ID: 922191609

View in Genome Browser
Species Human (GRCh38)
Location 1:223323605-223323627
Sequence CAGGTACAGGATGCAGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 452}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922191609 Original CRISPR CAGGTACAGGATGCAGGGTG AGG Intronic
900108509 1:996300-996322 GGGCCACAGGATGCAGGGTGGGG + Intergenic
900108534 1:996366-996388 GGGCCACAGGATGCAGGGTGGGG + Intergenic
900108560 1:996432-996454 GGGCCACAGGATGCAGGGTGGGG + Intergenic
900108585 1:996498-996520 GGGCCACAGGATGCAGGGTGGGG + Intergenic
900108609 1:996564-996586 GGGCCACAGGATGCAGGGTGGGG + Intergenic
900108634 1:996630-996652 GGGCCACAGGATGCAGGGTGGGG + Intergenic
900108659 1:996696-996718 GGGCCACAGGATGCAGGGTGGGG + Intergenic
900108683 1:996761-996783 GGGCCACAGGATGCAGGGTGGGG + Intergenic
900108708 1:996827-996849 GGGCCACAGGATGCAGGGTGGGG + Intergenic
901456771 1:9367647-9367669 CCGGTCCAAGGTGCAGGGTGCGG - Exonic
901985841 1:13074556-13074578 CAGGGACAAGAAGCAGGGAGGGG + Intronic
901995968 1:13152211-13152233 CAGGGACAAGAAGCAGGGAGGGG - Intergenic
903215796 1:21842750-21842772 CAGGTACAGGGGCCAGGATGGGG - Exonic
903234120 1:21938409-21938431 CAGGTAAAAGATACAGGCTGAGG - Intergenic
903660362 1:24973362-24973384 CCCATACAGGGTGCAGGGTGGGG + Intergenic
904048676 1:27625041-27625063 CAGGGTCAGGAAACAGGGTGGGG - Intronic
904526270 1:31136202-31136224 TGGGTACAGGATGGGGGGTGGGG - Intergenic
904825011 1:33268669-33268691 CAGGGAGAGGATGCAGCCTGTGG + Intronic
905795932 1:40816667-40816689 CAGGGAGAGGATGTAGGGAGGGG - Intronic
905886233 1:41493563-41493585 CTGGTATAGGAGGCAGAGTGGGG + Intergenic
905973854 1:42161720-42161742 CAGGGTGAGGAGGCAGGGTGTGG - Intergenic
906139777 1:43527173-43527195 CAGCCCCAGGGTGCAGGGTGAGG - Intronic
907885521 1:58589181-58589203 CAGGTACAAGAGGCAGGATGTGG - Intergenic
909094555 1:71271101-71271123 CGGGTCCAGGCTGGAGGGTGGGG + Intergenic
910465338 1:87493091-87493113 TGGGTACAGCATGCTGGGTGGGG + Intergenic
910478543 1:87634258-87634280 TAGGCACAGGATGGAGGGTGTGG + Intergenic
912681567 1:111732382-111732404 CATCTCCAGGCTGCAGGGTGCGG + Intronic
913975206 1:143450257-143450279 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
914069599 1:144275873-144275895 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
914109556 1:144690481-144690503 CAGGTTCAGGATGGAGGCGGTGG - Intergenic
914905251 1:151738536-151738558 CAGAAACAGGATCAAGGGTGGGG - Intergenic
915069643 1:153255487-153255509 CAGGTAGAGGAGACAGTGTGAGG - Intergenic
915274533 1:154779054-154779076 CTGGTACTGGCTGCAGGCTGGGG - Intronic
915393982 1:155567965-155567987 CAGGTAGAGGTTGCAGTGAGCGG + Intergenic
915598805 1:156909849-156909871 CAGGTACAGGCTCCAGTTTGGGG - Exonic
917210966 1:172631800-172631822 CAGGTCCAGGCTTGAGGGTGGGG - Intergenic
917539860 1:175901972-175901994 TGGGTACAGGATGGGGGGTGTGG - Intergenic
918291043 1:183107936-183107958 CAGATACAGGATGGAGGGAAGGG + Intronic
920508132 1:206531470-206531492 AGGGTAGAGGCTGCAGGGTGAGG + Intronic
922191609 1:223323605-223323627 CAGGTACAGGATGCAGGGTGAGG + Intronic
922756005 1:228097318-228097340 TGGGTGCGGGATGCAGGGTGAGG - Intronic
923023739 1:230187931-230187953 TGGGTACAAGATGGAGGGTGGGG + Intronic
924153983 1:241156975-241156997 CAAGTACAGGAAGCAGACTGTGG - Intronic
1063101030 10:2950414-2950436 CTGCTACAGGATGCAGTGTCAGG + Intergenic
1064242669 10:13645284-13645306 CAGGGACAGGAGCCAGGGTGGGG - Exonic
1064680478 10:17806625-17806647 TGGGCACAGGATGCGGGGTGTGG + Intergenic
1064785236 10:18887792-18887814 CGGGTACAGGATGCAGGGCAGGG - Intergenic
1065326844 10:24556932-24556954 CAGGCACAGGAAGCAGCTTGTGG - Intergenic
1066659954 10:37728869-37728891 CTAGAACAGGATGCAGGGAGTGG - Intergenic
1067382439 10:45787403-45787425 CAGGTGCAGGATGAGGGGGGTGG - Intronic
1067738489 10:48877743-48877765 CAGGCCCAGGAGGCAGGCTGGGG + Intronic
1067890137 10:50127951-50127973 CAGGTGCAGGATGAGGGGGGTGG - Intronic
1068924073 10:62516751-62516773 GAGGAAGAGGAAGCAGGGTGGGG - Intronic
1069160349 10:65084597-65084619 CAAGTACAGGAGGCAGGCTGGGG - Intergenic
1069247216 10:66220872-66220894 TAGGTACAGGATGGGGGGTGAGG + Intronic
1069788841 10:71006545-71006567 CAGGCTCAGAAGGCAGGGTGGGG - Intergenic
1071505665 10:86230050-86230072 CAGGAGCAGGATGCAGGGGCTGG - Intronic
1071598497 10:86944609-86944631 TAGGTGTAGGAGGCAGGGTGAGG - Intronic
1072130348 10:92488173-92488195 GAGGTAGAGGATGCAGTGAGTGG - Intronic
1073339672 10:102735373-102735395 GAGGAACAGCATGGAGGGTGGGG - Intronic
