ID: 922192158

View in Genome Browser
Species Human (GRCh38)
Location 1:223328842-223328864
Sequence AGCCAGGACTTGCCTCCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922192158_922192163 16 Left 922192158 1:223328842-223328864 CCTAGTGGAGGCAAGTCCTGGCT 0: 1
1: 0
2: 0
3: 13
4: 158
Right 922192163 1:223328881-223328903 GACTCCACAAACTTTAATTTTGG 0: 1
1: 0
2: 0
3: 13
4: 149
922192158_922192165 21 Left 922192158 1:223328842-223328864 CCTAGTGGAGGCAAGTCCTGGCT 0: 1
1: 0
2: 0
3: 13
4: 158
Right 922192165 1:223328886-223328908 CACAAACTTTAATTTTGGCCTGG 0: 1
1: 0
2: 3
3: 36
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922192158 Original CRISPR AGCCAGGACTTGCCTCCACT AGG (reversed) Intronic
900194883 1:1371150-1371172 AACCAGGACTTGGCTCTGCTGGG - Intergenic
900537355 1:3185480-3185502 AGCCTGGACATCCCTGCACTTGG - Intronic
900537369 1:3185536-3185558 AGCCTGGACATCCCTGCACTTGG - Intronic
900549285 1:3246074-3246096 AGCCAGCACTTGCCTCCCCCGGG - Intronic
900555028 1:3276082-3276104 AGCCAGGACTTGCCAAAACCTGG + Intronic
900679043 1:3906168-3906190 AGCCAGGACTTGTCTCCTGGTGG + Intergenic
901332697 1:8423526-8423548 AGCCAGGAGCTGCCCCCACCGGG - Intronic
902159711 1:14520156-14520178 TGCCAGGACTGGACACCACTGGG - Intergenic
902518352 1:17001956-17001978 GCCCAGGGCTTGCCTCCTCTGGG - Intronic
904256187 1:29256511-29256533 GGCCAGGACTTGAAGCCACTAGG + Intronic
904457512 1:30656590-30656612 GGCCAGGACTCTCCTGCACTCGG - Intergenic
905771653 1:40641890-40641912 AGCCAGGTCCTGCCTCATCTGGG - Exonic
906775358 1:48524455-48524477 AGCCAGGATCAGCCTTCACTGGG + Intergenic
907313735 1:53554535-53554557 AGCCAGGATTTGACTCAAGTAGG + Intronic
908830559 1:68174403-68174425 AGCCAGGACATTCCTCGAGTTGG + Intronic
913213938 1:116604164-116604186 AGCCAGGGCTTGCAGCAACTAGG - Intronic
914997418 1:152557236-152557258 AGCCAGAAGATGCCTCCAATGGG + Intronic
917472327 1:175336552-175336574 AGCCGGGAGTTCCCACCACTTGG - Intronic
917491671 1:175503597-175503619 AGCCAGGACCTGCCTGCCCGGGG - Intronic
917877809 1:179302498-179302520 AGACATGCCTTGCCTCCCCTTGG + Intronic
919452428 1:197787826-197787848 GGCCTGGACTTGGATCCACTGGG + Intergenic
919840970 1:201609251-201609273 AGCCTGGAGCTGCCTTCACTTGG + Intergenic
919990725 1:202707476-202707498 AGCTAGGACCTGCCTAGACTGGG + Intronic
921991823 1:221374974-221374996 AGCCCAGTCTTGCCTTCACTTGG + Intergenic
922192158 1:223328842-223328864 AGCCAGGACTTGCCTCCACTAGG - Intronic
1069519149 10:69104073-69104095 AGCCAGGACTTGGGTCAACATGG + Exonic
1069651314 10:70052039-70052061 AGCCGAGACTGGCTTCCACTAGG + Intergenic
1070676826 10:78417674-78417696 GACAAGGACTTGCCACCACTGGG - Intergenic
1072041469 10:91611079-91611101 AGCCAAGACTTGCTGCCACTGGG + Intergenic
1072663640 10:97379045-97379067 AGACAGGAGCTGCCTCCACATGG - Intronic
1075390040 10:122085312-122085334 AGACAGAAGTTGCCTGCACTAGG + Exonic
1080677424 11:34440440-34440462 AACCAGGATTTGCACCCACTGGG - Intronic
1081764315 11:45598953-45598975 AGCCAGAACTTGCCCCCAGATGG + Intergenic
1082285718 11:50316034-50316056 AGCCAAGACCTTCCTCCATTTGG - Intergenic
1083331206 11:61899209-61899231 AGCTGAGTCTTGCCTCCACTAGG + Intronic
1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG + Exonic
