ID: 922194564

View in Genome Browser
Species Human (GRCh38)
Location 1:223348836-223348858
Sequence GCTTTCAGCAGAATCTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 8, 3: 59, 4: 391}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922194564_922194567 28 Left 922194564 1:223348836-223348858 CCATCTGAGATTCTGCTGAAAGC 0: 1
1: 0
2: 8
3: 59
4: 391
Right 922194567 1:223348887-223348909 ACAAGTCTTCATACATGTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922194564 Original CRISPR GCTTTCAGCAGAATCTCAGA TGG (reversed) Intronic
901841279 1:11955492-11955514 GCTTTCATCAGATTCTCAAAAGG - Intronic
902253034 1:15168312-15168334 GCTTTCATCAGATTCTCAAAGGG + Intronic
902289633 1:15427712-15427734 CCTTTCAGCAGGTTCTCAGATGG + Intronic
902638484 1:17750851-17750873 GCTTCCACCAGGTTCTCAGATGG + Intergenic
902806593 1:18865045-18865067 GCTGTCGTCAGAATCTCAAAAGG - Intronic
902912766 1:19612766-19612788 GATTTTAGCAGGCTCTCAGAAGG + Intronic
904099538 1:28012697-28012719 GCTTTCCTCAGAATCTTAAAGGG + Intronic
904601188 1:31673384-31673406 GCTTCCATCAAACTCTCAGAGGG - Intronic
904653100 1:32021369-32021391 GCTTCCATCAAATTCTCAGAGGG + Intronic
904928324 1:34065902-34065924 GCTGTCATCAGAAGTTCAGAGGG + Intronic
905158337 1:36008021-36008043 GCTTACATCAGATTCTCAAAGGG + Intronic
906105920 1:43292397-43292419 GCATTCATCAGCTTCTCAGAAGG - Intergenic
908098049 1:60761157-60761179 ACTTTCAGCAGTATCAGAGATGG - Intergenic
908470451 1:64438844-64438866 GCTGTCATCAGATTTTCAGAGGG + Intergenic
908994897 1:70139808-70139830 AGTTTCAGCATAATCTGAGAAGG - Intronic
911926492 1:103838663-103838685 ATTTTCAGCAAAATATCAGAAGG + Intergenic
912230452 1:107786920-107786942 GCTTTCATCATACTCTCAAAGGG - Intronic
913588746 1:120302415-120302437 GCTCTCAGCAGGATTTCAAAAGG - Intergenic
913619439 1:120595954-120595976 GCTCTCAGCAGGATTTCAAAAGG + Intergenic
914570769 1:148914286-148914308 GCTCTCAGCAGGATTTCAAAAGG - Intronic
914602061 1:149215977-149215999 GCTCTCAGCAGGATTTCAAAAGG + Intergenic
915392840 1:155560269-155560291 TCTTTCATCAGATTCTCAAAAGG + Intronic
916063552 1:161118393-161118415 CCTTTCACCAGAATCTCGCAGGG - Intronic
916571532 1:166032427-166032449 GCTTTCAGCAGATCCTCCAAAGG - Intergenic
917599681 1:176561686-176561708 GCTTTCATCAGATTTTCAAAAGG - Intronic
917928427 1:179807551-179807573 GCTTCCAGCAGCAGCACAGAGGG + Intronic
918073126 1:181148407-181148429 ACATACAGCAGAATCTGAGAGGG + Intergenic
918095744 1:181332773-181332795 GCTTTCATCAGATTTTCAAAGGG - Intergenic
920180276 1:204128160-204128182 GCTTTCATTAGAGTCTCAAAGGG - Intergenic
920761887 1:208791889-208791911 GCTTCCAGAAGACTCTAAGATGG + Intergenic
921407833 1:214800092-214800114 GCAATCAGCAGATTGTCAGAAGG + Intergenic
922166835 1:223122735-223122757 GCTATCATCAGAGTCTCAAATGG - Intronic
922194564 1:223348836-223348858 GCTTTCAGCAGAATCTCAGATGG - Intronic
922926925 1:229356046-229356068 CATTTCAGCAGAATGTGAGAAGG + Intergenic
923592523 1:235331659-235331681 GCTTTCATCATATTCTCAAAAGG + Intronic
924387519 1:243513011-243513033 GCTTTCATCAGATCCTCAAAGGG + Intronic
924580861 1:245323280-245323302 TCTTTCAACAGTCTCTCAGAAGG + Intronic
1062900247 10:1138462-1138484 GCTTTCAGCTGAAGATGAGAAGG + Intergenic
1063757927 10:9036787-9036809 CCTTTCATTAGAATCCCAGAAGG + Intergenic
1064090988 10:12384330-12384352 CCTTTCTGCAGAAACTGAGATGG + Intronic
1064869883 10:19925546-19925568 ACTTTCTCAAGAATCTCAGATGG + Intronic
1065144600 10:22755519-22755541 GCTGTCATCAGAATCTCAAAGGG + Intergenic
1066790803 10:39061062-39061084 TCTTTTAGGAGAATCTGAGAAGG - Intergenic
1066792230 10:39078455-39078477 TCTTTCTGGAGAATCTGAGAAGG + Intergenic
1066811378 10:39341462-39341484 TCTTTCAGCAGAATCTGCAAAGG - Intergenic
1067482289 10:46610262-46610284 GCTTTCAACAAATCCTCAGAGGG - Intergenic
1067612460 10:47731406-47731428 GCTTTCAACAAATCCTCAGAGGG + Intergenic
1068125831 10:52840841-52840863 GCCTTCAACAGAATCACAGCAGG - Intergenic
1068711194 10:60135887-60135909 ACTTTTATCAGAATCTCAGATGG + Intronic
1068877712 10:62014734-62014756 GCTTTCATCTGATTCTCAAAGGG - Intronic
1069886325 10:71626222-71626244 GGCTTCACCAGACTCTCAGAAGG + Intronic
