ID: 922194396

View in Genome Browser
Species Human (GRCh38)
Location 1:223347140-223347162
Sequence CAATAAGCAATATGGAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 441}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922194396 Original CRISPR CAATAAGCAATATGGAAAAT TGG Intronic
900698721 1:4029971-4029993 CAAAAATCTAAATGGAAAATGGG - Intergenic
901826137 1:11862776-11862798 CAAGAAGGAAGATGGAAGATGGG + Intergenic
904595585 1:31642977-31642999 TAATAAGCATTAGGGACAATTGG - Intronic
905961067 1:42042939-42042961 CATTAAGCACTAAGGAAAGTAGG + Intergenic
906852386 1:49265497-49265519 CAATAAGTAATATAAAAACTGGG - Intronic
907232959 1:53017774-53017796 CAAGAAGCAATACAGAAAAATGG + Intronic
908373376 1:63506378-63506400 AAATAAGCAAGATGCAAAAGTGG + Intronic
908685569 1:66715242-66715264 CAATAAGGAATATTGTAAGTGGG + Intronic
909359641 1:74745407-74745429 CAATCAGCACTCTGTAAAATGGG - Intronic
910030006 1:82708323-82708345 CTATAAGCGATAAGAAAAATGGG - Intergenic
910173143 1:84399658-84399680 CAAGAAGCAACATGGAAATTTGG + Intronic
910240733 1:85083159-85083181 CAATAAGCAATAAGAATAAAGGG + Intronic
911130122 1:94378639-94378661 CAATCAGCACTCTGTAAAATGGG - Intergenic
911434405 1:97837966-97837988 TAATAAGAAATATAGAAAATTGG - Intronic
911818206 1:102382143-102382165 CATATAGCAAAATGGAAAATAGG + Intergenic
912220064 1:107664024-107664046 AAATAAGCAATTAGTAAAATAGG + Intronic
912283041 1:108337819-108337841 ACTTAAGCAAAATGGAAAATTGG + Intergenic
914782077 1:150794562-150794584 CAATAAGAAAAATTAAAAATGGG - Intergenic
915098488 1:153481540-153481562 AAAAAAAAAATATGGAAAATAGG - Intergenic
915189037 1:154133202-154133224 CAATAAGCCATGTGGATAATTGG - Intronic
916591730 1:166197591-166197613 AAATAATCAATTTGGAAAGTAGG - Intergenic
916788885 1:168107325-168107347 CAATAGGCAACATGGAGAAGTGG + Intronic
918019360 1:180670267-180670289 CTATAAAGAATATAGAAAATTGG - Intronic
918475164 1:184917046-184917068 CAATAAGCAGCCGGGAAAATGGG - Intronic
918811753 1:189131550-189131572 AAAGAAGTAATGTGGAAAATAGG + Intergenic
921417419 1:214906260-214906282 CTTTATGAAATATGGAAAATTGG - Intergenic
921524904 1:216205150-216205172 CATTAAGCTGTATGGAAAGTAGG + Intronic
922194396 1:223347140-223347162 CAATAAGCAATATGGAAAATTGG + Intronic
922230160 1:223678687-223678709 AAATAAGTGATATTGAAAATTGG + Intergenic
922611685 1:226934617-226934639 GAATAAGCAAAATTGAAAATGGG + Intronic
922647303 1:227301913-227301935 CAATAAGAAAAATAGAAATTAGG - Intronic
923295756 1:232593778-232593800 AAATAAGCAATATTCAAAGTAGG + Intergenic
924286314 1:242491307-242491329 ATATAAGTAATATGGAAAAGAGG - Intronic
924400564 1:243676022-243676044 ATATAAGCTTTATGGAAAATAGG - Intronic
924800464 1:247326374-247326396 CAATAATCAATAGGCAAAGTAGG - Intronic
1063668742 10:8082764-8082786 CAAGAAGCAATATAGAAAGAGGG - Intergenic
1065498951 10:26359694-26359716 CCATAACCAATGTTGAAAATTGG + Intergenic
1066612172 10:37260670-37260692 CAACAAGCAAATGGGAAAATCGG + Intronic
1068017055 10:51530529-51530551 CAATACAAAATGTGGAAAATAGG - Intronic
1068084313 10:52355781-52355803 CAAAAAATAATAAGGAAAATTGG + Intergenic
1068240250 10:54295316-54295338 CAATCAGCACTCTGTAAAATGGG + Intronic
1069009412 10:63354457-63354479 AAATAAAAAATATGAAAAATTGG - Intronic
1069223577 10:65913248-65913270 CCATAATCAAAATGGAAAACAGG + Exonic
1069526360 10:69175597-69175619 CAATCAGCACTCTGTAAAATGGG + Intergenic
1070648724 10:78219767-78219789 CAATCAGCACTCTGTAAAATGGG + Intergenic
1072775861 10:98192303-98192325 AAATAAACAAAATAGAAAATAGG + Intronic
1074680784 10:115904890-115904912 CACTGAGCAATATCAAAAATTGG - Intronic
1077204323 11:1335061-1335083 CAAAAAACAATCTGCAAAATGGG - Intergenic
1077717549 11:4597161-4597183 CCATAAGTAACATGAAAAATTGG + Intergenic
1078951004 11:16134279-16134301 CATTAGGCAATATGGAACAATGG - Intronic
1079069886 11:17335184-17335206 TTATAAGCAATATGGAAAAATGG + Intronic
1079620164 11:22544126-22544148 CAATGAGGAATATGGAGAAAAGG - Intergenic
1079725469 11:23875422-23875444 AATTTAGCAATAAGGAAAATAGG + Intergenic
1080132444 11:28812803-28812825 CAATTAGTAATATGGGAGATGGG + Intergenic
1081162116 11:39761857-39761879 CACAAAACAATATGGAAATTAGG - Intergenic
1081480649 11:43485245-43485267 AAAAAAGTAATATTGAAAATTGG + Intronic
