ID: 922196802

View in Genome Browser
Species Human (GRCh38)
Location 1:223365425-223365447
Sequence GATGATTTAGTAGCTGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922196802_922196805 19 Left 922196802 1:223365425-223365447 CCTGATACAGCTACTAAATCATC 0: 1
1: 0
2: 1
3: 12
4: 96
Right 922196805 1:223365467-223365489 CCCAAAATCTCACATACTGATGG 0: 1
1: 0
2: 1
3: 22
4: 170
922196802_922196807 26 Left 922196802 1:223365425-223365447 CCTGATACAGCTACTAAATCATC 0: 1
1: 0
2: 1
3: 12
4: 96
Right 922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 113
922196802_922196808 27 Left 922196802 1:223365425-223365447 CCTGATACAGCTACTAAATCATC 0: 1
1: 0
2: 1
3: 12
4: 96
Right 922196808 1:223365475-223365497 CTCACATACTGATGGTAGTTGGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922196802 Original CRISPR GATGATTTAGTAGCTGTATC AGG (reversed) Intergenic
902596906 1:17515935-17515957 TTTGATTTAGAAGCAGTATCTGG - Intergenic
902662098 1:17912020-17912042 AATGATTTATTTGCTGAATCAGG + Intergenic
913122987 1:115758815-115758837 GAAGATTGGGTATCTGTATCTGG - Intronic
916249841 1:162726390-162726412 GATGATGCAGTAGATGTATTTGG - Intronic
916819844 1:168387462-168387484 GATGATTAAGTTGCTTTTTCGGG - Intergenic
917669504 1:177259414-177259436 GCTGATTTAGAAGCTGCAGCAGG + Intronic
918457803 1:184742320-184742342 CAGAATTTAGTAGCTGTATGTGG - Intronic
919524837 1:198634473-198634495 AATGATTTAGTAGTTGTAACAGG + Intergenic
920585792 1:207158906-207158928 AAAGCTTTAGTAGCTGTACCTGG - Intergenic
922196802 1:223365425-223365447 GATGATTTAGTAGCTGTATCAGG - Intergenic
1064731205 10:18332387-18332409 GAGGAATTAGTAGCTCTTTCGGG + Intronic
1068434047 10:56968174-56968196 GAGCATTTAGTAGCTGTAATAGG + Intergenic
1069270491 10:66520616-66520638 GATGACTTCCTTGCTGTATCTGG - Exonic
1070542626 10:77427484-77427506 ACTGATTCAGTATCTGTATCTGG - Intronic
1072627938 10:97126044-97126066 GCTATTTTAGTAGCTGTCTCTGG + Intronic
1078917550 11:15794174-15794196 GATGAGTTAGTAGCAGTCTACGG - Intergenic
1079591320 11:22186420-22186442 CAAGATTGAGCAGCTGTATCTGG - Intergenic
1084160634 11:67347719-67347741 GGTGGTATAGTAGATGTATCAGG + Intronic
1088782065 11:113145404-113145426 AATGATTTAGTATTTGTTTCTGG + Intronic
1089360923 11:117885911-117885933 GCTGATTTAGTGCCTGGATCTGG - Intergenic
1090134876 11:124186898-124186920 AACAATTTAGTAGCTTTATCAGG + Intergenic
1092623527 12:10300822-10300844 GCTGATATAGAAGCTGTAGCAGG - Intergenic
1093220772 12:16417828-16417850 GATGTTTTAGTAGTTGTGTTTGG - Intronic
1095870678 12:47024190-47024212 GTTCATTGAATAGCTGTATCAGG + Intergenic
1098944086 12:76571400-76571422 GGTGATTCAGAAGCTGTATCTGG - Intergenic
1099874031 12:88382628-88382650 TATGATTTAGTTTCTGTTTCAGG + Intergenic
1100164452 12:91900735-91900757 GATGATTTAGGTATTGTATCTGG + Intergenic
1102640735 12:114364184-114364206 GATGCTTTGGTAGCTTTTTCTGG - Intronic
1102800860 12:115732470-115732492 GATGATTTTCAAGCTGTATCTGG - Intergenic
1107549381 13:41460492-41460514 GATGATTTATTAGCTGGAATGGG + Intronic