1069953375 10:72034866-72034888 GCTTCCATTAGAATCTCAAAGGG + Intergenic
1071627879 10:87191653-87191675 GCTTTCAACAAATCCTCAGAGGG + Intergenic
1072446666 10:95504768-95504790 GCTTTCATCAGAGTCTCAAAGGG + Intronic
1072734663 10:97870921-97870943 GCTTTCAGCAGATTCTCAAAGGG + Exonic
1072902413 10:99420097-99420119 GCTTTTAGCAGATTTTCAAAAGG - Intronic
1073482968 10:103798561-103798583 GCTTCCATCAGATTCACAGAGGG + Intronic
1073594442 10:104785836-104785858 ACTTTCACCAGATTCTCAAAGGG - Intronic
1074483500 10:113851097-113851119 CCTTTGAGTAGACTCTCAGATGG - Intronic
1074778950 10:116786462-116786484 GCTTTTGTCAGAATCTCAAAGGG + Intergenic
1075027042 10:118992921-118992943 GCTTTCATCAGATTCACAAAGGG - Intergenic
1076607832 10:131700861-131700883 GCATCCAGCAGACTCTCAAATGG - Intergenic
1077886072 11:6389298-6389320 TTTTTCAGCAGAATTTCAGAGGG - Intergenic
1078834106 11:15009748-15009770 GCTTTTATCAGAATGTCAGATGG + Intronic
1079624589 11:22600737-22600759 GCTTTCAGCAGATTTTCAAATGG - Intergenic
1080568669 11:33536093-33536115 GCTTTAATCAGATTCTCAAAAGG - Intergenic
1080920579 11:36705066-36705088 GCTTTCATCAGATTCTGAAAGGG + Intergenic
1081083114 11:38768138-38768160 GCTTTTAGCAGATCTTCAGAAGG + Intergenic
1081635418 11:44718350-44718372 GCTTTTCCCAGAGTCTCAGAGGG - Intergenic
1082282575 11:50286210-50286232 ACTTTTATCAGAATGTCAGATGG - Intergenic
1082310897 11:50647049-50647071 TCTTTCTGTAGAATCTGAGAAGG + Intergenic
1082940744 11:58703095-58703117 GCATTTAGCAGATTGTCAGAGGG - Intronic
1084026351 11:66452531-66452553 ACTTTAATCAGTATCTCAGATGG + Intronic
1084664117 11:70567048-70567070 GCATTCAGCAGCAGCTCAGAGGG - Intronic
1085189137 11:74602663-74602685 CCTTTCAGAAGGATCTGAGAAGG - Intronic
1087015785 11:93553313-93553335 GCTTTGATCAGATTCTCAAAGGG + Intergenic
1087663929 11:101020169-101020191 GCTCTCATCAGCTTCTCAGAGGG - Intergenic
1087916015 11:103811800-103811822 TCTTTGAGCAGAAACCCAGATGG + Intergenic
1088346150 11:108828229-108828251 GGGTACACCAGAATCTCAGAAGG - Intronic
1088433412 11:109783324-109783346 GCTTTCATCAGATTCTCAAAGGG - Intergenic
1088525799 11:110752930-110752952 CCTTTAAGCATAATCTCACAGGG - Intergenic
1088603943 11:111511580-111511602 GCTTCCAGCTGAATTTCACAAGG + Intronic
1088625905 11:111730367-111730389 GCCTTCACCAAAATCTCTGAAGG + Exonic
1089059419 11:115614220-115614242 CCTGTCAGGGGAATCTCAGATGG + Intergenic
1090926361 11:131254015-131254037 AGTTTCAGCAGCATCACAGAAGG - Intergenic
1091010871 11:131999140-131999162 GCTTTCAGGAGAGGCTCTGAGGG + Intronic
1091566303 12:1651000-1651022 GCTTTCAGCAGAATATCAGGAGG + Intergenic
1092436521 12:8451565-8451587 GCTTTAATCAGAATCTCACATGG + Intergenic
1092694843 12:11159788-11159810 GTTTTCATCACAATTTCAGAAGG + Intronic
1092872006 12:12813571-12813593 GTTTTCCCCAGAATTTCAGAGGG + Intronic
1094775665 12:33724346-33724368 GCTTTCACCAGATTCTCACTAGG - Intergenic
1094827363 12:34280512-34280534 TCTTTAAGTAGAATCTCTGAAGG - Intergenic
1095079490 12:37981469-37981491 GCTTTTTGTAGAATCTCTGAAGG + Intergenic
1095511422 12:42955020-42955042 GCTCTTAGCAGAATCTTAGATGG + Intergenic
1096055478 12:48647575-48647597 GATTTAATCAGAATCTCAGAGGG + Intergenic
1097746464 12:63309389-63309411 GCTTTCAAGAGATTCTCAAAGGG - Intergenic
1097942867 12:65331552-65331574 GCTTTCCCCAGCATCCCAGAGGG - Intronic
1099544423 12:83959653-83959675 GCTTTCATCAGATTCTTAAAGGG + Intergenic
1101109968 12:101476402-101476424 GCTTTTGCCAGATTCTCAGAAGG + Intronic
1101339813 12:103832958-103832980 GCTTTCTCCAGATTCTCAGTGGG + Intronic
1101556655 12:105816517-105816539 GCGTTCAGCAGAGCCTAAGATGG + Intergenic
1101603438 12:106230193-106230215 GTTTTCAGCATATTCACAGAAGG - Intergenic
1102067928 12:109994424-109994446 GCATTCAACAGAATCTCAAAGGG + Intronic
1102760152 12:115377699-115377721 GCTTTCATCAGATTTTCAAAGGG - Intergenic
1103334232 12:120177270-120177292 GCTTTCAACATAATCGCAAAAGG + Intronic
1104040930 12:125130139-125130161 GCTTTCTGCAGTCTCTCAAAAGG + Intronic
1106597481 13:31158999-31159021 GCTTTCATCAGATACTCAAAGGG + Intronic
1107918491 13:45178134-45178156 TGTTTCATCAGAATCTCAGGAGG - Intronic
