGAGACATGGGGAGGG - Exonic
1034481463 7:151323066-151323088 GTGGTGCCAGGGACTGGGGGAGG - Intergenic
1034496824 7:151428032-151428054 GAGGTGCTCAGGACTGTTGGGGG - Intergenic
1034888109 7:154814500-154814522 GGGATGCCCAGGACAGGGGAAGG + Intronic
1035101719 7:156402821-156402843 TTGGTGCACAGGAGTGGGAAGGG - Intergenic
1035531163 8:351923-351945 GTGGCGACCAGGGCTGGGGAAGG + Intergenic
1038151198 8:24943198-24943220 GAGGAGCTCTGGGCTGGGGAGGG - Intergenic
1038411668 8:27363834-27363856 GTGGCCCACAGGACTGGGGGTGG - Intronic
1038454508 8:27663858-27663880 GTGGGGCCCAGAACAGGGGAAGG - Intronic
1038538026 8:28368553-28368575 GCGCGGCTCAGGCCTGGGGAGGG + Intronic
1039324205 8:36466750-36466772 GTGGGGCTCAGAACAGGAGAAGG - Intergenic
1040799939 8:51329193-51329215 GTGCTGGTCAGGTGTGGGGATGG - Intronic
1042027637 8:64440916-64440938 GTGGAGCTAAGGGCAGGGGATGG - Intergenic
1044145064 8:88702806-88702828 GTGGTTATCAGGAGTGGAGAGGG - Intergenic
1045344204 8:101280106-101280128 GTGGTGATCTGGACTGCGGTGGG + Intergenic
1045817749 8:106296540-106296562 GTGGTGCTAAGAAATGAGGAAGG - Intronic
1046895152 8:119463909-119463931 TGGTTGCTCAGGGCTGGGGAGGG - Intergenic
1048145608 8:131839393-131839415 TTAGTGACCAGGACTGGGGAGGG - Intergenic
1049275358 8:141717560-141717582 GTGGTCCTCAGGGCTGGGCTGGG - Intergenic
1049592743 8:143470006-143470028 CTGGTGCTCAAGAGTGGGGCAGG - Intronic
1049800936 8:144517307-144517329 GTGGGGCACAGAACTTGGGAGGG - Intronic
1050317699 9:4420083-4420105 GTGGTGCTCACTCCTGGAGAGGG + Intergenic
1051876953 9:21803127-21803149 GTGGTTCTCAGGAATGGTGGTGG - Intronic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1052642205 9:31182642-31182664 GTGGTGGTCGGGGCTGGGGTAGG + Intergenic
1053145814 9:35711477-35711499 GTAGTGCTAGAGACTGGGGAGGG + Intronic
1056107559 9:83362385-83362407 GTGGTGCTCAGAAGTTGTGATGG - Intronic
1056363474 9:85881409-85881431 GTGATGGTGAGGACAGGGGATGG - Intergenic
1058872823 9:109217113-109217135 GAGCTGCTAAGCACTGGGGAAGG + Exonic
1059206280 9:112469287-112469309 GTGGGGCACAGGGGTGGGGAGGG + Intronic
1059381190 9:113927460-113927482 GTGGTGCTAAGGACTGGGCGAGG + Intronic
1060041961 9:120307820-120307842 ATGGTGCTCAGGACTGGCTGAGG - Intergenic
1060243083 9:121921578-121921600 GGGGGACTCAGCACTGGGGAGGG - Intronic
1060266205 9:122112784-122112806 GTTGTGCCCAGGACAGGGCATGG - Intergenic
1060479127 9:124007830-124007852 ATGGTGCTGGGGACTGGGGTCGG - Intronic
1061385435 9:130286760-130286782 GTGGTGCTGGGCACTGGGCAGGG + Intronic
1061557094 9:131377600-131377622 GTGGAGCCCAGGGCTGGGGTGGG - Intergenic
1061878662 9:133557478-133557500 CTGGTTCTCAGGACTCGGGCGGG + Intronic
1062029776 9:134356964-134356986 GGGGTGCCCAGCACTGGGCATGG - Intronic
1062250354 9:135590868-135590890 GTGGTGGTCAGCACTGGGTGTGG - Intergenic
1062388291 9:136323780-136323802 GAGGTGCTCAGCCCTGGGGTGGG + Intergenic
1062551604 9:137090016-137090038 GTGGTGCCCAGGACTAGGCCTGG - Intronic
1062599359 9:137313009-137313031 CTGGTGCACAGGAGTGGTGAGGG + Intronic
1185819572 X:3189049-3189071 GTGGTGCCCAGGACAGGGCTAGG - Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1189472274 X:41323199-41323221 GTGGTGCTCACAACTGGACATGG + Intergenic
1189558099 X:42165969-42165991 GTGGTGCTCAGGGTGGGGGCAGG + Intergenic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1192216664 X:69164146-69164168 GGGGTGCGCAGCACTGGAGAGGG + Intronic
1193592138 X:83402544-83402566 GTGGTGGTGGGGAGTGGGGATGG + Intergenic
1194668119 X:96697771-96697793 GTGGTTCTCTAGACTGGTGATGG + Intronic
1195203398 X:102571535-102571557 GCCGTGCCCAGGACTGGGGTTGG + Intergenic
1195446524 X:104958385-104958407 CTGGTGTTCAGGACTGGGGGTGG + Intronic
1195825055 X:108990600-108990622 GTGGTGCTGGAGATTGGGGAGGG + Intergenic
1195888624 X:109668609-109668631 GTGATGCTGAGGAGTGGGGATGG - Intronic
1195941582 X:110172100-110172122 GAAGAGCTCAGGACTGGGGCTGG + Intronic
1196419413 X:115507112-115507134 GTGGGGCTCCATACTGGGGATGG + Intergenic
1197708779 X:129652049-129652071 TTAGTGCTGAGGACTGGGGATGG + Intronic
1200043455 X:153387236-153387258 CAGGAGCTCTGGACTGGGGAGGG + Intergenic
1200248854 X:154541675-154541697 GTGGTCCTCAGGAAAGAGGAGGG - Intronic
1201372185 Y:13277930-13277952 GTGCTGCCTAGAACTGGGGAAGG - Intronic
1201496425 Y:14594886-14594908 GTGGGGATCCGTACTGGGGATGG + Intronic