1087156238 11:94907624-94907646 AGCCAGGAATTGGCTGGACTGGG + Intergenic
1087588455 11:100152902-100152924 AGCCAGGATCTGCCTCCTCAGGG + Intronic
1088881495 11:113976756-113976778 AGCCAGGCCTTGCCAGCACCTGG + Intronic
1090334908 11:125955535-125955557 GGCCAGGGCTTTCCTCCAGTTGG + Intergenic
1091173579 11:133540234-133540256 AGCCAGGATTTTACTCCCCTGGG - Intergenic
1091706192 12:2695080-2695102 AGCAAGTATTTGCCTCCCCTGGG - Intronic
1095324133 12:40867196-40867218 AGTCAGGAAATGCATCCACTTGG + Intronic
1096362527 12:51000550-51000572 TACCAGAACGTGCCTCCACTTGG + Intronic
1096622882 12:52875331-52875353 AGCCAGGAGTGGCCTCCACCTGG + Intergenic
1098225973 12:68324742-68324764 AGACAGGAAATACCTCCACTTGG - Intronic
1098508349 12:71281946-71281968 GGCCAGGCTTTGCCTCCTCTCGG - Intronic
1100009218 12:89933832-89933854 AGTCAGGGCTTGCTTCCAATGGG + Intergenic
1100363889 12:93901587-93901609 AGCCAGGACTTTCCCCTTCTAGG + Intergenic
1102008668 12:109604976-109604998 AGCCAGGATTTGAATCCAGTAGG + Intergenic
1103933630 12:124463716-124463738 AGCCAGGACTTACCGCCCCTTGG - Intronic
1104674396 12:130702926-130702948 AGCCGGGACCTGCCTCAACAGGG + Intronic
1114452108 14:22834037-22834059 AGCCAGAACTCGCTCCCACTGGG + Intronic
1115576481 14:34716464-34716486 AACCAGAACTTACCACCACTTGG + Intergenic
1118029252 14:61803995-61804017 GGCCAGGACTTATCTCCTCTTGG - Intergenic
1119740177 14:77008966-77008988 AGCCTGGAATTGCCACCCCTGGG + Intergenic
1120827751 14:88970558-88970580 AGCCAGGAAGTGGCTGCACTTGG - Intergenic
1120933163 14:89868614-89868636 AGCCAGAACTGGCCTCCTCCAGG - Intronic
1121308906 14:92924137-92924159 AGAAAGGACTGGCCTCCACTTGG + Intronic
1122264833 14:100541697-100541719 AGCCAGGAGTGGCTGCCACTGGG + Intronic
1122887365 14:104716056-104716078 AGACAGGACCAGCCTGCACTGGG + Intronic
1126857510 15:52853347-52853369 GGCCATGAGTTGCCTCCACAGGG - Intergenic
1126902141 15:53325498-53325520 AGCAAGGACTGGCCTCTCCTGGG + Intergenic
1127274295 15:57428618-57428640 AGGCAGGAGCTGCCTCCAGTAGG + Intronic
1127707693 15:61563322-61563344 AGACAGGACATCCTTCCACTTGG - Intergenic
1127847128 15:62880254-62880276 TGACAGTACTTGCCTCAACTGGG - Intergenic
1128647771 15:69389601-69389623 AGCCAGGCCTTGGCACCACATGG - Intronic
1132128097 15:99247698-99247720 AACCAGGACTTGCCTGCAAATGG + Intronic
1137341577 16:47612610-47612632 AGCTAGGATGTGGCTCCACTTGG - Intronic
1137629910 16:49935751-49935773 ACACAGGAGTGGCCTCCACTGGG + Intergenic
1138829792 16:60361235-60361257 AACCTGGATGTGCCTCCACTTGG - Intergenic
1139973280 16:70789829-70789851 AGCCAGGACATGTTTCCGCTTGG + Intronic
1141774981 16:86117157-86117179 CCCCAGGACTTGCCACCATTTGG - Intergenic
1142492271 17:286766-286788 AGCCAGGACTCGCTTGCCCTGGG - Intronic
1143294148 17:5857949-5857971 ACCCAGGTCTGGCCTCCACAGGG + Intronic
1144579319 17:16449315-16449337 AGCCAGGACTTGAATCCCCACGG - Intronic
1146689713 17:34865057-34865079 AGGCAGGACTCCCCTCGACTAGG + Intergenic
1147332520 17:39707162-39707184 AGCCAGGCCCTGCCTCCAGCTGG + Intronic
1148560952 17:48605705-48605727 AACCTGGACTTGCCTGCATTTGG - Intergenic
1148850391 17:50551755-50551777 AGCCAGGACTGGAGTCCACATGG - Intronic
1150487790 17:65556092-65556114 AGCCTGGGCTTGCCTCATCTGGG - Intronic