1083809270 11:65094318-65094340 CAATAAGAGTTACGGAAAATGGG + Intronic
1083829162 11:65220172-65220194 CAACAAGCTAAAAGGAAAATGGG - Intergenic
1084863433 11:72037540-72037562 CTAGAAGCCACATGGAAAATGGG + Intronic
1085554740 11:77410270-77410292 GAATAAGCAAGATGGGAAGTGGG - Intronic
1085660762 11:78364574-78364596 CAATAAGCATTTTACAAAATGGG - Intronic
1085673217 11:78489253-78489275 AAGCAAGCCATATGGAAAATGGG + Intronic
1085881699 11:80474655-80474677 CAGTAACTAATATGTAAAATAGG + Intergenic
1086045657 11:82528238-82528260 CAAATAGAAATAAGGAAAATGGG + Intergenic
1086380964 11:86253744-86253766 CTATAAGCTATAAGAAAAATGGG + Intronic
1087144905 11:94801456-94801478 CCATAAGCAATCGGGAAAAGCGG + Intronic
1087744768 11:101930679-101930701 CAATCAGCACTCTGTAAAATGGG - Intronic
1087933932 11:104009305-104009327 TATTAAGCAATATACAAAATCGG + Intronic
1088081542 11:105922150-105922172 GAATACTCAATATGGAAAAGTGG + Intronic
1089204132 11:116745096-116745118 CAATAACCCAAATGAAAAATGGG + Intergenic
1089841362 11:121420911-121420933 CCAAAGGCAATATGGAAAAATGG + Intergenic
1090689689 11:129166534-129166556 CAATAAGCAATAATTACAATGGG + Intronic
1090956497 11:131517458-131517480 CAATAGGCAGGCTGGAAAATGGG + Intronic
1092141535 12:6187094-6187116 CAAAATGCAATGTGGAAACTTGG + Intergenic
1092270172 12:7017820-7017842 GAATATGAAATATGGAATATGGG + Intronic
1093240652 12:16667518-16667540 CAAGAAGCCACATGGAAACTAGG + Intergenic
1093862431 12:24182706-24182728 GAATTAGCAATTTGGAAATTTGG - Intergenic
1094114605 12:26896867-26896889 GACTAATCAATATGGAAATTAGG + Intergenic
1094238722 12:28198579-28198601 CATTCAGCAAAATGGAAAATAGG - Intronic
1095668550 12:44832084-44832106 AAAAAAGCAATATGGAATAGAGG - Intronic
1095710044 12:45278442-45278464 AAATAGGAAACATGGAAAATTGG - Intronic
1096580342 12:52580919-52580941 CCATAGGCAATGTGGAAATTGGG + Intergenic
1096944879 12:55392895-55392917 CATAAAGAAAGATGGAAAATTGG - Intergenic
1097375123 12:58834211-58834233 CAATCAGCAATTTGTAAAGTGGG - Intergenic
1097666613 12:62484884-62484906 CAATAATGAACATGGAAAAGAGG + Intronic
1098118331 12:67204944-67204966 AAATGAGAAATAGGGAAAATGGG + Intergenic
1098178295 12:67817381-67817403 CAATAAAGAACATGGAAAATGGG - Intergenic
1098617008 12:72538880-72538902 GGATAAGGAATTTGGAAAATTGG - Intronic
1098722560 12:73920431-73920453 TAATAAGCAATATGAACATTTGG - Intergenic
1099234674 12:80069397-80069419 TAATAAGCAGTAGGAAAAATAGG + Intergenic
1100129172 12:91469125-91469147 CAACAAGCCATTTGAAAAATGGG - Intergenic
1100139439 12:91599111-91599133 CTATTAGCAATATTGAAATTAGG + Intergenic
1100204926 12:92338713-92338735 CACTAAGAGATATGCAAAATTGG - Intergenic
1100590371 12:96022535-96022557 AAATTAGCAATATGGGAAACTGG + Intronic
1101181343 12:102221773-102221795 AAATGAGAAATCTGGAAAATAGG + Intergenic
1101578607 12:106021095-106021117 CAATAGTCAGTATGGAAATTGGG + Intergenic
1102896207 12:116600274-116600296 CAATAAGGAATATTCCAAATAGG - Intergenic
1103027581 12:117586283-117586305 AAATAAGAAATAAGAAAAATAGG + Intronic
1104999928 12:132683856-132683878 CAGTAAGAAATCTGAAAAATGGG + Intronic
1105351453 13:19619943-19619965 ATATAAGCAAGATGGAGAATAGG - Intergenic
1105380745 13:19884945-19884967 CAATCAGCACTCTGTAAAATGGG - Intergenic
1105952590 13:25244229-25244251 CAATCAGCACTCTGTAAAATGGG - Intergenic
1106813505 13:33382803-33382825 CGATAAGCATTATAGAAAAATGG + Intergenic
1107955744 13:45509387-45509409 CAATAATCTTTATGGAACATAGG - Intronic
1108265725 13:48706750-48706772 CAGTAAGCAAGAAGGAAAAAGGG + Exonic
1108276468 13:48815238-48815260 CAATAAGCAATGTATAAAAGGGG + Intergenic
1109407910 13:61924954-61924976 CAATAAGCAATAAGTACAAAAGG - Intergenic
1110050325 13:70888593-70888615 CAATGAGCAATTTGCAAAGTGGG - Intergenic
1110901942 13:80835164-80835186 AATTAATTAATATGGAAAATTGG - Intergenic
1111033687 13:82641471-82641493 AAATAAGCAAGATGGGAAAGTGG - Intergenic
1111255850 13:85667421-85667443 CAAGAAGGAATATAGAATATTGG + Intergenic
1111474864 13:88731362-88731384 TAATAACCTATATGAAAAATTGG - Intergenic
1112099435 13:96170785-96170807 CAAAAACCAAAATGAAAAATTGG + Intronic
1112854851 13:103755767-103755789 TAATAAGCAATATAGAATATTGG + Intergenic
1112859499 13:103812692-103812714 CAATTAGCAAAATGGAAAGAAGG + Intergenic