1108204893 13:48078484-48078506 GGTTTCACCAGAATCCCAAAGGG + Intronic
1110472804 13:75878948-75878970 GTTTTCAGAAAAATATCAGAGGG + Intronic
1110477910 13:75939524-75939546 GCCTTCAGTAGAAACTCAGTTGG - Intergenic
1112372338 13:98804733-98804755 ATTTTCATCAGATTCTCAGAAGG + Intronic
1112675040 13:101691295-101691317 TCTTTCACCAGATTCTCAAAGGG + Intronic
1113760722 13:112844567-112844589 CCTATCAGCAGAATCACAAAAGG + Intronic
1114502742 14:23183210-23183232 CCTTTCAGCAGAATTCCAGCCGG - Exonic
1114603592 14:23976831-23976853 ACTTTCAGCAAAATATCACAAGG + Intronic
1114608602 14:24019605-24019627 ACTTTCAGCAAAATATCACAAGG + Intergenic
1115351773 14:32403195-32403217 GCTGTCAACAGAATCACAAAGGG + Intronic
1116613888 14:47109073-47109095 ACTTGCTGCAGAATCCCAGAGGG + Intronic
1116822613 14:49640168-49640190 GCTTTCATTAGATTCTCTGAGGG + Intergenic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1117197486 14:53354769-53354791 GCTTACAGAGGAATCTAAGAAGG + Intergenic
1117527937 14:56630364-56630386 CATTTCATCAGAGTCTCAGAAGG - Intronic
1117825974 14:59704127-59704149 ACTTTCATCAGACTCTCAGTGGG - Intronic
1119167932 14:72511425-72511447 TCTCTCAGCAGACTCTCACAGGG - Intronic
1119712540 14:76832770-76832792 AGTTTCACCAGCATCTCAGATGG + Intronic
1121343820 14:93120625-93120647 GCTTTCAACAAACTCTCAAAGGG + Intergenic
1121573661 14:94966146-94966168 GCTTTCTGGAGCATCTCTGAGGG + Intergenic
1124884020 15:33667722-33667744 GGTTTCACCAGACTGTCAGAGGG + Intronic
1125389504 15:39176771-39176793 GCTTGCAGTAAAATATCAGATGG - Intergenic
1126149395 15:45508980-45509002 GCTTTCATCAGAATTCCAAAGGG + Intronic
1126834586 15:52646870-52646892 GCATTCAGCACATTCTCAAAAGG + Intronic
1127284876 15:57523700-57523722 GCTTTCACCAGACCCTCAGAGGG - Intronic
1127488386 15:59439564-59439586 GCTTTAAGTAGAAAGTCAGAAGG - Intronic
1128209526 15:65885571-65885593 GCTTTCAGCAAACCTTCAGAGGG - Intronic
1128896451 15:71377919-71377941 GCTTTCAGAAGAGTCACTGAAGG - Intronic
1129695322 15:77737707-77737729 GCTCTCAGCAGCATCTGACATGG + Intronic
1131018218 15:89075363-89075385 GCTTGCAGCAGAGTCTCAAAGGG + Intergenic
1131405509 15:92160996-92161018 GATCTCATCAAAATCTCAGAGGG + Intronic
1131972629 15:97907402-97907424 GCTATCAGTAGAATATCACAGGG - Intergenic
1132265295 15:100465066-100465088 GCTTCCAGACAAATCTCAGATGG + Intronic
1132335253 15:101044289-101044311 CCTCTCAGCAGACTCTGAGAAGG + Intronic
1132951792 16:2566976-2566998 ACTTTCAGCAACATCTCCGATGG - Intronic
1132962558 16:2633194-2633216 ACTTTCAGCAACATCTCCGATGG + Intergenic
1132995580 16:2820773-2820795 GCCCTCAGCAGCATCACAGAAGG - Intronic
1133033654 16:3023189-3023211 GCCTTCTGCAGAATCACAGGCGG - Intronic
1133807369 16:9135733-9135755 GTTGTCAGCAGATTCTCAAAGGG - Intergenic
1134378869 16:13705453-13705475 TATTTCATCAGATTCTCAGAAGG + Intergenic
1134828712 16:17305977-17305999 GTTCTCAGCAGGTTCTCAGAGGG - Intronic
1134850767 16:17476875-17476897 GATTTCAGCAGAAGCACAGCTGG - Intergenic
1136490327 16:30603908-30603930 GCAATCAGGAGAATCTCATAGGG - Exonic
1136584974 16:31178896-31178918 CCTTTCAGCGGGATTTCAGAAGG - Intergenic
1136743729 16:32564120-32564142 TCTTTCTGGAGAATCTGAGAAGG + Intergenic
1136745981 16:32591673-32591695 TCTTTTTGCAGAATCTGAGAAGG + Intergenic
1137364306 16:47847492-47847514 TTTTTCAGCAGAACTTCAGAGGG + Intergenic
1138094228 16:54199591-54199613 GCTGCCAGCAGAATCTCATCAGG - Intergenic
1138556706 16:57775150-57775172 GCTCTGTCCAGAATCTCAGAGGG + Intronic
1139955478 16:70691108-70691130 GCTTTCCTCAGAATCTCCCACGG - Intronic
1140049891 16:71471187-71471209 GCCTGAAGCAGAATGTCAGAAGG + Intronic
1140341337 16:74166737-74166759 TCTTTCTGCAGAAGCTCAGCTGG - Intergenic
1140422688 16:74833699-74833721 ACTTGCATCAGATTCTCAGAAGG + Intergenic
1141135483 16:81462278-81462300 GCTTTCAGCACATTTTCAAAGGG - Intronic
1141288611 16:82696128-82696150 GATTTCATCAGAGTCCCAGAAGG - Intronic
1142143789 16:88484224-88484246 GGTTTCATCAGATTCCCAGAGGG + Intronic
1203025870 16_KI270728v1_random:511113-511135 TCTTTCTGGAGAATCTGAGAAGG - Intergenic
1203045851 16_KI270728v1_random:823318-823340 TCTTTCTGGAGAATCTGAGAAGG + Intergenic