1074291411 10:112140378-112140400 CTGGACCAGGGTGCAGGGTGTGG - Intergenic
1075975684 10:126691953-126691975 CAGGTCCAGGCTTGAGGGTGGGG + Intergenic
1076693265 10:132234565-132234587 AGAGCACAGGATGCAGGGTGTGG - Intronic
1077072836 11:684926-684948 CAGGTGCAAGAGGCAGCGTGAGG + Exonic
1077333507 11:1993563-1993585 CAGGTGGCGGCTGCAGGGTGCGG - Intergenic
1077435345 11:2536268-2536290 CAAGTACAGGAAGCCTGGTGGGG - Intronic
1077504124 11:2922336-2922358 CAGGGACAGCAGTCAGGGTGGGG + Intronic
1077606706 11:3617221-3617243 CAGGCACAGGAGACCGGGTGGGG - Intergenic
1078586358 11:12593472-12593494 CAGGTAGAGGTTGCAGTGAGCGG + Intergenic
1078666955 11:13333695-13333717 CAGGAGCAGGATGCCTGGTGCGG - Intronic
1079246703 11:18757523-18757545 CAGGTCCAGGAATCAGGCTGAGG - Intronic
1079368655 11:19831297-19831319 GAAGAACAGGATGGAGGGTGAGG + Intronic
1080774771 11:35375491-35375513 CAGGTGCAGGTTGCAGGATGTGG + Intronic
1080961621 11:37167776-37167798 CAGTTCCAGGCTTCAGGGTGGGG - Intergenic
1081557776 11:44182163-44182185 CAGGCACAGAAAGCAGGGTGAGG - Intronic
1081672503 11:44949927-44949949 CAGGGACAGATTGCAGGGGGAGG - Intronic
1081702099 11:45158593-45158615 CGGGTACAGCAGACAGGGTGAGG - Intronic
1081915539 11:46728076-46728098 CGGGTACAGGAGGCAGTGGGCGG - Exonic
1083484897 11:62977125-62977147 CAGGTAACACATGCAGGGTGGGG - Exonic
1083544480 11:63538342-63538364 CAGGGACAGGAGGCAGGGGCTGG + Intronic
1084857546 11:71998681-71998703 GAGGGCCAGGATTCAGGGTGAGG - Intronic
1084876243 11:72135825-72135847 CCTGTAGGGGATGCAGGGTGGGG + Intronic
1084881113 11:72172321-72172343 CCTGTAGGGGATGCAGGGTGGGG + Intergenic
1084891057 11:72237442-72237464 CTGGTAAAGGATCCAGGCTGGGG - Exonic
1084907519 11:72359448-72359470 CAGGTAAAGAAAGCAGGTTGGGG + Intronic
1084955182 11:72687419-72687441 CAGGTACCAGGTGCAGAGTGTGG - Exonic
1085261848 11:75210251-75210273 CAGCTGCAGGATGAAGGCTGAGG - Intergenic
1085534193 11:77208270-77208292 CAGGCACATGGGGCAGGGTGGGG + Intronic
1085870809 11:80347204-80347226 CAGGCACAGGATACGGGGTGGGG + Intergenic
1086642417 11:89176085-89176107 CAGGTACATGGAGCAGTGTGTGG - Intergenic
1087216942 11:95504718-95504740 CAGGACCAGGAGGCAGGGGGTGG - Intergenic
1087907081 11:103710680-103710702 CAGGAGCTGGAGGCAGGGTGTGG + Intergenic
1090353105 11:126120415-126120437 CAGGTACAGAATGCAGAAGGGGG + Intergenic
1090401491 11:126452417-126452439 CAGGTGGTGGATGCAGCGTGAGG + Intronic
1090468752 11:126959482-126959504 CAAGTATAGCATGCAGAGTGAGG - Intronic
1091196544 11:133736266-133736288 CCTGTACAGGAAGCAGAGTGAGG + Intergenic
1202816487 11_KI270721v1_random:48745-48767 CAGGTGGCGGCTGCAGGGTGCGG - Intergenic
1091648705 12:2293345-2293367 CTGGGACAAGATGCAGGGAGTGG + Intronic
1092047630 12:5443274-5443296 GTGGTACATGATGCAGGGTCGGG - Intronic
1092605420 12:10112752-10112774 CAGGACCAGGCTGCAGAGTGCGG - Intergenic
1092936479 12:13368504-13368526 CAGGGACTGGGTGCAGGGAGGGG + Intergenic
1095040536 12:37435751-37435773 CAAGCGCAGGATTCAGGGTGGGG - Intergenic
1096470083 12:51870068-51870090 GAGGAACAAGATTCAGGGTGAGG - Intergenic
1096669253 12:53188662-53188684 CAGGTAGAGGAGGTAGGGAGGGG + Exonic
1097619333 12:61921347-61921369 CACTTACAGGATGTAAGGTGAGG + Intronic
1098724971 12:73952318-73952340 TAGGGACAGAATGAAGGGTGAGG - Intergenic
1099540812 12:83905024-83905046 CAGGCACAGAATGTGGGGTGGGG + Intergenic
1099578258 12:84406849-84406871 CAGGTTCAGGAATCAGGGGGTGG + Intergenic
1102721524 12:115020781-115020803 CAGGAATAGGAGTCAGGGTGAGG - Intergenic
1102791454 12:115649818-115649840 TAGGTAGGGGGTGCAGGGTGGGG - Intergenic
1103044649 12:117725874-117725896 GAGGTAGAGGTTGCAGGGTGTGG + Intronic
1104150148 12:126074435-126074457 CAGATACAGGATGCAGCCCGTGG - Intergenic
1104900847 12:132188863-132188885 CAGGAGCAGGAGGGAGGGTGGGG + Intergenic
1105072099 12:133240727-133240749 CAGGTACAGGATGGGAAGTGGGG + Intergenic
1105274456 13:18906474-18906496 CTAGAACAGGATGCAGGGAGTGG - Intergenic
1105840944 13:24253151-24253173 CTGGAACAGGAAGAAGGGTGGGG + Intronic
1105943847 13:25173210-25173232 CTGGTACAGGAAGTAAGGTGAGG + Intergenic
1106628295 13:31443179-31443201 CAGACACAGGAGGCAGGCTGAGG - Intergenic
1106879367 13:34112722-34112744 TGGGTACAGGATAGAGGGTGTGG - Intergenic
1108904470 13:55451407-55451429 CAGGTCCAGGAAGCAAGGGGTGG + Intergenic
1109039244 13:57310809-57310831 TAGGCACAGGATGAAGGATGGGG - Intergenic
1109313986 13:60727968-60727990 TAGGCACAGGATGGAGGGTGGGG + Intergenic