1112903415 13:104387649-104387671 CACTAAGTTATATGGAAAACAGG - Intergenic
1112914214 13:104526061-104526083 CTCTAAGCAACATAGAAAATAGG - Intergenic
1113368583 13:109701874-109701896 AAACAAGCAATATGGAAAGGAGG - Intergenic
1113843814 13:113374884-113374906 CCATGAGCACTTTGGAAAATAGG + Intergenic
1114526794 14:23371566-23371588 CAAAGGGCAATCTGGAAAATTGG - Intergenic
1114931075 14:27467344-27467366 CAATAAGAAATATGAAAAAAAGG + Intergenic
1115314934 14:32015521-32015543 AAATAACCAATATGTAAAATAGG - Intronic
1115938423 14:38581501-38581523 CATTAAGCCATATGAAAAAGGGG + Intergenic
1116235691 14:42276248-42276270 CAATAAACAATTTGCAAATTGGG + Intergenic
1117058973 14:51941815-51941837 CAACAAGAAACATGAAAAATAGG - Intronic
1117162712 14:53005124-53005146 CAGTTAGCAATATGAAAAAATGG + Intergenic
1117296293 14:54382654-54382676 CAAGAAACAATATTGAAATTAGG + Intergenic
1120020324 14:79522882-79522904 CAGTCAGCTATATGCAAAATAGG + Intronic
1120391636 14:83915963-83915985 CAATTAGCAATAGAGAAAAGAGG - Intergenic
1121805503 14:96816725-96816747 CAATCAGCAAAATTCAAAATGGG + Intronic
1122039527 14:98974186-98974208 AAATAAGCAATATGCACCATAGG + Intergenic
1124627762 15:31318772-31318794 CCGTAATCAATGTGGAAAATGGG - Intergenic
1124938939 15:34199958-34199980 CAATCAGCACTCTGTAAAATGGG - Intronic
1125109576 15:36015293-36015315 CAATCAGCACTCTGTAAAATGGG + Intergenic
1125381261 15:39089738-39089760 CAACAATCAATATGGCAAAGTGG + Intergenic
1125632279 15:41157074-41157096 CAATTAAAAATATAGAAAATAGG + Intergenic
1126291506 15:47085625-47085647 CAACAAGAAAAATGGAAAACTGG - Intergenic
1126585402 15:50281001-50281023 AAATATGCAGTATGGAAAATAGG - Intronic
1128439670 15:67693856-67693878 AAATAAGAAATGTGGAAAAGTGG - Intronic
1131346639 15:91655798-91655820 CAATCAGCACTCTGTAAAATGGG + Intergenic
1131430368 15:92383304-92383326 CAATAATCAATAATGAAAATCGG - Intergenic
1131729483 15:95264508-95264530 CAAGAAGAAACTTGGAAAATGGG + Intergenic
1133933354 16:10250029-10250051 CAGGAAGGAATGTGGAAAATGGG + Intergenic
1136958901 16:34821998-34822020 TAATAATTAATTTGGAAAATGGG + Intergenic
1136967021 16:34925303-34925325 TAATAATTAATTTGGAAAATGGG + Intergenic
1137387316 16:48053725-48053747 CAATAAGCATTAGAGGAAATGGG - Intergenic
1139406499 16:66723121-66723143 CACTAAGCAAAATGGGAATTAGG - Exonic
1140609184 16:76577897-76577919 TCAAAAGCAATTTGGAAAATTGG + Intronic
1140618967 16:76704575-76704597 CATTAAACAATATAGAAAGTAGG + Intergenic
1140872346 16:79118784-79118806 AAATAAGCAATGTGCCAAATGGG - Intronic
1141020303 16:80489454-80489476 TAATAAGTAATATGCAAAAATGG - Intergenic
1141869354 16:86774065-86774087 CTATAAGCAAGCTGGAGAATGGG + Intergenic
1143418268 17:6766450-6766472 CAATAAGTAATATCTAAAACTGG - Intronic
1143441038 17:6974376-6974398 CAAAAAGTAACATGTAAAATCGG - Intronic
1144516788 17:15923705-15923727 CACTAAGAAATATGGGCAATGGG - Intergenic
1147398786 17:40166158-40166180 CAATAGGCAAAATGGGTAATAGG - Intronic
1148379669 17:47186378-47186400 TAATAAGCAATATAGCAATTGGG - Intronic
1148497682 17:48063313-48063335 CAATAGGCTATATGGCACATAGG - Intergenic
1149184929 17:53986294-53986316 GAATATACAATATGGAAAATGGG - Intergenic
1149308291 17:55370425-55370447 CAAAATGCAATGTGGAAAATAGG - Intergenic
1152840961 17:82567833-82567855 CAAGAAGCAATGTGGAAATAGGG - Intronic
1153389559 18:4538932-4538954 GAATTAGCAGAATGGAAAATAGG + Intergenic
1153417892 18:4869758-4869780 GAATAAGCAAAATTGAAGATAGG + Intergenic
1154220176 18:12445769-12445791 CAATAAGCAATAAGTCATATTGG - Intergenic
1154352189 18:13593523-13593545 AAATAAACAAAATAGAAAATAGG - Intronic
1155103038 18:22632693-22632715 CAACAATCATTCTGGAAAATAGG - Intergenic
1155263136 18:24064647-24064669 CATTGGGCAATGTGGAAAATGGG + Intronic
1155587698 18:27386683-27386705 TAATAAACAATATGGCTAATAGG - Intergenic
1155744641 18:29338763-29338785 AAAGAAGCAATAGAGAAAATGGG + Intergenic
1155819823 18:30361630-30361652 GAATAGGCTATATGTAAAATAGG - Intergenic
1158198831 18:54917600-54917622 AAATTAGCACTATGGAAAAAAGG - Intronic
1158331895 18:56371544-56371566 AAATAAGTAAAATAGAAAATAGG + Intergenic
1158388391 18:57021034-57021056 CAATTAGCAATCTGGAAAGAGGG + Intronic
1159783973 18:72692580-72692602 CAAGAAGCAGTAAGCAAAATGGG + Intergenic