1152566580 17:81103095-81103117 AGCCAGGCCTGACCCCCACTGGG + Intronic
1203171135 17_GL000205v2_random:148635-148657 AGCCTGGCCCTGCCTTCACTGGG - Intergenic
1153523986 18:5977854-5977876 AGGCAGGACTTACCTCCTCCTGG - Intronic
1158026033 18:52898399-52898421 TGCCAAGACTTGCCGCCTCTAGG - Intronic
1158710588 18:59834004-59834026 AGCCAGGACTTGACTACCCATGG + Intergenic
1161394072 19:4035418-4035440 AACCAGGGCCTGCCTCCAGTTGG + Intronic
1162789495 19:13055588-13055610 AGCCAAGACCACCCTCCACTTGG + Intronic
1165068769 19:33243277-33243299 AGCCAGGACCAGCCTCGGCTAGG - Intergenic
1166822613 19:45589814-45589836 AGCCTGGCCTTGCCTTCACAGGG - Exonic
1168638963 19:58018053-58018075 CGCCAGGATTTTACTCCACTTGG - Intergenic
925537513 2:4933377-4933399 AGTCAGGCCTTTCCTCCTCTAGG + Intergenic
926046815 2:9716093-9716115 AGCATGGACTTGCTTCCACTGGG - Intergenic
928095855 2:28404624-28404646 AGCCAGGACTTGGCTACAGATGG + Intronic
930243654 2:48961521-48961543 AGCCAGGACCTGACCTCACTAGG - Intergenic
932462657 2:71893320-71893342 ACCGAGGACTTTCCTCCACGTGG - Intergenic
936284822 2:111173749-111173771 AGGCAGGACTGGACTCCACAGGG + Intergenic
937245309 2:120488693-120488715 AGCCTGCCCTTGCCTCCTCTAGG - Intergenic
941662007 2:168204489-168204511 ATCCAGGTCTTGCCTTCCCTGGG - Intronic
947800426 2:232926100-232926122 AGACAGGACGTGTCTCCAGTGGG - Intronic
948808594 2:240463492-240463514 ACCCAGGAGGTTCCTCCACTCGG - Exonic
1170019222 20:11817207-11817229 AACCAGGACTTACTCCCACTTGG + Intergenic
1170224245 20:13974161-13974183 AGCCAGGACTTGCCCCATCCTGG - Intronic
1170505898 20:17025521-17025543 ACCCTGGACTTCCCTCCTCTAGG + Intergenic
1172781090 20:37437455-37437477 AGCCAGCACTGGCCTCCATGGGG - Intergenic
1173470415 20:43319343-43319365 AGCCAGCAGTTTCCTCCAGTAGG - Intergenic
1175669423 20:60889435-60889457 AGCCACGACTCCCCTCCCCTCGG + Intergenic
1176327119 21:5510465-5510487 AGCCTGGCCCTGCCTTCACTGGG - Intergenic
1176400638 21:6310486-6310508 AGCCTGGCCCTGCCTTCACTGGG + Intergenic
1176436519 21:6678618-6678640 AGCCTGGCCCTGCCTTCACTGGG - Intergenic
1176460781 21:7005688-7005710 AGCCTGGCCCTGCCTTCACTGGG - Intergenic
1176484342 21:7387466-7387488 AGCCTGGCCCTGCCTTCACTGGG - Intergenic
1178487456 21:33027887-33027909 AGCGAGGACTGGCCTGCGCTGGG + Exonic
1180246905 21:46554554-46554576 AGCCAGTCCTTGTCTCCACAGGG + Exonic
1181754512 22:25013867-25013889 AACCAGGCCTTGCCCTCACTTGG - Intronic
1182618459 22:31604585-31604607 AGACAGCACTTGTTTCCACTTGG - Intronic
1183695042 22:39416897-39416919 GGCCTGGACTTGACTCCCCTGGG - Intronic
1185300164 22:50075370-50075392 AGCCAGGCCTTGCGTCCAGAAGG + Intronic
949946087 3:9191193-9191215 GGCCTGGGCTTGCCTCCACAGGG - Intronic
951710014 3:25577632-25577654 ACCCAGGAGCTGCCTCCAGTGGG + Intronic
952585568 3:34887969-34887991 AGCTAGGACTGGTCTCCACATGG - Intergenic
953983610 3:47425568-47425590 AGCCAGGGCCAGCCCCCACTTGG + Exonic
955198348 3:56827035-56827057 AGCAAGGTCTTTCCTACACTAGG - Intronic
955354290 3:58217615-58217637 CGCCAGGACTTGTCACCACGTGG + Intergenic
955963450 3:64364149-64364171 ATCCAGGACTTGCATCCATAGGG - Intronic
962536023 3:136329353-136329375 AGCCTGGACTAGCCTCCTCAAGG - Intronic
969598713 4:8163220-8163242 AGCCCGGAGTTGCTCCCACTGGG - Intergenic