1203048109 16_KI270728v1_random:850878-850900 TCTTTTTGCAGAATCTGAGAAGG + Intergenic
1143000784 17:3793846-3793868 GCTTCCATCAGATTCTCAAAGGG - Intronic
1144369999 17:14581156-14581178 TCTTTCTGCAACATCTCAGATGG - Intergenic
1145412347 17:22679852-22679874 ACTTTTAGTAGAATCTAAGAAGG - Intergenic
1145412611 17:22684210-22684232 TCTTTTAGTAGAATCTAAGAGGG - Intergenic
1146121399 17:30198793-30198815 GCCTTCAACAGAATCTCTGCTGG + Intronic
1147760370 17:42794173-42794195 GCTTTCATCATATTCTCAAATGG - Intronic
1147864181 17:43542177-43542199 GCTTTTATCAGATTCTCAAAGGG - Intronic
1148008009 17:44449836-44449858 GCTTTCAGCAGAATCACCTTGGG - Intronic
1148154120 17:45412844-45412866 ACTTCCATCAGAATCTCAGAGGG - Intronic
1148212236 17:45815518-45815540 GCTTTCATTAGATTCTCAAAGGG - Intronic
1148508294 17:48146038-48146060 ACTTTCATCAGATTCTCAAAGGG + Intronic
1149610078 17:57953652-57953674 GCTTTCACCAGATTCTCAAAGGG + Intronic
1151379341 17:73714168-73714190 GCTTTCATCAGATTCTCAAAGGG + Intergenic
1152083332 17:78202454-78202476 GCTGTCAGCACAAGCTCAGGTGG - Intronic
1152581759 17:81168451-81168473 GGTTCCAGCGAAATCTCAGAGGG - Intergenic
1153229684 18:2924028-2924050 GCTTTCAGAAGCACCTCAGTGGG - Intronic
1153767301 18:8386459-8386481 GCCTTCAGCAGCATCTGACATGG - Intronic
1153888689 18:9492216-9492238 GCTTTTTGCAGAATGTCATATGG + Intronic
1156645668 18:39159528-39159550 TCTTTTACCAAAATCTCAGAGGG + Intergenic
1156960070 18:43016925-43016947 GCTTTAAGCAGAATCTGCCATGG + Intronic
1157959092 18:52132335-52132357 ACTTTCAGCAGGTGCTCAGAAGG - Intergenic
1157970065 18:52256994-52257016 GCTTTCAGTTGAGTTTCAGATGG - Intergenic
1158380327 18:56922680-56922702 GCTTTCATCAGATTCTTAAAGGG + Intronic
1158448250 18:57539958-57539980 GCTCTCAGCAGCCTCCCAGAGGG - Intergenic
1159759132 18:72402834-72402856 GCTTCCAGTAAGATCTCAGAAGG - Intergenic
1164102151 19:22065920-22065942 ATTTTCAGCAGAATTTCATAAGG - Intronic
1164337726 19:24347009-24347031 TGTTTTTGCAGAATCTCAGAAGG + Intergenic
1164363150 19:27541153-27541175 TCTTTTAGTAGAATCTGAGAAGG + Intergenic
1165599106 19:37037650-37037672 ACTTTCCGGAGACTCTCAGAAGG + Intronic
1166112938 19:40634220-40634242 GCTTTCGACAGATTCTCAAAGGG - Intergenic
925803684 2:7627616-7627638 GCATACAGCAGAAACACAGATGG - Intergenic
927615004 2:24584718-24584740 GCTTTAAGCAGACTCTCAAAGGG - Intronic
927839350 2:26429143-26429165 GGTTTCAGAAGAGTCTTAGAAGG - Intronic
928061435 2:28117234-28117256 GCCTTCATCAGAACCTCAAAGGG - Intronic
928719362 2:34101362-34101384 GCTGTCAGGAGAATCTCTGTGGG + Intergenic
929159583 2:38818124-38818146 GCTTTCATCAGCTTTTCAGAGGG - Intronic
929974482 2:46618255-46618277 GTTTTCATCAGATTATCAGAGGG - Intronic
930026503 2:47032259-47032281 GCTTTCAGCAGATTCTCAAAGGG + Intronic
930661145 2:54054436-54054458 TCTGTCAGCAGAATATCACAAGG - Intronic
931106193 2:59059036-59059058 GTTTTCAGCAGAATATTAGTTGG - Intergenic
931879154 2:66548692-66548714 GCTTTCAGCACATTCACAAAGGG - Intronic
932089397 2:68791550-68791572 GCTTTCATCAGATTCTCCAAGGG - Intronic
933002328 2:76941059-76941081 TCTTTCAACAGAATATGAGAAGG + Intronic
933049149 2:77580425-77580447 GCCTTCAGCAGAAATCCAGAAGG + Intronic
933228684 2:79780483-79780505 CTTTTCCTCAGAATCTCAGAGGG - Intronic
935665170 2:105505614-105505636 TCTTTCAGAAGAATGACAGAAGG - Intergenic
937126052 2:119475782-119475804 GCTTTCATCTGATTTTCAGAAGG + Intronic
937581132 2:123489353-123489375 GTTTGCTGCAGAATCACAGAAGG + Intergenic
937686384 2:124702619-124702641 AAGTTCAGCAGAATTTCAGAAGG + Intronic
937709754 2:124966234-124966256 GCTTTCAACAGCATCACTGAAGG + Intergenic
939608029 2:144275804-144275826 GTTTTTATCAGAATCTCAGGTGG - Intronic
940041318 2:149364090-149364112 GATTTCAGCAGCTTTTCAGAAGG + Intronic
940343847 2:152609088-152609110 AATTTCAGCAGAAACTCAAATGG - Intronic
941591829 2:167429604-167429626 GCTTTTATCAGAAACTCATATGG - Intergenic
941828753 2:169930193-169930215 GCTATCATCAGAATCTCTGTGGG + Intronic
941931697 2:170947098-170947120 GCTTTCATCAGATTCTCAAAGGG - Intronic
942195053 2:173508846-173508868 GTTTTCATCAGATTCTCACAGGG - Intergenic
942341026 2:174947278-174947300 GCTTTCATCAGAGTTTCAAAGGG + Intronic