1159826764 18:73222396-73222418 CAATAAGTAACAAGGAGAATTGG + Intronic
1159991293 18:74911872-74911894 AGATAAGCAAAATGGAAAGTGGG + Intronic
1161186956 19:2927468-2927490 AAATAACCAAAATAGAAAATAGG + Intergenic
1162672641 19:12270112-12270134 CAATGATCAATATGAAGAATGGG - Intronic
1162684881 19:12374066-12374088 CAATAAACAATATAAAAACTAGG - Intergenic
1163268950 19:16238002-16238024 CTATAAAAAATATGAAAAATTGG - Intronic
1164811052 19:31156138-31156160 CAATAAACAATAAGCAGAATAGG - Intergenic
1165610733 19:37149942-37149964 CATGAAGCAATGTGGGAAATTGG + Exonic
1165881442 19:39046856-39046878 CAATAAGATATATGTACAATTGG + Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
925527366 2:4817848-4817870 CAGAAATCATTATGGAAAATTGG + Intergenic
925677810 2:6384346-6384368 AAATAATAAATATGGAAATTAGG - Intergenic
925949209 2:8895271-8895293 CAATCAGCACTCTGTAAAATGGG - Intronic
926381892 2:12299278-12299300 AAATCAGCAATGTGGAAGATGGG - Intergenic
926984489 2:18607387-18607409 CAGTGAGAAATAAGGAAAATAGG - Intergenic
927439158 2:23098171-23098193 AAATTAGAAACATGGAAAATAGG + Intergenic
927569732 2:24148304-24148326 CAATAAGCAACATGCAACAGTGG - Intronic
929298166 2:40271566-40271588 AAATAATCAACGTGGAAAATAGG - Intronic
929322291 2:40558848-40558870 CAATAAGAAATAGGGAAAAGTGG - Intronic
929470379 2:42186173-42186195 TTATAAGCTATTTGGAAAATAGG - Intronic
930224612 2:48779507-48779529 AAATAAGCAATATGCAGAAATGG - Intergenic
930543665 2:52740011-52740033 CAAGAAACATTATGGAAGATAGG + Intergenic
930637954 2:53826471-53826493 AAAAAAGTAATAGGGAAAATTGG - Intergenic
932247931 2:70212922-70212944 CAAGAACAAATATGGGAAATGGG + Intronic
933125032 2:78593758-78593780 GAATAAGTAATATGGAATTTAGG - Intergenic
933373851 2:81453061-81453083 AAAAAAGCAATATGTAGAATAGG - Intergenic
933623377 2:84570653-84570675 CAATCAGCACTCTGTAAAATGGG + Intronic
933948890 2:87311459-87311481 CACTAAGCAGTTTGCAAAATGGG + Intergenic
934631492 2:95929164-95929186 AAATAATCAATATGTAAAGTAGG + Intronic
934802541 2:97179819-97179841 AAATAATCAATATGTAAAGTAGG - Intronic
934802674 2:97181679-97181701 AAATAATCAATATGTAAAGTAGG - Intronic
934833526 2:97558891-97558913 AAATAATCAATATGTAAAGTAGG + Intronic
934833652 2:97560757-97560779 AAATAATCAATATGTAAAGTAGG + Intronic
936331309 2:111550137-111550159 CACTAAGCAGTTTGCAAAATGGG - Intergenic
937763319 2:125631440-125631462 CAATCAGCACTATGTAAAAATGG + Intergenic
937802685 2:126098680-126098702 CAATAACAAATGTGGAAAAAAGG + Intergenic
939139396 2:138335572-138335594 CCATAAGGAATAAAGAAAATGGG + Intergenic
939681491 2:145140366-145140388 TAATTAGCAATATGAAAAAATGG + Intergenic
941343869 2:164343218-164343240 CAATAAGGTACATGGAAGATAGG + Intergenic
941419959 2:165271505-165271527 CAATATAGACTATGGAAAATAGG + Intronic
941531227 2:166674103-166674125 CAATGAACAATTTGCAAAATTGG + Intergenic
942141646 2:172983456-172983478 AAAAAAGGAATATGGAAAAAGGG - Intronic
943027360 2:182646155-182646177 CATTAAGAATTAAGGAAAATGGG + Intergenic
943486776 2:188495036-188495058 AAATAAGCAATTTACAAAATAGG - Intronic
943855070 2:192778993-192779015 CAATCAGCATTCTGTAAAATGGG - Intergenic
943868377 2:192958806-192958828 CAATCAGCACTCTGTAAAATGGG - Intergenic
944207636 2:197173166-197173188 CTATAAGCAAAATGCAAAACAGG + Intronic
944211281 2:197208965-197208987 CATTAGGCTATCTGGAAAATAGG + Intronic
945174426 2:207028198-207028220 TAATAACCAATTTGGAAAATAGG + Intergenic
946132222 2:217615443-217615465 CAAAAAGCAATCTAGAAATTTGG + Intronic
946607507 2:221421694-221421716 CAATAAGTAATCTGGATAGTTGG - Intronic
948014228 2:234674664-234674686 TAAAAAGCAATATGGAAGAGAGG + Intergenic
1169647979 20:7834644-7834666 CAATCAGCAATCTGTAAAAATGG - Intergenic
1169750841 20:8992134-8992156 CAAAAATCAATATCCAAAATCGG + Intergenic
1170750956 20:19144574-19144596 CAGAAAGAAATCTGGAAAATCGG + Intergenic
1172155612 20:32821717-32821739 CAATAAGCCCTATGTAAAGTGGG - Intronic
1173972712 20:47164835-47164857 CAATGGGCAATATGTAAACTTGG - Intronic
1174725123 20:52853296-52853318 AAAAAATCAGTATGGAAAATAGG + Intergenic
1174871632 20:54188065-54188087 CTATACTCAAGATGGAAAATGGG - Intergenic
1177502785 21:21980411-21980433 CTATAATCAATGTGTAAAATAGG + Intergenic
1177547232 21:22574972-22574994 AAATAAGCATTATGGGAAATGGG + Intergenic