969806260 4:9611339-9611361 AACCAGGATTTGACCCCACTGGG - Intergenic
985123225 4:186664619-186664641 AGCCAGGATTTACCTCCTCTGGG + Intronic
985639207 5:1055649-1055671 CGCCGGGGCTTGCCTCCCCTTGG - Intronic
989199145 5:38746294-38746316 TTCCAGGTCTTTCCTCCACTGGG + Intergenic
993350596 5:86845136-86845158 AGCCATGACTAGTCTCAACTAGG - Intergenic
995382542 5:111550729-111550751 AGCCAGGACTTTCTTCTACCAGG - Intergenic
995806064 5:116053514-116053536 ACCCGGGACTGGCCTCCACGCGG - Intronic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1001490438 5:172150971-172150993 AGACAGGACGTGCCTGCCCTTGG - Intronic
1002311702 5:178318975-178318997 AGCCAGCACCTGCCTTCACCTGG - Intronic
1003129946 6:3386838-3386860 AACAAGGACTTGCTTCCACAGGG + Intronic
1004343681 6:14829130-14829152 GGCTAGGAGTTGCCTCCTCTGGG + Intergenic
1007750681 6:44068885-44068907 AGCCAAGACTTGCTCCAACTGGG + Intergenic
1013311379 6:108897590-108897612 AGCCTGGACTTGCTGCAACTGGG + Intronic
1015496630 6:133889783-133889805 AGCCAGGATCTGCCTCAAGTGGG - Exonic
1016376658 6:143428147-143428169 AGTCAGCACTTGCCTGGACTGGG + Exonic
1017089709 6:150748573-150748595 AGCCAGGATTTGCTTCCATTTGG - Intronic
1017099883 6:150839009-150839031 AGCCAGGAGCTGACTCCTCTAGG + Intronic
1018083150 6:160276221-160276243 AGGTAGGGCTTGCCTCCACTGGG - Intronic
1018338941 6:162829247-162829269 GGCCAGGCCTTGCCTGCATTTGG - Intronic
1018705279 6:166459914-166459936 AGCCACCACTTGCCCCCACTGGG + Intronic
1018804760 6:167249922-167249944 AGCCTCGACATGTCTCCACTTGG + Intergenic
1022120869 7:27306726-27306748 AGTCGGGACTTGGCTCTACTAGG + Intergenic
1022494467 7:30844365-30844387 AGCAAGGACTCGCCTCCTCCTGG + Intronic
1023543754 7:41295348-41295370 AGACAGGGCTTCCATCCACTGGG - Intergenic
1023959276 7:44913094-44913116 ATCCAGGACCTGCCTCACCTCGG - Intergenic
1024096403 7:45986242-45986264 AGACAGGACTTGGCCTCACTAGG - Intergenic
1024617860 7:51130646-51130668 TGCCAGGACCTGCCTCCCCCTGG + Intronic
1027438360 7:78191592-78191614 AGCCTGGAGTTGCCACCTCTGGG + Intronic
1029477775 7:100795126-100795148 AGCCAGGCCTTCCCTCAGCTGGG + Intronic
1030742649 7:113128294-113128316 ATCCAGCACTTCCCTCTACTAGG - Intergenic
1032945827 7:136851496-136851518 AGCCAGGATAGGCCTCCACACGG + Intergenic
1034241658 7:149615958-149615980 AGCCAGGACTTGCGTCTAAAAGG + Intergenic
1037693117 8:21199878-21199900 AGCCATGCATTGCCTCTACTCGG + Intergenic
1045223552 8:100222172-100222194 GGAGAGGACTTGCCTCCTCTAGG + Intronic
1048268297 8:133006645-133006667 AGCAAGGATATGCCTCCACGAGG - Intronic
1050130197 9:2403955-2403977 TGCCAGGACTTGCCACCAGCTGG + Intergenic
1051120448 9:13746495-13746517 AGCCAGGATAGGCCTCCCCTAGG - Intergenic
1061665494 9:132158655-132158677 CATCAGGACTTGCCTCCTCTTGG + Intergenic
1203434997 Un_GL000195v1:130041-130063 AGCCTGGCCCTGCCTTCACTGGG + Intergenic
1190310989 X:49116964-49116986 AGCCAGGCCCTGCCACCCCTAGG + Intronic
1191801556 X:65086855-65086877 TGCCAGGCTTTGCCTCCACAAGG + Intergenic
1192737707 X:73864294-73864316 AGTCTGGACCTGCATCCACTTGG - Intergenic
1199139426 X:144292207-144292229 AGCCAGGACTGCCTTCCCCTCGG + Intergenic
1200148254 X:153938519-153938541 ACCCAGGCCTTGCCACCACTGGG + Intronic