1110570638 13:76999280-76999302 CAGTGACAGGATGCAGTGTTTGG + Intronic
1111610694 13:90603222-90603244 CAGGTGCAGGGGCCAGGGTGAGG + Intergenic
1113567522 13:111327654-111327676 GAGGTAAAGGAAGCAGGGCGGGG - Intronic
1114206067 14:20572217-20572239 CAGGTCCAGGATTCAAGGGGTGG + Intergenic
1114484841 14:23056427-23056449 AAGGAAGAGGATACAGGGTGGGG + Intronic
1114522617 14:23348514-23348536 CAGGAAGAGGATGCAGGGAGCGG + Exonic
1115648185 14:35384615-35384637 CAGGTTCAAGATGCACTGTGAGG - Intergenic
1117199339 14:53372372-53372394 CAGGCATAGGAGGAAGGGTGAGG + Intergenic
1119451169 14:74712245-74712267 CAAGTACAGTATACAGGATGGGG + Intronic
1119633187 14:76251852-76251874 CTGGTACAATATTCAGGGTGAGG - Intronic
1120218408 14:81705186-81705208 TGGGTACAGGATGGCGGGTGTGG + Intergenic
1120713368 14:87815825-87815847 AAGGTACAGGAGCCGGGGTGAGG - Intergenic
1122165531 14:99820676-99820698 CAGGTAAAGGATCCAGGGGCAGG + Intronic
1122375448 14:101254020-101254042 CAGGAACAAGAGGCTGGGTGTGG - Intergenic
1122501504 14:102203096-102203118 TAGGTGCAGAATGCAAGGTGGGG - Intronic
1122959135 14:105086663-105086685 CAGAGGCAGGGTGCAGGGTGAGG + Intergenic
1123006046 14:105324379-105324401 CAGGACCAGGGGGCAGGGTGTGG + Intronic
1202840211 14_GL000009v2_random:114424-114446 CAAGCACAGGAGGGAGGGTGAGG + Intergenic
1123410794 15:20057151-20057173 CAGGCACAGGCTCCATGGTGGGG - Intergenic
1123520124 15:21063857-21063879 CAGGCACAGGCTCCATGGTGGGG - Intergenic
1123928018 15:25137630-25137652 CAGATACAGTATGAAGTGTGTGG - Intergenic
1124964334 15:34422114-34422136 CTGCTACAGGAGGCGGGGTGGGG - Intronic
1124980953 15:34568342-34568364 CTGCTACAGGAGGCGGGGTGGGG - Intronic
1125285257 15:38085918-38085940 CAGGAATAGGATTCAGGGTTTGG + Intergenic
1125485704 15:40109288-40109310 TGGGTGCAGGGTGCAGGGTGCGG + Intergenic
1126101378 15:45120161-45120183 CAGGTGCAGGGGACAGGGTGAGG + Exonic
1127281526 15:57497363-57497385 CAGGTAGGGGGAGCAGGGTGGGG + Intronic
1128147249 15:65338587-65338609 CAGGTGCAAGAGGGAGGGTGTGG + Intronic
1128357661 15:66939588-66939610 CAGGGACTGGAGGCAGGGTCTGG - Intergenic
1129296972 15:74604929-74604951 CAGGAGCAGGATGCAGGCTCTGG - Intronic
1129669081 15:77597176-77597198 CAGGGACAGGGTGGGGGGTGGGG + Intergenic
1130146283 15:81276235-81276257 CAGGGGCTGGAGGCAGGGTGGGG - Intronic
1130622284 15:85476174-85476196 CAGGGACTGGATGGAAGGTGTGG + Intronic
1130773021 15:86944074-86944096 CAGGTGAAGAATGAAGGGTGGGG + Intronic
1131694340 15:94859090-94859112 CAGGTAGAGGGTGGAGGGTGGGG - Intergenic
1132625295 16:888748-888770 TAGGTACAGGGGGCAGTGTGTGG + Intronic
1132625590 16:890046-890068 TAGGTACAGGGGGCAGTGTGTGG - Intronic
1132830291 16:1924696-1924718 CAGGAACAAGATCCAGGGTTCGG - Intergenic
1133126070 16:3646823-3646845 CAGGCTCAGGGTGCATGGTGCGG + Intronic
1135759565 16:25126278-25126300 CAGGCTCAGGACGCAGGGTCTGG - Intronic
1136052068 16:27658593-27658615 AAGGTACAGGATGGAAGGTGGGG + Intronic
1136249529 16:28995044-28995066 CATGTACATGAGGCAGGGCGTGG + Intergenic
1137585633 16:49662674-49662696 CAGGAAAAGGGTGAAGGGTGGGG + Intronic
1137964109 16:52914074-52914096 TGGGTACAGGATGGGGGGTGTGG - Intergenic
1137995979 16:53213286-53213308 CAGGTGCAAAATGAAGGGTGAGG + Intronic
1138023745 16:53506109-53506131 GAGCTACAGGATGGATGGTGAGG + Intergenic
1138280349 16:55768245-55768267 CAGCTGCAGGTTGGAGGGTGGGG + Intergenic
1138288134 16:55825393-55825415 CAGCTGCAGGTTGGAGGGTGGGG - Intronic
1139784968 16:69385587-69385609 CCGGGACATCATGCAGGGTGAGG - Exonic
1140564567 16:76026797-76026819 TGGGTACAGGATGAGGGGTGGGG - Intergenic
1140609567 16:76581791-76581813 CAGGAACAGGAGGAAGGGAGAGG - Intronic
1141886260 16:86894432-86894454 CAGCTAGAGGGTGCAGGGTGAGG + Intergenic
1142113847 16:88346226-88346248 CCGGTGCAGGCTGCTGGGTGAGG + Intergenic
1142749339 17:1978003-1978025 GGGGTGCAGGATGCGGGGTGCGG - Intronic
1143057259 17:4171626-4171648 CAGGAACAGGCAGCAGGGAGGGG - Intronic
1144300824 17:13921985-13922007 TAGGCACAGGATGCAGGGAGTGG - Intergenic
1144668202 17:17116389-17116411 TAGGTCCAGGAGGCAAGGTGGGG + Intronic
1145396914 17:22503591-22503613 CAGGTGCGGGATGCAGGGCAGGG + Intergenic
1147366019 17:39959751-39959773 CAGGTACTGGGAGCAGGGAGCGG + Intergenic
1148121461 17:45214753-45214775 CAGGTAGAGGAGGCTGGATGTGG - Intergenic
1148472954 17:47906912-47906934 CAGGGAAAGGGTGCTGGGTGAGG + Intronic
1148893783 17:50827921-50827943 CAGGTTTAGGAGACAGGGTGGGG + Intergenic
1149979520 17:61298679-61298701 AAGGTGGAGGATGCAGGGTGTGG - Intronic