1178116827 21:29426475-29426497 AGAAAAGCAACATGGAAAATTGG - Intronic
1178185380 21:30213132-30213154 GAATCACCAATATGGAAAAAAGG + Intergenic
1178814125 21:35911945-35911967 CAAGAAGCAAGAAGGCAAATGGG + Intronic
1179055260 21:37925928-37925950 CAATAACCAATAGGGCAAAGGGG - Intergenic
1179485618 21:41708601-41708623 CAATAGCCACTTTGGAAAATAGG + Intergenic
1179938856 21:44625448-44625470 CAAAAAGAAATATTGATAATGGG + Intronic
1180879543 22:19194084-19194106 CAATCAGCACTCTGTAAAATGGG - Intronic
1181572967 22:23777818-23777840 CAATAAGCAAGCTCGGAAATGGG + Intronic
1182382101 22:29899529-29899551 CAATGATCAATATGAAGAATGGG - Intronic
1184540792 22:45122900-45122922 CAATAGGCTATATGGTTAATTGG - Intergenic
949362903 3:3250474-3250496 AAATAATCAATTTGTAAAATAGG + Intergenic
949660663 3:6275031-6275053 CAATAAGCCATCTGCAAAATGGG + Intergenic
949734492 3:7155892-7155914 TAACAAGCAATATGAATAATTGG - Intronic
950370456 3:12525126-12525148 CAATCAGACATATGGAGAATGGG - Intronic
950564512 3:13759492-13759514 CAAAAACCAAAATGGACAATTGG + Intergenic
951239982 3:20275880-20275902 CAATCAGCACTCTGTAAAATGGG + Intergenic
951751965 3:26046130-26046152 TATTAAGCAAAATGGAAACTTGG + Intergenic
953064759 3:39458814-39458836 CAATCAGCACTCTGTAAAATGGG - Intergenic
954231479 3:49221051-49221073 CAATCAGCACTCTGTAAAATGGG - Intronic
956271653 3:67454281-67454303 GAATAAATAATATGAAAAATTGG + Intronic
956900794 3:73713871-73713893 CAATAAGTACTGTGAAAAATGGG - Intergenic
956906343 3:73769721-73769743 CAAAAAGCAAAATGGGACATGGG + Intergenic
957150720 3:76482687-76482709 TATTAAGCAAAATGGAAAATTGG - Intronic
957214568 3:77302609-77302631 AAATAAGAAATCTGGAAATTTGG - Intronic
957601936 3:82347984-82348006 AAACAAGCAATATGAAAAACAGG + Intergenic
957813587 3:85261071-85261093 AGAAAAGCAATATGGAAATTAGG - Intronic
957862758 3:85977740-85977762 CATTAATCACTAGGGAAAATGGG - Intronic
958546562 3:95559481-95559503 CAATAATTAATTTGGGAAATTGG - Intergenic
958601026 3:96297759-96297781 CAATCAGCACTCTGTAAAATGGG + Intergenic
958766594 3:98376308-98376330 CAAGAAGAAATATATAAAATGGG - Intergenic
959802652 3:110513178-110513200 AAATAAGCATCATGGCAAATGGG - Intergenic
960389076 3:117054743-117054765 CAACAAGCCAAATGGAAAAAGGG + Intronic
960649182 3:119927290-119927312 CAAACAGTATTATGGAAAATGGG + Intronic
961619876 3:128215742-128215764 AGGTAAGCAATCTGGAAAATGGG - Intronic
962396941 3:135024295-135024317 AAATAAACAATATGGAAAGGAGG - Intronic
963020897 3:140872348-140872370 CAATCAGCACTCTGTAAAATGGG + Intergenic
963021746 3:140878584-140878606 CAATCAGCACTCTGTAAAATGGG + Intergenic
964321170 3:155498648-155498670 CAATAATCACTATGGAAATTTGG - Intronic
964474034 3:157082861-157082883 GAATCAGCAATGTGGAAACTGGG - Intergenic
965032344 3:163388582-163388604 CAACAAAGAATATGAAAAATAGG - Intergenic
965092353 3:164179949-164179971 CAATCAGCAATCTGTAAAATGGG + Intergenic
965175631 3:165327568-165327590 CAAAAGGCAGTATGGAAAAGTGG - Intergenic
965652480 3:170947951-170947973 CAATAAGCTCTCTGTAAAATGGG + Intergenic
966363283 3:179152724-179152746 CAGTCAGCAAAGTGGAAAATAGG - Intronic
966616815 3:181922132-181922154 CAATAAAAAATAAAGAAAATGGG + Intergenic
967311709 3:188112312-188112334 CAATAAGAAAGAAGGAACATGGG + Intergenic
967474321 3:189898278-189898300 CAAAATGCACTATGGAAACTCGG + Intergenic
969718841 4:8882016-8882038 GGAAAAGCAATCTGGAAAATTGG - Intergenic
971677210 4:29647329-29647351 CAATAAGCTCTATAGAAGATGGG + Intergenic
971874329 4:32285600-32285622 CAATAAGAAATAAGTAAAATTGG - Intergenic
972009832 4:34163981-34164003 TAATATGCATCATGGAAAATTGG - Intergenic
972115468 4:35627787-35627809 GGATATGCAATATGGACAATAGG + Intergenic
972427621 4:38949002-38949024 AAATAAGAGATATGGAAAAGAGG - Intergenic
972791325 4:42373951-42373973 CAATCAGCACTCTGTAAAATGGG - Intergenic
973787494 4:54347026-54347048 CTACAACCACTATGGAAAATGGG + Intergenic
973973958 4:56243712-56243734 AAATAAGCATCATGGAGAATGGG + Intronic
974155242 4:58063096-58063118 CAATCTGCAAAATGGAAAAATGG + Intergenic
974395604 4:61330813-61330835 CAATCAGCACTCTGTAAAATGGG - Intronic
974831402 4:67193674-67193696 CAATAAGAAATCTGCAAAATTGG + Intergenic
974919156 4:68216047-68216069 AGATAATCAATATGGAAAACGGG - Intergenic
975053615 4:69898737-69898759 AAATTAGCAGAATGGAAAATAGG + Intergenic