942763504 2:179427692-179427714 ACTTTCAGCAGGTTCTCAAAGGG + Intergenic
942983648 2:182112713-182112735 GTTTTCAGCAGAATCTCAGTGGG - Intronic
945364681 2:208937326-208937348 GCTCTAAGCAGAGTCTCTGATGG - Intergenic
947332926 2:229048968-229048990 ACTTTCATCAGATTCTCAAAGGG + Intronic
947685283 2:232078415-232078437 GCTTTCATCTGATTCTCAGAGGG + Intronic
948485638 2:238279158-238279180 GTTTTCAGCAGAGTCCCAGCAGG + Intronic
948619100 2:239222638-239222660 GATTGTAGCAGCATCTCAGACGG - Intronic
948619735 2:239226936-239226958 TGTTTCAGCAGAATCTTGGAGGG - Intronic
1169812460 20:9622038-9622060 GCTAGAAGCAGAACCTCAGATGG - Intronic
1169879374 20:10329597-10329619 TCTTTCAGCAGTAGCACAGATGG - Intergenic
1170099915 20:12687596-12687618 ACTTTCAGCAGAATGTGTGAGGG - Intergenic
1170818889 20:19739416-19739438 GCCTTTGGCAGAATCACAGAGGG - Intergenic
1171389924 20:24794814-24794836 GCTTTCTCCAGAATCTCTGCCGG - Intergenic
1171542150 20:25969212-25969234 TCTTTTAGTAGAATCTAAGAGGG - Intergenic
1171798874 20:29590695-29590717 TCTTTTAGTAGAATCTAAGAGGG + Intergenic
1172749221 20:37238162-37238184 GTTTTTATCAGAATCCCAGAAGG + Intronic
1172938203 20:38636004-38636026 GGTGACAGCAGAAGCTCAGAGGG + Intronic
1172952257 20:38729641-38729663 GCTTCCACCAAATTCTCAGATGG - Intergenic
1172955852 20:38758226-38758248 TCTTTCAGCAGATACTCAGTAGG + Intronic
1173059102 20:39644904-39644926 GCTTTTAGCAGATTCTCTAAGGG + Intergenic
1173063494 20:39684442-39684464 GCATGCATCAGAATCACAGATGG - Intergenic
1173118125 20:40265476-40265498 GCTTTCAACAGACTATCAAATGG + Intergenic
1174217010 20:48923408-48923430 GCTTTCATCAGATTTTCAGAGGG + Intronic
1174526241 20:51174096-51174118 GGCTTTAGCAGAAACTCAGATGG + Intergenic
1174640700 20:52041458-52041480 GCTTTCATCAGATTCTCAGTAGG + Intergenic
1174874445 20:54211765-54211787 GCTTTCACCAGATTCTCAAAGGG - Intronic
1175364297 20:58441233-58441255 GCTTTCATGAGAGTCTCAAAAGG + Intronic
1175586604 20:60146145-60146167 GCTTTCCCCAGAGTTTCAGATGG + Intergenic
1178530446 21:33371453-33371475 TTTTTCAGCAAAACCTCAGAGGG + Intergenic
1179223082 21:39426889-39426911 CCTTTCATCAGAGTCTCAAAAGG - Intronic
1179410931 21:41162671-41162693 GCTTTCAGGAGCATATCAGTTGG - Intergenic
1182450882 22:30420262-30420284 GCTTTCATCAGATTCTCAAGGGG + Intronic
1182573608 22:31258015-31258037 GCTTTTATCAAATTCTCAGAGGG + Intronic
1183615201 22:38940178-38940200 GCTTTCTCCAGAATCTCAGGTGG + Intergenic
1183615917 22:38945288-38945310 TCTTTCAGCAAAACTTCAGAGGG - Intergenic
951681270 3:25297192-25297214 GCTTTCATCATATTCTCAAATGG + Intronic
951695593 3:25442794-25442816 GATTTTTGCAGAATCTCAGTGGG + Intronic
952943127 3:38458292-38458314 GCTTTCATCAGATTCTCAGAGGG - Intronic
953434112 3:42865134-42865156 GCTTCCAGCAGAACCTCCTAGGG + Exonic
954461233 3:50628138-50628160 GCTTTCAGAAGAATGACAGCTGG - Intronic
955020661 3:55117855-55117877 GCTTTCATCAGATTCTCAATAGG - Intergenic
955925324 3:63998736-63998758 GCTTTCATAAGAATCTCAAAGGG + Intronic
955957481 3:64305378-64305400 GCTTCCAAAAGAATCTAAGAGGG + Intronic
955988611 3:64601397-64601419 GTTATCAGCACAATCTCTGAGGG - Intronic
956211788 3:66809146-66809168 GCTTTCAGGAGAATGACACATGG - Intergenic
956260516 3:67335703-67335725 GCAGTCAGCAGATTGTCAGAGGG - Intergenic
956629880 3:71305785-71305807 GCTTTCAGGAGGCGCTCAGAAGG + Intronic
957510909 3:81186510-81186532 ACTTTCAGGAGAATCCAAGAGGG + Intergenic
959241893 3:103807857-103807879 GCTTTCAACAGATCTTCAGAGGG + Intergenic
960161786 3:114357634-114357656 GCTTTCATCAAAATCTCAAAGGG + Intronic
960259120 3:115545511-115545533 GCTTTTATCAGATTCTCAAATGG - Intergenic
960263139 3:115590782-115590804 GCTCTCACCAGAAACTCAGAAGG - Intergenic
961100958 3:124198745-124198767 GCTTTCATCAGATTCTGAAAGGG + Intronic
961139848 3:124546683-124546705 CCTTTCAGCTGCATCTAAGATGG - Intronic
961658035 3:128453933-128453955 GCCTCCATCAGCATCTCAGAGGG - Intergenic
963543757 3:146628546-146628568 GCTTTTATCAGATTCTCAAAGGG + Intergenic
964320416 3:155490651-155490673 GCTTTTAACATAAACTCAGATGG + Intronic
965208813 3:165758125-165758147 TCTTACATCAGAATCTCAAAGGG - Intergenic