1151341545 17:73474442-73474464 CAGACCCAGGATGGAGGGTGGGG - Intronic
1151581618 17:74982397-74982419 GAGGTAGGGGATGCAGGCTGGGG + Intergenic
1152350021 17:79778980-79779002 CAGGTCCAGCATGCAGGGAGGGG - Intronic
1152775928 17:82201970-82201992 CAGGTTCAGGGTGCACCGTGAGG + Intronic
1153755711 18:8280805-8280827 CAGGTGCAGGGTGCTGGTTGCGG - Intronic
1154366692 18:13716737-13716759 CAGCAACAGGAGGCAGGGAGAGG - Intronic
1155160031 18:23188106-23188128 CAGGTACAGGGAGCAGGGTAGGG - Intronic
1156227642 18:35124806-35124828 CAGGCAGGGGAGGCAGGGTGAGG - Intronic
1157702062 18:49767724-49767746 CAAGTACAGGGGACAGGGTGAGG + Intergenic
1158762706 18:60409437-60409459 CAGGTAGTGTATGCAGTGTGTGG + Intergenic
1159642122 18:70875954-70875976 AAGGTACAGGAAGCAGGGACTGG + Intergenic
1160243237 18:77137533-77137555 CAGGCACAGGCAGCAGGGGGTGG - Intergenic
1160508192 18:79438793-79438815 CAAGCTCAGGACGCAGGGTGGGG + Intronic
1160534611 18:79585466-79585488 ATGGTGCAGGGTGCAGGGTGGGG - Intergenic
1162109852 19:8394076-8394098 CTGGTCCAGGATGCAGGCTGGGG - Intronic
1162500784 19:11052464-11052486 CAGGTGGAGGAAGGAGGGTGTGG - Intronic
1162838732 19:13340123-13340145 CAGGGACAGGGTGGAGGATGGGG + Intronic
1162840976 19:13356202-13356224 AAGGAACACCATGCAGGGTGGGG + Intronic
1162954127 19:14089136-14089158 CAGGGCCAGGATGAAGGGCGGGG - Exonic
1163385940 19:17000642-17000664 TCAGGACAGGATGCAGGGTGTGG - Intronic
1163677187 19:18660954-18660976 CAGGCCCAGAAAGCAGGGTGAGG - Intronic
1163784939 19:19270153-19270175 AAGGTGCAGGAGGCAGGGAGAGG - Exonic
1163786821 19:19279077-19279099 CAGCCACAGGAAGCAGGCTGGGG + Intronic
1164475060 19:28569316-28569338 ATGGTGCAGGCTGCAGGGTGGGG - Intergenic
1164778532 19:30873447-30873469 CAGGTACAGGAAGTGGGGTGGGG - Intergenic
1165177109 19:33938589-33938611 CAGGGACAGGAGGCAGAATGGGG - Intergenic
1165479121 19:36051552-36051574 CAGGAGCAGGATGCAGGAAGAGG + Intronic
1166380070 19:42351114-42351136 CAGGGACAGTCTGCAGGGTGGGG + Intronic
1167087489 19:47320280-47320302 CCGGTACAGGAAGGAGGGTATGG - Exonic
1167255891 19:48428474-48428496 CAGCTACAGGAGGGAGGCTGAGG - Intronic
1167450176 19:49562807-49562829 GAGGTGCAGGTTGCAGGGAGTGG + Intronic
1167507758 19:49880146-49880168 AAGGTACAGCAGGCCGGGTGCGG - Intronic
1168327334 19:55545025-55545047 CAGCCCCAGGATGGAGGGTGGGG + Intronic
1168651964 19:58097580-58097602 CAGGGAAGGGATGGAGGGTGCGG - Intronic
925217843 2:2112492-2112514 CATGCACACGATGCAGTGTGTGG + Intronic
925373278 2:3362780-3362802 CAGGTGCTGGAGGCAGGCTGGGG + Intronic
925451670 2:3974246-3974268 CAGCTACACGGTGCTGGGTGTGG + Intergenic
925705745 2:6683372-6683394 TGGGTACAGGATGGGGGGTGGGG + Intergenic
926041440 2:9676377-9676399 CAGGGACGGGAGGCAGGGTCCGG - Intergenic
926562744 2:14435313-14435335 TAGGCACAGGATGGGGGGTGGGG + Intergenic
927962697 2:27250629-27250651 AAGGGCCAGAATGCAGGGTGCGG - Intergenic
928002567 2:27537649-27537671 GAGGAACTGGATGCAGGGAGAGG + Intronic
928188356 2:29136695-29136717 CAGGTACTGAAGGGAGGGTGAGG + Intronic
928240054 2:29578385-29578407 CAGGGAGAGGTTGCAGGGTATGG + Intronic
929906953 2:46054792-46054814 TAGGCACAGGATGGGGGGTGGGG - Intronic
930477518 2:51902203-51902225 CAGGTGCAGGAAGCAGGGGATGG + Intergenic
931938918 2:67230699-67230721 CAGGCACAGGATGGGGGATGGGG - Intergenic
932904935 2:75739116-75739138 CAGGACCAGGATGCAGGCTCTGG - Intergenic
932959448 2:76395851-76395873 CACTCACAGGAAGCAGGGTGAGG - Intergenic
933846231 2:86329231-86329253 TGGATACAGGATGCGGGGTGTGG + Intronic
934035639 2:88086578-88086600 CACGTGCAGGAAGCAGGGAGGGG - Intronic
934145902 2:89093706-89093728 CAGGTACAGAAGGCAGTGTTGGG + Intergenic
934179906 2:89611230-89611252 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
934223356 2:90106862-90106884 CAGGTACAGAAGGCAGTGTTGGG - Intergenic
934290202 2:91685491-91685513 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
937002876 2:118484286-118484308 CAGGTACTGTATGCACAGTGTGG - Intergenic
937267168 2:120623802-120623824 CATGTCCAGAAGGCAGGGTGGGG + Intergenic
937359372 2:121218437-121218459 CTGATACAGGATGAGGGGTGCGG + Exonic
938150735 2:128880177-128880199 TAGGCACAGGATGGGGGGTGGGG + Intergenic
938604716 2:132880557-132880579 GAGGTGCAGGATGCAGTGAGTGG + Intronic
938624240 2:133091147-133091169 CATGTACAGGAAGCATGGTTAGG - Intronic
940767873 2:157809527-157809549 CAGGGAGAGGAGGCAGGGAGAGG + Intronic
942960592 2:181825651-181825673 CAGGCACAGTGTGGAGGGTGTGG + Intergenic
944512348 2:200477085-200477107 TGGGTACAGGATACGGGGTGGGG + Intronic