975405959 4:73989937-73989959 TATTAAACAATAGGGAAAATTGG - Intergenic
975630851 4:76400633-76400655 AAATAAGTATTATGGAAAACTGG + Intronic
976215653 4:82713212-82713234 AAATAAGCAATATGTATAAAAGG - Intronic
976284068 4:83354542-83354564 AAATAATCAATATGCAAAAGTGG + Intergenic
976316455 4:83664049-83664071 CAAAAAGCAACTTGTAAAATTGG + Intergenic
976588961 4:86830093-86830115 CAATAATAAATGTGGAAAAGGGG + Intronic
976829225 4:89294962-89294984 CAATAAGCACTATTGAAACTTGG + Intronic
977821610 4:101478452-101478474 CAATCAGCACTCTGTAAAATGGG + Intronic
978036158 4:103997796-103997818 AACTAACCAATTTGGAAAATAGG - Intergenic
978198227 4:105995208-105995230 CAGTAAGGAAAATGGAAAGTAGG - Intronic
978265700 4:106822063-106822085 CAATAATAAAAATGGAAAATTGG + Intergenic
979070601 4:116200141-116200163 TAATACGCAATCTGGAAAAGAGG - Intergenic
979212008 4:118116079-118116101 TAATAAGCAGCATGTAAAATTGG + Intronic
979420106 4:120493822-120493844 CAATCAGCACTCTGTAAAATGGG + Intergenic
979580344 4:122351418-122351440 TAATTAGCAAAATGGAAAGTTGG - Intronic
979953333 4:126922749-126922771 CAATAAGCACTCTGTAAAAATGG + Intergenic
980217394 4:129869999-129870021 CAATGAGCAAAAGGGAAAATGGG + Intergenic
980237430 4:130127514-130127536 CATCTAGCAATATGGAAGATAGG - Intergenic
980243206 4:130203070-130203092 CAATCAGCACTCTGTAAAATGGG - Intergenic
980680469 4:136153338-136153360 CTATAAGAAATCAGGAAAATAGG - Intergenic
980704090 4:136470014-136470036 AAATAACCAATTTGAAAAATGGG - Intergenic
980759618 4:137213445-137213467 TAATAAGCCACATGGAAATTTGG - Intergenic
981618833 4:146671117-146671139 CAAAAAGCAATAACAAAAATAGG - Intergenic
982544921 4:156722377-156722399 TAATGATCAATATGGAAAAAAGG + Intergenic
983014845 4:162600429-162600451 CAATCAGCAATCTGTAAAAACGG - Intergenic
983539564 4:168894722-168894744 CCATAAGGAAGATGGAAAAGGGG - Intronic
983736953 4:171073408-171073430 CAATCAGCACTCTGTAAAATCGG - Intergenic
984168873 4:176337115-176337137 CAATAAGACAAATAGAAAATGGG - Intergenic
984825294 4:183918949-183918971 GAATAAGTAACATGGAAACTCGG - Intronic
985313895 4:188633481-188633503 AATTAAGAAATAAGGAAAATGGG + Intergenic
985346016 4:189005184-189005206 CAAAAAGTAAAATAGAAAATGGG - Intergenic
986947770 5:13045565-13045587 CAAGAAGAAATAAGAAAAATTGG + Intergenic
987232098 5:15905498-15905520 AAATAATTAATATGGAAAAATGG + Intronic
987914474 5:24193506-24193528 CAATAAGCAAATGGGCAAATGGG - Intergenic
989312380 5:40035130-40035152 CATTAACCAATAAGGAAGATGGG - Intergenic
989719352 5:44505488-44505510 AAATAAGCAAGATGAAAAAAAGG - Intergenic
989952246 5:50313166-50313188 TATTAAGGAATGTGGAAAATTGG + Intergenic
993156351 5:84229574-84229596 CATTAAAGAATAAGGAAAATTGG - Intronic
993446470 5:88018477-88018499 CAATATGCAATATGCCAAAGTGG - Intergenic
994706522 5:103213427-103213449 CAATAAATAATATCTAAAATTGG - Intergenic
995539710 5:113172692-113172714 CAATATACAACAAGGAAAATTGG - Intronic
996391066 5:122962669-122962691 CAATTAGAAATATCAAAAATAGG + Intronic
996962147 5:129264034-129264056 CAATAAGAAATGGGGAATATGGG - Intergenic
997921443 5:137983071-137983093 AAATAAGCAATCTGAGAAATGGG + Intronic
999420636 5:151439352-151439374 CAATAAGAAATGTGTAAAACAGG + Intronic
999600710 5:153261004-153261026 GAATAAGCAATATTGCAAAGTGG + Intergenic
999661789 5:153871933-153871955 TAATTAACACTATGGAAAATGGG + Intergenic
1000170013 5:158693276-158693298 CAAATAGGAATATGGAAAATTGG - Intergenic
1000568692 5:162883338-162883360 CAATCAGCACTCTGTAAAATGGG + Intergenic
1001859555 5:175041665-175041687 CAATTACCAAAATGGAAAAGCGG - Intergenic
1002403588 5:179010535-179010557 AAATAATCAATATGCATAATAGG + Intergenic
1002415549 5:179119190-179119212 CAAGAAGCATCAGGGAAAATTGG - Intronic
1003251513 6:4432688-4432710 AAATGACCAGTATGGAAAATGGG - Intergenic
1004048901 6:12053905-12053927 CAATAAAGAATATGACAAATAGG + Intronic
1005577119 6:27200269-27200291 CACTAAGCTAAAGGGAAAATGGG - Intergenic
1005705263 6:28444918-28444940 CAATCAGCACTCTGTAAAATGGG - Intergenic
1007350152 6:41266731-41266753 CATTAAGCCAAATAGAAAATAGG - Intergenic
1008270928 6:49488692-49488714 CTGTAATCAATATGGTAAATAGG - Intronic
1010129958 6:72480256-72480278 CAATAAACAGTTGGGAAAATTGG + Intergenic
1010679094 6:78778991-78779013 CAAATGGCAATATGAAAAATAGG - Intergenic