967529002 3:190528038-190528060 GCTTTAAGAATAATTTCAGAAGG + Intronic
969242054 4:5905755-5905777 GCTTTCAGGAGCCTCTCAAAGGG + Intronic
969453473 4:7287943-7287965 GCTGTCAGAAGAGGCTCAGAGGG - Intronic
970164196 4:13219061-13219083 GCTTTCAGCTGAAACACAGAAGG + Intergenic
970480093 4:16463898-16463920 AATTTCATCTGAATCTCAGAAGG + Intergenic
970686279 4:18571200-18571222 GCTTCCTGCAGATTCTCAGTTGG - Intergenic
972356841 4:38287286-38287308 GCATTCAGCGGCATCTCAGGAGG + Intergenic
974125240 4:57688000-57688022 GCTGTCAGCTGGATCTCAGTGGG + Intergenic
974725210 4:65789933-65789955 CCTTTGCTCAGAATCTCAGAGGG - Intergenic
975474451 4:74807175-74807197 GCTTTCAGCAGGTGGTCAGAAGG - Intergenic
976256362 4:83104702-83104724 GTTTTCAGCAGAAACCTAGAAGG + Intronic
976351091 4:84060508-84060530 ACTTTCAGCAAAGTCTCACAGGG + Intergenic
976658603 4:87515629-87515651 ACTTTCAGGAGAACCTCAGCTGG + Intronic
976660100 4:87532091-87532113 GCTTTCATCAGATTCTCAAAGGG - Intergenic
977779231 4:100960742-100960764 CCTTTAAGAAGAATCTAAGAAGG + Intergenic
978580198 4:110224235-110224257 TCTTTTAGCAGAGTATCAGAGGG - Intergenic
978646950 4:110945548-110945570 GCTTTCACCAGATTCACAGGAGG - Intergenic
981311521 4:143302344-143302366 GCTTTCTTCAGAATCTCAAAAGG + Intergenic
981362394 4:143862793-143862815 GCAGGCAGCAGAATCTGAGATGG + Intergenic
981373124 4:143983562-143983584 GCAGGCAGCAGAATCTGAGATGG + Intergenic
981382219 4:144086836-144086858 GCAGGCAGCAGAATCTGAGATGG + Intergenic
981466174 4:145075511-145075533 ACTTTAAGCAGACTGTCAGAAGG + Intronic
981619068 4:146673383-146673405 CCCTTCAGCAGAAGCTTAGAGGG - Intergenic
983293892 4:165840936-165840958 TCTTTCAGCAGAAATACAGAAGG + Intergenic
983670207 4:170228326-170228348 TTTTTCATCAGATTCTCAGAAGG - Intergenic
983672220 4:170251117-170251139 GGTTTCACCAGACTTTCAGACGG - Intergenic
984016487 4:174432993-174433015 TCTTTCAGGAGAATCTCCCATGG - Intergenic
984716409 4:182929692-182929714 GCTACCAGCAGATTCTCAAAAGG - Intergenic
986561754 5:9067184-9067206 ACTCTCAGGAGAAGCTCAGAAGG - Intronic
987249973 5:16089995-16090017 GCATGCATCAGAACCTCAGAGGG + Intronic
988089761 5:26522307-26522329 GCTTTCAGAAAACTCTCACATGG - Intergenic
988205996 5:28135200-28135222 TCTTTCAGCAAAACTTCAGAGGG + Intergenic
988460633 5:31433935-31433957 GCTTTCATTAGATTCTCAAAGGG + Intronic
988696309 5:33625983-33626005 GCCTTCAGCAGAATCAGAGGTGG + Intronic
988734511 5:34007432-34007454 GCTTTCATTAGATTCTCACAGGG + Intronic
990987619 5:61655447-61655469 GCTTTCATCAGATTCTCTGTGGG + Intronic
991228113 5:64296575-64296597 GCTTTCAGAAGAATCTCAGTAGG + Intronic
991537822 5:67692251-67692273 GGATTCAGTAGAATGTCAGATGG - Intergenic
992077370 5:73203797-73203819 GCTTTCACTAGAGTCTCAAAAGG + Intergenic
992192638 5:74309001-74309023 GTTTTCAGCAAAACCTCAGAGGG - Intergenic
992263019 5:74989733-74989755 TTTTTCAGCAGAACTTCAGAGGG - Intergenic
993507949 5:88734225-88734247 GCTGTCAGCTGAAGGTCAGATGG + Intronic
994211537 5:97092264-97092286 GCTTTTATCAGATTCTCAAAGGG + Exonic
995830922 5:116355020-116355042 GGTTTAAGATGAATCTCAGAAGG + Intronic
996086328 5:119309405-119309427 GCTTTCATCAGATTCTCAAAAGG - Intronic
999046134 5:148471835-148471857 GATTTCATCAGACTCTCAAAAGG + Intronic
999069001 5:148723318-148723340 GTGTTCATCAGAATCTCTGATGG + Intergenic
1000200533 5:159005748-159005770 GCTTTTATCAAATTCTCAGAAGG - Intronic
1000465659 5:161572930-161572952 GTTTTCAACAGAGTCTCAAAGGG + Intronic
1000836756 5:166164587-166164609 GGTTTTAGCAGACTCTTAGAAGG - Intergenic
1001205231 5:169756105-169756127 GCTGTCACCTGAGTCTCAGAGGG - Intronic
1001435848 5:171698741-171698763 CCTTCCCACAGAATCTCAGAGGG - Intergenic
1001902437 5:175443507-175443529 ATTTTCAGCTGAGTCTCAGAAGG - Exonic
1002354945 5:178619654-178619676 GCTTTCAGCAGATTTTCAAAGGG - Intronic
1002773382 6:308105-308127 GCTTTAAGAAGAACCCCAGAAGG - Intronic
1003291507 6:4782706-4782728 GCTTTCATCTGATTCTCAGAGGG + Intronic
1004338668 6:14787686-14787708 GCTTTCAGCAAATTCTCAAATGG - Intergenic
1004381693 6:15138123-15138145 TCTTTCAGCAGAGTCTATGAAGG + Intergenic
1004717923 6:18236676-18236698 GCTTTCAACAGATTCTCAAAGGG + Intronic