946653363 2:221917906-221917928 AAGGGACAGGAAGCAGGGGGTGG - Intergenic
947227324 2:227852939-227852961 CAGGCACAGGATCGGGGGTGGGG + Intergenic
947505606 2:230706197-230706219 CTGGTGCAGTATCCAGGGTGGGG + Intergenic
948455140 2:238101381-238101403 CAGGAACAGGATGCTGGGCCGGG - Intronic
1169657188 20:7938234-7938256 CAGCTACATGATGCAGTGTGAGG + Intronic
1169971127 20:11270549-11270571 CAGGGAGATGGTGCAGGGTGAGG + Intergenic
1170099904 20:12687440-12687462 CTGGTATGGGATACAGGGTGAGG + Intergenic
1171185575 20:23121875-23121897 CAGGCACAGGATGGTGGGGGTGG + Intergenic
1171328794 20:24319030-24319052 CCGGTCCAGGATCCAGGGTGGGG + Intergenic
1171425114 20:25044092-25044114 CAGGTGCAGGAAGCAGCCTGAGG - Intronic
1171526200 20:25813499-25813521 CAAGTACAGGATTCAGGGCAGGG - Intronic
1171550627 20:26042386-26042408 CAAGTACAGGATTCAGGGCAGGG + Intergenic
1172442191 20:34973663-34973685 CAGCGACAGGAAGCAGGATGCGG - Intergenic
1173861751 20:46288297-46288319 GAGGTACAGGGTGCTGGGAGAGG - Intronic
1174142200 20:48423297-48423319 CAGCTTCAAGATGCAGGGTAAGG - Intergenic
1174577706 20:51548334-51548356 GAGGAACATGAAGCAGGGTGAGG - Intronic
1174798046 20:53539072-53539094 GAGGTAGAGGTTGCAGTGTGTGG - Intergenic
1175153718 20:56955126-56955148 CAGGTACAGGTGGCTGGCTGAGG + Intergenic
1175166251 20:57046880-57046902 CAGGCACAGGGTGCAGGCGGGGG + Intergenic
1175180546 20:57143467-57143489 CAGGTACAAGTGGCAGAGTGGGG - Intergenic
1175550362 20:59813617-59813639 CAGCTTCAGGAGGGAGGGTGAGG + Intronic
1175938684 20:62527010-62527032 CAGGCACAGGCTGCAGGCTTAGG + Intergenic
1175988675 20:62776941-62776963 CAGGTACAGAAAGGAGGGGGTGG + Intergenic
1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG + Intergenic
1176173094 20:63705043-63705065 GAGGTACAGGATGCACACTGGGG - Intronic
1176220871 20:63968928-63968950 GTGGGACAGGAAGCAGGGTGAGG + Intronic
1177380961 21:20343940-20343962 TAGTTAAAGGATGCCGGGTGTGG + Intergenic
1177564166 21:22796522-22796544 TAGGCACAGGATGCAGGGAGTGG + Intergenic
1177801553 21:25833549-25833571 TAGGCACAGGATGGGGGGTGGGG - Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1179057252 21:37947446-37947468 CAGTTACTGGCTGCAGGCTGAGG + Intergenic
1179389822 21:40977628-40977650 CATGTACATGATGTAGGTTGAGG - Intergenic
1179478019 21:41660165-41660187 CAGGTACAGGGATCCGGGTGGGG + Intergenic
1179889037 21:44326609-44326631 CATGCACAGGCTGCAGGGTCGGG + Intronic
1179936861 21:44611587-44611609 CAGGTAGGGGTGGCAGGGTGGGG + Intronic
1180706150 22:17811091-17811113 CAGGGACAGGAGGCTGAGTGGGG + Intronic
1181464091 22:23101552-23101574 CAGGAACAGGAGGCAGAGTGAGG - Intronic
1181961549 22:26625418-26625440 CTGGTCTAGAATGCAGGGTGAGG + Intronic
1182519433 22:30876954-30876976 CAGGACAGGGATGCAGGGTGAGG - Intronic
1183310928 22:37109207-37109229 CAGGGACAGGAGGAAGGGAGAGG - Intronic
1183361550 22:37385724-37385746 CAAGTACAGGAGGCAGGGATCGG - Intronic
1183782924 22:40010122-40010144 CAGGTAAAGGACGCCGGGGGTGG + Intronic
1183852947 22:40607212-40607234 CAGGTACACAAGGCCGGGTGCGG + Intronic
1184118905 22:42437857-42437879 TCGGTACAGGGTGCAGGGCGTGG + Intergenic
1184200473 22:42965260-42965282 CAGGGCCAGGGGGCAGGGTGGGG + Intronic
1184421251 22:44384111-44384133 CAGTTAGTGTATGCAGGGTGGGG + Intergenic
1184467354 22:44676765-44676787 CAGGTCCAAGGTACAGGGTGGGG - Intronic
1184641974 22:45877654-45877676 CAGGAAGAGGATGGAAGGTGAGG + Intergenic
1184645279 22:45891831-45891853 CAGGGATAGGCTGCTGGGTGGGG - Intergenic
1184652757 22:45926604-45926626 CATGGCCAGGATCCAGGGTGAGG - Intronic
1184996191 22:48209304-48209326 CAGGGGAAGGAAGCAGGGTGTGG + Intergenic
1185050909 22:48553509-48553531 CAGGGACAGGATGGTGGGAGAGG + Intronic
1185101608 22:48843648-48843670 TGGGTACAGAATGCAGGGTGTGG + Intronic
1185356115 22:50371925-50371947 CAGGAAAAGGAGGCAGGGTGCGG - Intronic
950098915 3:10345585-10345607 CAGGGACAGGAGGCTGGGTGGGG + Intronic
950472298 3:13193777-13193799 CAGGTGCAGGCAGGAGGGTGTGG - Intergenic
951605518 3:24429875-24429897 AAATTACAGGATGCAGGGTTTGG + Intronic
952080522 3:29752328-29752350 TGGGTACAGGGTGGAGGGTGGGG + Intronic
952698681 3:36302430-36302452 CAGCTGCAGGAAGCAGGCTGGGG - Intergenic
952967582 3:38630788-38630810 CAGGGACCCCATGCAGGGTGAGG - Intronic
953889588 3:46742383-46742405 CAGGAACAGGAGGCAGGCAGAGG + Exonic
954940922 3:54372418-54372440 CTGCTGCAGGATGTAGGGTGAGG + Intronic
956978834 3:74614015-74614037 CAGGTGCATGATGCAGAATGTGG - Intergenic