1010858767 6:80878054-80878076 CAATCAGCACTATGTAAAAATGG - Intergenic
1011076748 6:83446580-83446602 CAAGAAGGACTAAGGAAAATAGG + Intergenic
1012165640 6:95947672-95947694 CAAGAAGTATTATTGAAAATGGG + Intergenic
1012357965 6:98339689-98339711 TAATAAGCTAAATGAAAAATGGG + Intergenic
1012412848 6:98979350-98979372 CAAATAGCAAAATGAAAAATGGG - Intergenic
1012714943 6:102656758-102656780 CAATGTGGAATATGGAGAATGGG - Intergenic
1013694321 6:112683177-112683199 GAATAAGCAAAATGAAACATTGG - Intergenic
1014599204 6:123388001-123388023 CCATAATCAATATGCAATATTGG - Intronic
1014931926 6:127345393-127345415 TAAAAAGAAAGATGGAAAATGGG - Intergenic
1016011667 6:139143529-139143551 CAAAAAGCAACATGTAAAAATGG + Intronic
1017376884 6:153781001-153781023 CAATAAACATTATCAAAAATTGG + Intergenic
1017612516 6:156204672-156204694 AAATAAGTAAACTGGAAAATAGG + Intergenic
1018073024 6:160182834-160182856 CAATAAGTAATCTTAAAAATTGG - Intronic
1018309877 6:162496844-162496866 GAATAAACAACATGGAAAATGGG - Intronic
1020210712 7:6156178-6156200 CCAAAAGCCATATGGAAAATAGG + Intronic
1020558879 7:9704085-9704107 CAAAAGGCAACATGGAATATGGG - Intergenic
1020674014 7:11157832-11157854 CAATCAGAGTTATGGAAAATGGG - Intronic
1021050207 7:15973765-15973787 CAGTAAACCATATGCAAAATAGG - Intergenic
1023027723 7:36065946-36065968 CAATCAGCACTCTGTAAAATGGG - Intergenic
1023231416 7:38033983-38034005 GAATAATAAAGATGGAAAATTGG - Intergenic
1023426315 7:40040540-40040562 CAATAAGTATTGTGAAAAATTGG + Intronic
1024196896 7:47067842-47067864 AAAAAAACAATATGGAAAAATGG + Intergenic
1024354728 7:48402931-48402953 CAATGAGTAAGATGGTAAATAGG + Intronic
1024491271 7:49988224-49988246 AAATAAATAATATGGAAATTTGG + Intronic
1024713894 7:52052353-52052375 AAATAAGTAAAATTGAAAATAGG - Intergenic
1024757588 7:52553584-52553606 CACTTAGAAATATGGATAATTGG - Intergenic
1026263521 7:68776395-68776417 AAATAATCAATATGCAAATTGGG - Intergenic
1027629172 7:80580939-80580961 CCATAATAAAAATGGAAAATGGG - Intronic
1027947480 7:84767353-84767375 CAATAAGAACTAGGGTAAATTGG + Intergenic
1027947527 7:84767671-84767693 AAATAAGAACTATGGTAAATTGG + Intergenic
1028041677 7:86061533-86061555 CAATAAGCACCATGTAAATTAGG + Intergenic
1028639100 7:93023087-93023109 CAATCAGCACTCTGTAAAATGGG - Intergenic
1028784584 7:94777499-94777521 CAATCAGCACTCTGTAAAATGGG + Intergenic
1028810501 7:95080737-95080759 AAATAATCAATATGCAAAAGAGG + Intronic
1030647691 7:112081773-112081795 CAAAAAGAAAGATGGTAAATTGG + Intronic
1031431854 7:121681425-121681447 CAGTCATCAATATGAAAAATAGG + Intergenic
1031805120 7:126298384-126298406 AAAAAAGGAAAATGGAAAATTGG + Intergenic
1032258905 7:130318734-130318756 CTATAAAGAATATGGAAGATGGG - Intronic
1032623186 7:133559122-133559144 CAATAAGAAGTATGGAAATATGG - Intronic
1032634957 7:133696504-133696526 CTATAAGCAATATGCAGATTGGG - Intronic
1032748504 7:134812380-134812402 GAATAAGCAGAATGCAAAATTGG + Intronic
1033032082 7:137837042-137837064 TAATAAGCAATATGCAAATATGG + Intronic
1033571617 7:142634685-142634707 CAAAAAGAAATATGGACAAAGGG + Intergenic
1036161199 8:6390068-6390090 CAATCAGCACTCTGTAAAATGGG + Intergenic
1038112256 8:24512579-24512601 CAAAAAAAAATATGGAAAAGGGG + Intronic
1038141255 8:24847910-24847932 CAGTGTGCAATATGGGAAATGGG - Intergenic
1038627111 8:29204867-29204889 CAAGAAACACGATGGAAAATAGG - Intronic
1038827256 8:31017925-31017947 CAAGAGGCAATAGGGTAAATTGG - Intronic
1039090184 8:33819641-33819663 CAATAGACAATATGTAAAATAGG + Intergenic
1039577519 8:38635541-38635563 CAACAAAAAATATTGAAAATTGG - Intergenic
1039641286 8:39225873-39225895 CAATAAGAAACATGAAAAACTGG + Intronic
1040526801 8:48232975-48232997 CAATCAGCACTCTGTAAAATGGG + Intergenic
1041370456 8:57154361-57154383 CAATAAGACATATGAAACATTGG - Intergenic
1041605427 8:59777639-59777661 CAATAACCAATCAGAAAAATGGG + Intergenic
1042317420 8:67438690-67438712 AAATAAGCAATATCCAAAGTGGG + Intronic
1042574872 8:70206658-70206680 CAGTAAGCAATATTGGAATTTGG - Intronic
1043470743 8:80559775-80559797 TCTTAAGCAATATGGAAAAATGG + Intergenic
1044098949 8:88105572-88105594 AAATAAGTTCTATGGAAAATTGG + Intronic
1044735575 8:95274958-95274980 CAAAAAACAATATGAAAAAGGGG - Intergenic