1005844246 6:29765330-29765352 ACTTAAAGCAGAAACTCAGATGG - Intergenic
1005862194 6:29910451-29910473 ACTTAAAGCAGAAACTCAGATGG - Intergenic
1007287322 6:40757045-40757067 GCTTTCAGCAGGATCTAACCTGG + Intergenic
1007290439 6:40782198-40782220 GCTTGCATCAGTTTCTCAGACGG - Intergenic
1007864387 6:44952344-44952366 GTTTTCATCAGATTCTCAAAGGG + Intronic
1008226553 6:48925392-48925414 GCTTTTGACACAATCTCAGAAGG - Intergenic
1010021537 6:71165307-71165329 GCTTTCACCAGATTCACAGGAGG + Intergenic
1010483037 6:76377802-76377824 CCTCTCAGCAGAAACTCAGAAGG - Intergenic
1011643632 6:89437116-89437138 GCTTTCATCAGATTCTCAAATGG + Intronic
1012947543 6:105483949-105483971 GCTTTTATCAGATTCTCAAAGGG - Intergenic
1013087083 6:106866008-106866030 TTTTTCAGCAAAATTTCAGAGGG - Intergenic
1013539647 6:111095283-111095305 CATTTCATCAGAATCTCACAAGG - Intronic
1014819972 6:125977276-125977298 GCTTTTTGCAGAATGTCATATGG + Intronic
1015038658 6:128689628-128689650 GATTTCAGGAGAAAATCAGAGGG + Intergenic
1015281107 6:131434513-131434535 TCTTTCAGCACAAGCTCACATGG - Intergenic
1015906445 6:138122223-138122245 GGTGTCATCAGACTCTCAGAGGG - Intergenic
1016124223 6:140379959-140379981 GGACTCAGGAGAATCTCAGAGGG + Intergenic
1017523569 6:155223062-155223084 GCTTTCCTCAGATTCTCAAATGG - Intronic
1018090320 6:160340914-160340936 GTTTACAGTAGCATCTCAGATGG + Intergenic
1018417799 6:163616284-163616306 GCTTCCATGAGAATCTCAAAGGG - Intergenic
1019849941 7:3544884-3544906 GCTATCAGCAGCATCTGAGATGG - Intronic
1020533437 7:9363962-9363984 GCAATCAGCAGATTGTCAGAAGG - Intergenic
1020750810 7:12139169-12139191 GCCTTCAGCTCAATGTCAGAAGG + Intergenic
1020777810 7:12477330-12477352 GTGTTCATCAGAATCTCAAATGG + Intergenic
1021271940 7:18599521-18599543 GCCTTCTGCAGAATGTCATAGGG + Intronic
1021867891 7:24977346-24977368 GTTTACAGCCCAATCTCAGATGG + Intronic
1022071063 7:26914795-26914817 GTTTTCATCAGATTCTCAAAGGG - Intronic
1022437289 7:30401129-30401151 ACTTTCATCAAAACCTCAGAAGG - Intronic
1022481282 7:30744711-30744733 ACTTTCATCAGATTTTCAGAGGG + Intronic
1022963925 7:35455479-35455501 GTTTTCATCAGATTCTCAAAAGG - Intergenic
1023103558 7:36742588-36742610 GCTTTCATCAGATTCTCAAAGGG - Intergenic
1023809857 7:43903661-43903683 GCTTTCAACAGATTTTCAAAGGG - Intronic
1024064572 7:45721720-45721742 GATTTCAGCAGGAGTTCAGAGGG + Exonic
1024066941 7:45746256-45746278 ACTTTTATCAGAATGTCAGATGG - Intergenic
1025293603 7:57755537-57755559 TCTTTTAGTAGAATCTAAGAGGG - Intergenic
1025523784 7:61777930-61777952 CCTTTCAGCAGGATCTGTGAAGG - Intergenic
1025547143 7:62190133-62190155 CCTTTCAGCAGGATCTGTGAAGG - Intergenic
1025586287 7:62792518-62792540 TGTTTCAGCAGAATCTGCGAAGG + Intergenic
1025952152 7:66153723-66153745 GATTTCAGCTGAAGCTCAGATGG - Exonic
1026207882 7:68273961-68273983 GCTTTCAGCTGCACCTCAGCTGG - Intergenic
1026364207 7:69631195-69631217 GCTTTCATCAGATTCTCCAAGGG + Intronic
1026878158 7:73891581-73891603 GGTTTCAGCAGAAGCTGAGTAGG - Intergenic
1029016395 7:97319199-97319221 GCTTTCTGTAGAATATCAAATGG - Intergenic
1029295682 7:99538618-99538640 GATTTCAACAGAGTCTAAGAAGG - Intergenic
1029670405 7:102026496-102026518 GCTTTCCTCAGATTCTCAGAAGG + Intronic
1030322012 7:108179114-108179136 GCTGTCATCAGATTCTCAAAAGG - Intronic
1030351350 7:108491352-108491374 GCTTTCACCAGACCTTCAGATGG + Intronic
1030825665 7:114154842-114154864 ATTTTCCCCAGAATCTCAGAGGG - Intronic
1031559934 7:123226265-123226287 GGTGACAGCAGCATCTCAGATGG - Intergenic
1031560306 7:123230507-123230529 GCTTTCACCAGATTCCCAGGAGG - Intergenic
1032324175 7:130911214-130911236 GCTTCCATCATAATCTCAAAGGG + Intergenic
1032987278 7:137352102-137352124 TCCTGAAGCAGAATCTCAGAGGG - Intergenic
1033475273 7:141686371-141686393 GCTTTCATCAGATTCTCAATGGG - Intronic
1033769212 7:144529779-144529801 GCTCTCAGCAGAATCACAAAAGG + Intronic
1034423288 7:151000209-151000231 GCTTTCATCAGATTCTCAAAGGG + Intronic
1034491848 7:151397041-151397063 GCTTTGCACAGAACCTCAGAAGG + Intronic
1035664080 8:1367347-1367369 GTTTTCAGCAGAATCTTAAAAGG - Intergenic
1035942438 8:3917241-3917263 GCATTCAACAGCATCTCATAGGG - Intronic
1036966952 8:13309711-13309733 ACTTCCAGGAGAACCTCAGATGG + Intronic