957665075 3:83217210-83217232 GATGTACAGCATGCAGGCTGCGG + Intergenic
958112177 3:89162713-89162735 CAGTTCCAGCATGCAGGGTTGGG - Intronic
958466815 3:94469973-94469995 CAGTTCCAGGCTTCAGGGTGGGG + Intergenic
958498476 3:94875175-94875197 CAGGTGCTGGAAGCAGGGAGAGG + Intergenic
959399106 3:105877492-105877514 CAAGGACAAGAGGCAGGGTGAGG + Intergenic
959694150 3:109231688-109231710 TGGGTACAGGATGCGGGGTGGGG - Intergenic
960692202 3:120358489-120358511 CAGGAACAAGAGGCCGGGTGTGG - Intergenic
961106151 3:124243302-124243324 CAGGGACAGGTTGTAGGGAGTGG + Intronic
961702148 3:128753350-128753372 CAGATAGAGGATGAAGGGGGGGG + Intronic
961957508 3:130819171-130819193 TCCTTACAGGATGCAGGGTGGGG - Intergenic
963657225 3:148070207-148070229 CAGTTACAGAGTGCAGGTTGAGG - Intergenic
964307570 3:155357290-155357312 CAGGCACAGGATGGAGGGTGGGG + Intergenic
965065207 3:163839477-163839499 TAGGCACAGGATGAAGGGTGTGG + Intergenic
965085287 3:164088535-164088557 TGGGTACAGGATGGGGGGTGTGG - Intergenic
966665104 3:182463517-182463539 CAGGTACACGGTGCAAGCTGGGG - Intergenic
966922158 3:184619520-184619542 CAGGGTCAGGATGTAGTGTGGGG + Intronic
967318666 3:188174480-188174502 AAGGCACAGCATGCTGGGTGAGG + Intronic
967853572 3:194100050-194100072 CAGTTACAGGTGGCAGGGAGAGG - Intergenic
968651512 4:1761979-1762001 GTGGCACAGGATGGAGGGTGTGG + Intergenic
968675662 4:1877600-1877622 CAGGCACAGCATTCAGTGTGGGG - Intronic
968838855 4:2985706-2985728 CAGATACAGAAGGCCGGGTGTGG + Intronic
969637607 4:8378367-8378389 CAGGTACAGAATCCAGCGTGTGG + Intronic
969829378 4:9782400-9782422 CAGGTTCAGGATGGAGGCAGTGG - Exonic
970144789 4:13024002-13024024 GAGGTGCAGGATGCCTGGTGTGG + Intergenic
970296755 4:14639000-14639022 CAGCTACAGGAGGCAGGGGTGGG + Intergenic
970708946 4:18839243-18839265 GAGGCAGAGGATGCAGGGAGCGG + Intergenic
971308775 4:25506264-25506286 CAGGTCCAGGATGATGGGGGCGG - Intergenic
971749703 4:30631697-30631719 TAGGTACAGGATGGAGGATGGGG - Intergenic
972329102 4:38047320-38047342 CTGGTTCAGTAGGCAGGGTGGGG + Intronic
973068047 4:45821904-45821926 TGGGTACAGGATGGGGGGTGTGG + Intergenic
973864084 4:55094413-55094435 CAGGTAAAGCATGCAACGTGGGG + Intronic
974505871 4:62771746-62771768 TGGGTACAGGATGGGGGGTGGGG - Intergenic
975247016 4:72131140-72131162 TAGGTATAGGATGCGGGGCGTGG + Intronic
975580876 4:75906150-75906172 TGGGTACAGGATGTGGGGTGTGG - Intergenic
976380012 4:84388550-84388572 CAGCAACAGGCTACAGGGTGGGG + Intergenic
978991288 4:115084957-115084979 CAAGTACATGATGCAAGATGTGG - Intronic
979771025 4:124525197-124525219 TAGGTACAGGATAGGGGGTGTGG - Intergenic
980097013 4:128501699-128501721 TGGGTTCAGGATGCAGAGTGTGG - Intergenic
980113706 4:128659014-128659036 CAGCTACTGGATGGGGGGTGGGG + Intergenic
981550625 4:145937814-145937836 CGGGTACAGGATCCAGGGAGAGG - Intronic
982671129 4:158320995-158321017 CGGGTACATGATAAAGGGTGGGG + Intronic
983172564 4:164552302-164552324 TAGGCACAGGATGCGGGGGGTGG + Intergenic
984382864 4:179017532-179017554 TGGGTACAGGATGGTGGGTGGGG - Intergenic
984417166 4:179476907-179476929 CAGGTCCAGGTTTGAGGGTGTGG - Intergenic
984417180 4:179477002-179477024 TGGGTACAGGATGGGGGGTGGGG - Intergenic
985366642 4:189237810-189237832 CAGGGAAAGGAGACAGGGTGGGG - Intergenic
985843832 5:2329768-2329790 CAGGTTCAGGAGGCTGGGAGGGG - Intergenic
986014852 5:3748830-3748852 CAGGCAGAGGATGCAGGCTCTGG - Intergenic
987268500 5:16280367-16280389 CAGGTCCAGGCTTGAGGGTGGGG + Intergenic
989013818 5:36905063-36905085 CAAGTACAGGAAGCAAGTTGAGG + Intronic
991626736 5:68610743-68610765 TAGGTACAGGCTGCAGTGGGTGG - Intergenic
993835381 5:92813517-92813539 CAGGTACAGGGTGGACTGTGTGG - Intergenic
995120917 5:108534289-108534311 CAGGTCCAGGCTTGAGGGTGGGG + Intergenic
996706321 5:126502081-126502103 CGGGTGCAGGATGAGGGGTGGGG + Intergenic
997468689 5:134104567-134104589 GAGGCAAGGGATGCAGGGTGGGG + Intergenic
997628818 5:135350685-135350707 CAGGGACAGGAGACAGGGTCAGG + Intronic
998071226 5:139199263-139199285 CAGCTACTGGATGGAGGCTGAGG - Intronic
998531734 5:142891201-142891223 CAGCCACACGATGCAGGGGGTGG + Intronic
998791101 5:145767031-145767053 CAGGTCCAGGCTTGAGGGTGTGG - Intronic
998943764 5:147314425-147314447 GAGGTAGAGGTTGCAGGGCGTGG + Intronic
1000308556 5:160018964-160018986 CAGCTACTGGATGGATGGTGTGG + Intronic
1000806716 5:165804149-165804171 CAGGGACAGGGTGGGGGGTGGGG + Intergenic
1000870661 5:166573232-166573254 CAGGCACAGAATGCTGAGTGTGG + Intergenic
1001266091 5:170275611-170275633 CAGGGACAGGATGCAGAGCAGGG + Intronic