1045861832 8:106822184-106822206 CAATCAGCACTCTGTAAAATGGG - Intergenic
1046308532 8:112402063-112402085 TAATAAGCACTAAAGAAAATAGG - Intronic
1046330426 8:112707549-112707571 AAACAGGCAATTTGGAAAATTGG + Intronic
1046507837 8:115159026-115159048 CAATCAGCACTCTGTAAAATGGG - Intergenic
1046609280 8:116405975-116405997 CATTAAACAATTAGGAAAATGGG - Intergenic
1046743428 8:117852225-117852247 CAAAAAGCATTATGGAAAGGAGG - Intronic
1046920672 8:119724995-119725017 CAATATGCAAAATAAAAAATGGG - Intergenic
1047806561 8:128367104-128367126 CAAGAAGCTCTATGGATAATAGG - Intergenic
1049127691 8:140806958-140806980 AAATAAGCAATATAAATAATGGG - Intronic
1050699273 9:8319305-8319327 CAATAATTAATATGGAAATTTGG - Intronic
1051555295 9:18375822-18375844 CAATCAGCACTCTGTAAAATGGG - Intergenic
1051719638 9:20023081-20023103 CACTGAGCAATCTGAAAAATTGG + Intergenic
1051833539 9:21308893-21308915 CAATAAGAAATATGGCCATTGGG + Intergenic
1052102668 9:24468935-24468957 CAATGAAAAATATGGAAAACGGG - Intergenic
1052146552 9:25057532-25057554 CAATAAGCTACATGAAAGATAGG + Intergenic
1052884145 9:33626921-33626943 CAAAAAGAAATATGGACAAAGGG + Intergenic
1053017422 9:34670595-34670617 CAATAAGCAGTTTGGACAAGGGG + Intergenic
1055345312 9:75329623-75329645 GAATAAACAAAATGAAAAATTGG + Intergenic
1056246745 9:84703000-84703022 CAAACGGAAATATGGAAAATGGG + Intronic
1057516987 9:95729900-95729922 CAATCAGCACTCTGTAAAATGGG + Intergenic
1057625652 9:96673906-96673928 CAATCAGCACTCTGTAAAATGGG - Intergenic
1058265045 9:102888888-102888910 CAATCAGCACTCTGTAAAATGGG + Intergenic
1058330022 9:103749037-103749059 TAATAAGCAATATGTAATACAGG + Intergenic
1059690960 9:116686131-116686153 CAATTAGAAATTTAGAAAATGGG + Intronic
1059724012 9:116988320-116988342 CATTGAGCAACATGAAAAATGGG + Intronic
1060032975 9:120231664-120231686 CAGTGAGCAAGGTGGAAAATGGG + Intergenic
1061433093 9:130543519-130543541 CAATAAGAAGGTTGGAAAATGGG + Intergenic
1061863597 9:133480089-133480111 CAATAGCAAATATGCAAAATAGG - Intergenic
1186469147 X:9807702-9807724 CTACAAGCAATGTGGAAAACAGG - Intronic
1186839260 X:13468823-13468845 CTTAAAGCAATGTGGAAAATGGG + Intergenic
1187038119 X:15564100-15564122 CAATCAGCCATATGGAAACAGGG + Exonic
1187396504 X:18923963-18923985 CAACAATTAATATGAAAAATGGG + Intronic
1187542147 X:20207307-20207329 CATTAAGCAATTTAGAAACTTGG - Intronic
1188056300 X:25544609-25544631 CAATAAGCAATTTTTAAAAGAGG - Intergenic
1188198654 X:27272037-27272059 CAATAAGCAATATATAATATTGG - Intergenic
1188710558 X:33392313-33392335 GGATAAGCAACATGGAAAAGAGG - Intergenic
1189488283 X:41449435-41449457 AAATAAGCAATAAAAAAAATTGG + Intronic
1189588455 X:42486300-42486322 CAATGAGCAATCTGGAAGAAAGG + Intergenic
1189737308 X:44084855-44084877 CAATAGGCAAAAAGGAAAATAGG + Intergenic
1189809647 X:44769368-44769390 CAATAAGCATTATGGGACTTTGG - Intergenic
1191262757 X:58344978-58345000 CAATAAGCAGTTTGGAAACACGG + Intergenic
1191942460 X:66496136-66496158 TAATAATCATAATGGAAAATGGG + Intergenic
1192300992 X:69902535-69902557 CAACATGCAATATTTAAAATTGG - Intronic
1193466746 X:81857578-81857600 ATATTAGCAATAGGGAAAATTGG + Intergenic
1193784124 X:85738140-85738162 CAACAAAATATATGGAAAATTGG + Intergenic
1194086374 X:89533202-89533224 CAATCAGCACTCTGTAAAATGGG + Intergenic
1194093717 X:89609563-89609585 CAATAATCAATTTACAAAATGGG + Intergenic
1194250131 X:91564156-91564178 CAATCAGCACTCTGTAAAATGGG + Intergenic
1194497052 X:94629574-94629596 TAAGAAGCAATATTGCAAATTGG + Intergenic
1195642687 X:107194062-107194084 AAATAAGAAAGATGGAAAAGGGG + Intronic
1195850584 X:109277990-109278012 CAATCAGCAGTCTGTAAAATGGG - Intergenic
1196274376 X:113749769-113749791 TAAAAAGCAATAAGGAAAGTAGG + Intergenic
1196405891 X:115362248-115362270 CAATCAGCACTCTGTAAAATGGG + Intergenic
1196415574 X:115467439-115467461 CTATAAGCTATGTGGAACATGGG + Intergenic
1196681173 X:118471500-118471522 CAATCAGCACTCTGTAAAATGGG + Intergenic
1200308055 X:155048358-155048380 CAATTATCAGTATGGAAAAAAGG - Intronic
1200439036 Y:3189080-3189102 CAATCAGCACTCTGTAAAATGGG + Intergenic
1200446347 Y:3265691-3265713 CAATAATCAATTTACAAAATGGG + Intergenic
1200569095 Y:4805405-4805427 CAATCAGCACTCTGTAAAATGGG + Intergenic
1201985708 Y:19962516-19962538 CAATAAGCACTCTGTAAAAAAGG - Intergenic