1038387056 8:27158477-27158499 GCTTTCATCAGATTTTCAAAAGG + Intergenic
1039517164 8:38143841-38143863 GCACAAAGCAGAATCTCAGAGGG - Exonic
1039994200 8:42517524-42517546 GCTTTCATCAGATTTTCAAAGGG - Intronic
1040327037 8:46352541-46352563 TCTTTCTGTAGAATCTAAGAAGG - Intergenic
1040344839 8:46481687-46481709 TCTTTCTGCAGAATCTGTGAAGG - Intergenic
1040497050 8:47975092-47975114 ACTTTCATCAGATTCTCAAAGGG - Intronic
1040548530 8:48420751-48420773 GCTGTCAGCAGCATCCCAGGAGG + Intergenic
1041063892 8:54062287-54062309 GCTTTCACCAGATTCACAGGAGG - Exonic
1042041028 8:64588812-64588834 CCTTTCATCAAAATCTTAGATGG - Intronic
1045255927 8:100521429-100521451 GCTTTCAGCAGTATGTTTGAAGG - Intronic
1045357820 8:101404918-101404940 GCCTTCAACAGAATCACAGCAGG - Intergenic
1046635434 8:116670171-116670193 GCTTTCACCAAATTCTCAAAGGG + Intronic
1046660263 8:116940857-116940879 ACTTTCATCAGATTCTCAGAGGG + Intronic
1046872223 8:119216155-119216177 CCTTTCATCAGAATCACAAAGGG - Intronic
1047237438 8:123054248-123054270 GCATTCAGCTGAAGCTCAGCTGG - Intronic
1048152895 8:131911035-131911057 GCTTTCATCAGATTCTCAAAAGG - Intronic
1050699373 9:8320620-8320642 ACTTTCAACAGATTCTCACAGGG + Intronic
1050773411 9:9232820-9232842 GCTTCAAGAAGAATGTCAGAAGG - Intronic
1051858112 9:21592934-21592956 GATTTCCACAGAATCTCAAAAGG - Intergenic
1052472811 9:28921575-28921597 GTTTTCTGCATAGTCTCAGATGG - Intergenic
1054162887 9:61689978-61690000 TCTTTTAGTAGAATCTAAGAGGG + Intergenic
1054873727 9:70073969-70073991 GCTTTCATCAGATTCTCAAAAGG - Intronic
1055232023 9:74077678-74077700 ACTATCAGCAGATTGTCAGAAGG - Intergenic
1055746594 9:79453585-79453607 GCTTTCAACAAAATATCACAAGG - Intergenic
1056263274 9:84870760-84870782 GCTTACAGCATAATATCACATGG + Intronic
1056628577 9:88274293-88274315 GCTTTCATCAGAATCTCAAAAGG + Intergenic
1056674400 9:88662016-88662038 GCCTTCAGCAGAATCTCCTAAGG + Intergenic
1057431601 9:94999858-94999880 GCCTTCATTAGAATCTCAGAGGG + Intronic
1057997263 9:99829259-99829281 GCTTTCAGCAGAGTCTTAAAAGG + Intronic
1059160356 9:112028853-112028875 GCTAACGGCAGAACCTCAGAAGG - Intergenic
1059914314 9:119082034-119082056 CCTTTCTGGAAAATCTCAGAAGG + Intergenic
1060059591 9:120447264-120447286 GCTTTCTTCAGATTCTCAAAGGG + Intronic
1186060359 X:5698830-5698852 GCTCTCAGGAGAAACTCAGATGG - Intergenic
1187036811 X:15549265-15549287 GCTTTCATCAGATTCCCAAAAGG + Intronic
1187851250 X:23593535-23593557 GCTTTCAGCAGAGTGGGAGAGGG - Intergenic
1189810278 X:44774938-44774960 GTTTTCATCAGATTCTCAAAGGG + Intergenic
1191238992 X:58164394-58164416 TCTTTCTGTAGAATCTAAGAAGG + Intergenic
1191240115 X:58181558-58181580 TCTTTTTGCAGAATCTAAGAAGG + Intergenic
1191585443 X:62821347-62821369 TCTTTCTGTAGAATGTCAGATGG - Intergenic
1192438704 X:71158940-71158962 GCTTTCATCAGAATCTCAAAAGG - Intronic
1192470533 X:71395027-71395049 GCTTTCAGAAGACCCTCAGAAGG + Intronic
1192867526 X:75151101-75151123 GCTTTGATCAGATTCTCAAAGGG + Intronic
1194026920 X:88764189-88764211 GCAATCAGCAGATTGTCAGAGGG - Intergenic
1195334822 X:103842112-103842134 GCTTTCATCAGATTCTCAAAGGG + Intergenic
1195740354 X:108059059-108059081 GCTTTCATCAGGTTCTCAAAAGG + Intronic
1195959118 X:110367074-110367096 GCATTCAGTGGAATCCCAGATGG - Intronic
1196129017 X:112132463-112132485 GCCTTCTTCAGAATCTCAAAGGG - Intergenic
1196273315 X:113737231-113737253 GATTTCATCAGAATTTCATAGGG - Intergenic
1196292745 X:113962481-113962503 GCTTTCATCAGCAGCTAAGAAGG + Intergenic
1196841940 X:119867060-119867082 GCATTCAGCAGATTCTTAAAAGG - Intergenic
1197271605 X:124430262-124430284 GCTTTCATCAGATTCTCAAATGG - Intronic
1197662057 X:129184912-129184934 GCTTTTAGAAGATTCTCAGATGG - Intergenic
1199609102 X:149598580-149598602 GCATCCAGCAGAATCCCAAAAGG - Intronic
1199630017 X:149770777-149770799 GCATCCAGCAGAATCCCAAAAGG + Intergenic
1201775078 Y:17653566-17653588 CCTTTAAGTAGAATCTCTGAAGG - Intergenic
1201775408 Y:17658651-17658673 CCTTTTTGCAGAATCTCTGAAGG - Intergenic
1201826148 Y:18247338-18247360 CCTTTTTGCAGAATCTCTGAAGG + Intergenic
1201826478 Y:18252423-18252445 CCTTTAAGTAGAATCTCTGAAGG + Intergenic