1001467274 5:171978635-171978657 CATGGACAGTATGCAGAGTGAGG + Intronic
1002213436 5:177611645-177611667 GAGGCCCAGGATGCAGAGTGAGG - Intergenic
1003240821 6:4344249-4344271 CAGGTACAGGGCCCAGGCTGTGG + Intergenic
1003593928 6:7457982-7458004 TAGGTACAGGATAGGGGGTGTGG - Intergenic
1003985360 6:11429663-11429685 GAGGTAAAGGAGGCAGTGTGAGG + Intergenic
1006446661 6:34083611-34083633 GAGGTTCTGGCTGCAGGGTGGGG + Intronic
1006779665 6:36623679-36623701 CAGGGGCAGGAAGGAGGGTGGGG + Intergenic
1006793890 6:36720343-36720365 CAGCTGCAGGGTGGAGGGTGAGG - Exonic
1006798608 6:36745720-36745742 CAGGTACAGGGAGCCGGGTAAGG - Intronic
1007753593 6:44084493-44084515 CAGGTCCACGAACCAGGGTGGGG - Intergenic
1009312449 6:62171139-62171161 CAGATACAGAATTCAGGGTATGG + Intronic
1009741146 6:67747750-67747772 CAGGTCCAGGATTCAGGCAGTGG + Intergenic
1011353368 6:86447090-86447112 TGGGTACAGGATGGAGAGTGGGG + Intergenic
1011930227 6:92701731-92701753 CAGGCACTGGAAGCAGGGAGAGG + Intergenic
1012042945 6:94233805-94233827 TGGGTACAGGATGCAGGGGTTGG - Intergenic
1013316341 6:108946872-108946894 AAGGTACGGGAGGAAGGGTGTGG + Intronic
1014325352 6:119986593-119986615 TAGAAACAGGATGGAGGGTGTGG - Intergenic
1015317682 6:131834882-131834904 AGGGTACAGGATGTAGGGTCAGG + Intronic
1016422520 6:143900097-143900119 GAGGTACAGGGTGCTGGGTGTGG + Intronic
1016902113 6:149113302-149113324 TGGGTACAGGATGGGGGGTGTGG - Intergenic
1017276996 6:152581307-152581329 GAGGTACAGGCTGAAGGTTGTGG - Intronic
1017633649 6:156423020-156423042 TGGGTACAGGATGCAGGGCGTGG + Intergenic
1017714705 6:157200878-157200900 CAGGGAGAGGATGCAGGGCCCGG + Exonic
1018201592 6:161400376-161400398 GAGGTACAGGTTGCAGTGAGCGG - Intronic
1019631579 7:2052475-2052497 CAGGCACAGCAGGCAGGGAGGGG + Intronic
1019832838 7:3349991-3350013 CAGGTAGAGGATGAAGTTTGGGG + Intronic
1020262292 7:6537061-6537083 CAGGCCCAGGAGGCTGGGTGAGG + Intronic
1020273970 7:6614116-6614138 CAGGGACAGGAGGAAGGGAGGGG + Intergenic
1020390371 7:7651353-7651375 AGGGTACAGGATGGAGGGTGTGG + Intronic
1022117927 7:27278517-27278539 CAAGTACATGAGGCTGGGTGCGG - Intergenic
1022563021 7:31369480-31369502 CAGGCACAGGATGCCGGGTGGGG + Intergenic
1023500548 7:40844685-40844707 CAGGTCCAGGCTTGAGGGTGGGG + Intronic
1024253141 7:47521270-47521292 CAGGAACAGGATCCCGTGTGAGG - Intronic
1024493753 7:50017843-50017865 TAGGTACAGGATGCCGGGTATGG + Intronic
1024814413 7:53251687-53251709 CAGTTACAGAATGAAGGGTAAGG - Intergenic
1024959537 7:54959966-54959988 CAGGAAGAGGGTACAGGGTGAGG + Intergenic
1027195442 7:76026945-76026967 CAGCTACAGGCTGGAGGCTGAGG + Intronic
1027251769 7:76403285-76403307 CAAGTACAGGCTGCAGGGGGTGG - Intronic
1029635777 7:101782856-101782878 CAAGTCCAGGATGCTGGCTGGGG - Intergenic
1029642297 7:101828885-101828907 CAGGGACAGGGTGGAGGGAGAGG + Intronic
1029826208 7:103197640-103197662 CAGGCAGAGGAGGCAGGGAGAGG + Intergenic
1030219984 7:107088382-107088404 GAAGTACAGGGTGGAGGGTGAGG + Intronic
1031063448 7:117077216-117077238 TAGGCACAGGATGCGGGGTGGGG + Intronic
1031924872 7:127629664-127629686 CAGGCACACAGTGCAGGGTGGGG - Intergenic
1032166600 7:129550296-129550318 GAGGTAGAGGTTGCAGGGAGCGG - Intergenic
1032984998 7:137327955-137327977 CAGCTACTGGATGATGGGTGTGG + Intronic
1033390893 7:140926103-140926125 CAGGTAAAGGATGCTGTGTGAGG + Intergenic
1033635761 7:143209981-143210003 CGGGTACAGGATGGGGGGCGTGG + Intergenic
1033970656 7:147034868-147034890 TAGGCACAGGATGAAGGGTGTGG + Intronic
1034268471 7:149792225-149792247 CAGGTGCTGGCTCCAGGGTGTGG + Intergenic
1034438992 7:151077081-151077103 GAGGTAAAGGAGGCAGGGTGGGG - Exonic
1034533855 7:151714504-151714526 CAGGGAGAGGTGGCAGGGTGTGG - Intronic
1034854437 7:154528858-154528880 CAGGTGCAGGGAGCAGTGTGAGG + Intronic
1034900390 7:154904833-154904855 CCTGTCCAGGATGGAGGGTGTGG - Intergenic
1035278462 7:157762815-157762837 CAGGCACCGCATGCAGGGAGGGG + Intronic
1036529507 8:9570569-9570591 CAGGTAGAGGTTGCTGGGGGAGG - Intronic
1036634566 8:10540160-10540182 CAGTTGCATGCTGCAGGGTGGGG - Intronic
1036981524 8:13474538-13474560 CAGGCACACGATGCAAGTTGTGG - Intronic
1037167364 8:15847150-15847172 CAGGGACTGGAAGCAGGGAGAGG + Intergenic
1037258491 8:16981644-16981666 CAGTTTCAGGATTGAGGGTGGGG - Intergenic
1037539402 8:19856579-19856601 AAGGTGCAGGATGCAGAGTCAGG + Intergenic
1037735445 8:21562176-21562198 CATGTAGAGGAGGCTGGGTGTGG - Intergenic
1039178314 8:34834208-34834230 GATGTACAGGAAGCATGGTGAGG - Intergenic
1040029390 8:42810484-42810506 GAGGTAGAGGCTGCAGGGAGAGG + Intergenic
1040858022 8:51970362-51970384 AAGGGACAGGGGGCAGGGTGGGG - Intergenic
1041988438 8:63954855-63954877 TGGGTACAGGATGGGGGGTGTGG + Intergenic
1042228689 8:66535838-66535860 TAGGTACAGCATTGAGGGTGGGG - Intergenic
1044632320 8:94291816-94291838 GAGGGTCAGGCTGCAGGGTGGGG - Intergenic
1044683748 8:94807321-94807343 CTGGGACAGGTGGCAGGGTGAGG + Intergenic
1045337849 8:101224418-101224440 CAGCTGCAGGGTGCAGGCTGGGG - Intergenic
1048900388 8:139031910-139031932 TAGGTACAGGATGGGAGGTGTGG + Intergenic
1048966933 8:139621974-139621996 CAGGAACAGAAGTCAGGGTGGGG - Intronic
1049004501 8:139846123-139846145 CCGCTACAGGCTGCAGGGAGAGG + Intronic
1049262719 8:141648442-141648464 GAGGTGCAGGCTGCAGGCTGAGG - Intergenic
1049304783 8:141895380-141895402 CAGGTAGAGTATGGAGGATGAGG - Intergenic
1049579557 8:143405117-143405139 CAGGAGCAGCAGGCAGGGTGGGG - Intergenic
1049615381 8:143573586-143573608 CAGGTACAGGAAGCATGGCTGGG - Intergenic
1049654629 8:143792173-143792195 CAGGGACAGGCAGCAGGGCGGGG + Intronic
1050407141 9:5321610-5321632 GAGGGAAGGGATGCAGGGTGGGG + Intergenic
1051508965 9:17856721-17856743 CAAGTCCAGGATTCAGGGAGGGG - Intergenic
1051887186 9:21905346-21905368 CAGGCACAGGATGGGGGGCGTGG + Intronic
1051901296 9:22044693-22044715 CAGGCACAGGAAGGAGGGGGAGG - Intergenic
1052995148 9:34547918-34547940 CAGGTGCAGGATGCAGGACTGGG + Intergenic
1053429473 9:38032673-38032695 CTGGTACAGGGTGGAGGGAGAGG - Intronic
1054151064 9:61605438-61605460 CAAGTACAGGATTCAGGGCAGGG + Intergenic
1056203213 9:84296253-84296275 CAGGTAGAGGTTGCTGGGGGAGG + Intronic
1057379118 9:94553355-94553377 CTAGAACAGGATGCAGGGAGTGG + Intergenic
1057742811 9:97726821-97726843 CATGTTCAAGATGCAGGATGTGG - Intergenic
1057903612 9:98967698-98967720 CAGGCACAGGGTGCAGGGGCAGG - Intronic
1058905905 9:109482652-109482674 CAGGAAGAGGAAGCAGGGTTGGG - Intronic
1058985755 9:110207454-110207476 CAGGAACTGGATGCTGAGTGGGG + Exonic
1059800609 9:117746027-117746049 CATGGACAGGAGGGAGGGTGGGG + Intergenic
1059800802 9:117747743-117747765 CAGGAACAGGATGCAGGTAATGG - Intergenic
1060927187 9:127463253-127463275 CAGGTGCAGGAGGCAGGTGGTGG + Intronic
1061182287 9:129031815-129031837 TAGGTACAGGATGGGAGGTGGGG - Intergenic
1061264008 9:129495336-129495358 AAGGGACAGGAAGAAGGGTGAGG - Intergenic
1061494123 9:130961958-130961980 CAGGTACAGGCTACAGGGACAGG + Intergenic
1061719782 9:132544444-132544466 CAGGGCCAGGATGGAGGCTGTGG - Intronic
1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG + Intronic
1061948393 9:133921537-133921559 CAGGGAGAGGCTGCAGGGAGAGG - Intronic
1062276169 9:135732394-135732416 CAGGCACCGGAGGAAGGGTGAGG - Intronic
1062283246 9:135761356-135761378 AAGGAGCAGAATGCAGGGTGTGG - Intronic
1062315547 9:135965392-135965414 GAGGCTCAGGATGCAGGGTGAGG - Intergenic
1062344588 9:136109057-136109079 CAGGGGCAGGAGGCAGGGCGGGG - Intergenic
1062460369 9:136660301-136660323 CAGGTACAGGAGGTGGGCTGCGG - Intronic
1062700974 9:137902809-137902831 CTGGTACAAGATGCAGGGTGAGG + Intronic
1203491567 Un_GL000224v1:111130-111152 CAGTTATAGGGTGCAGGGAGAGG - Intergenic
1203504191 Un_KI270741v1:53001-53023 CAGTTATAGGGTGCAGGGAGAGG - Intergenic
1186036508 X:5429064-5429086 TGGGTACAGGATGGGGGGTGTGG + Intergenic
1187054563 X:15730469-15730491 GAGGTAGAGGAGGCTGGGTGCGG + Intronic
1187443941 X:19344229-19344251 CAGGAACGGAATGCAGGGCGCGG - Intronic
1188180569 X:27050493-27050515 TAGGTACAGGATGCAGGGCGGGG - Intergenic
1188553231 X:31383643-31383665 CAGGCACAGGATGGAGGGCAGGG - Intronic
1189164410 X:38846455-38846477 GAGTTACAGGATGGAGGCTGGGG + Intergenic
1189301461 X:39955511-39955533 TGGGTACAGGATGCTGAGTGAGG + Intergenic
1190212734 X:48460781-48460803 AGGGTACGGGATGCAGGATGTGG + Intronic
1190311472 X:49119824-49119846 CAGGTAGAGGAAGGAGGGTCAGG + Intronic
1191111407 X:56805559-56805581 CTGGCAGAGGATGCAGGATGGGG + Intergenic
1192335661 X:70217220-70217242 CAGGTACATGGTGCAAGCTGTGG - Intergenic
1192440666 X:71171284-71171306 AAGATACAGGAGGCAGGGGGAGG - Intergenic
1193709339 X:84860554-84860576 TGGGTACAGGATGGGGGGTGTGG - Intergenic
1195202927 X:102566854-102566876 AGGGTACAGGGTACAGGGTGTGG + Intergenic
1195759299 X:108228657-108228679 GAGGTACAGAGTGAAGGGTGGGG + Intronic
1195853249 X:109305683-109305705 TAGGGACAGGATGAGGGGTGGGG + Intergenic
1197322801 X:125053545-125053567 CTGGTAGTGGCTGCAGGGTGGGG + Intergenic
1199714308 X:150495492-150495514 GAGGTACTGGAGGCAGGCTGTGG - Intronic