1108516470 13:51207782-51207804 CAAGATTTAGGGGCTGTATCTGG - Intergenic
1109788070 13:67208169-67208191 GATGAAATATTAGCAGTATCTGG - Intronic
1110316762 13:74117236-74117258 GCTGATTTGGTAGCTGTGGCAGG + Intronic
1112085510 13:96027581-96027603 GATGAGTCAGTAGCTGTCTGTGG - Intronic
1115202885 14:30873169-30873191 AATGACTTAGTATTTGTATCAGG - Intergenic
1119578372 14:75750457-75750479 GAAGATCTAGTTGCTGTCTCGGG - Intronic
1122002001 14:98666431-98666453 GAAAATTTAGTGGCTGTTTCAGG + Intergenic
1124478251 15:30055385-30055407 GAGGATTTAGTAACTTTCTCAGG + Intergenic
1128053480 15:64683084-64683106 GATGATTTGGTAGCTTTATTGGG + Exonic
1138227172 16:55305926-55305948 GATGATCTATTAGTTGAATCCGG + Intergenic
1138404971 16:56784714-56784736 CATGCTTTATTAGCTGTTTCAGG + Intronic
1139248921 16:65475955-65475977 GATGACTTAGTAGCCAAATCAGG - Intergenic
1141651557 16:85395739-85395761 GATGATTTAGGAGCTGTTCTGGG - Intergenic
1144594562 17:16557662-16557684 CATGATTGAGGAGCTGTCTCAGG - Intronic
1155848685 18:30743234-30743256 CAAGATTTGGCAGCTGTATCTGG + Intergenic
1156593433 18:38518279-38518301 GATAATGTAGTTCCTGTATCTGG + Intergenic
1158074185 18:53509705-53509727 GATGATTTATTATCTATAACAGG + Intronic
926540859 2:14179393-14179415 GTTTATTTACTAGCTGTGTCTGG + Intergenic
927326005 2:21806118-21806140 GTTGAATTAGTTGATGTATCAGG + Intergenic
928308896 2:30193745-30193767 GATGACTTGGTAGCTGCATCGGG - Intergenic
929698185 2:44138176-44138198 GCTGATTTAGTATCTCTATGGGG + Intergenic
931953248 2:67389035-67389057 GATGATTTAGAAGCCATAACAGG + Intergenic
931986667 2:67748656-67748678 GATGATTTCTTAGCTGTATCTGG + Intergenic
934955147 2:98610988-98611010 GATCATTTAGTAACTCTACCTGG - Intronic
939466709 2:142565805-142565827 AATGAAATAGTAGCTGTGTCAGG - Intergenic
941214787 2:162692918-162692940 GATTATTTAGAAGGTGTATCTGG - Intronic
1172669487 20:36625078-36625100 GATGATTTCATACCTGTGTCTGG - Intronic
1174094908 20:48080627-48080649 AAAGATTTGGTAGCTATATCTGG + Intergenic
1174677426 20:52371923-52371945 GGTGATTGAGGAGCTGTATGAGG - Intergenic
1178478802 21:32961217-32961239 AATAATTATGTAGCTGTATCAGG - Intergenic
1182409794 22:30173909-30173931 GCTGATTTGGTAGCAGTATTTGG - Intronic
951666920 3:25136707-25136729 GATGATTTAATAGGTGTAGTAGG + Intergenic
951980989 3:28566741-28566763 GATGAGTTAGAAGGTGCATCTGG - Intergenic
953051270 3:39346241-39346263 AATGAGGTAGTAGCTGAATCAGG + Intergenic
963964959 3:151357203-151357225 GTTCATTTAGTAACTGTAACAGG - Exonic
964433667 3:156630670-156630692 GATTATTTAGTAGCTACATGAGG - Intergenic
964641116 3:158911550-158911572 GATAATTTACTAGCTGAATAAGG - Intergenic
964968791 3:162533528-162533550 AATTATTTAGGAGCTGTATAAGG + Intergenic
968019007 3:195367198-195367220 GCTGAATTAGGAGCTGTGTCTGG - Intronic
971703871 4:30014072-30014094 GATGACTGACTAGCTGTATCTGG - Intergenic
972037799 4:34548541-34548563 GTTGTTTTAGTAGCTGCATTAGG + Intergenic
972224728 4:36999423-36999445 GATGATTTAGAATCTGAATCAGG - Intergenic
973735520 4:53867661-53867683 GATTATTTAATAAATGTATCAGG + Intronic
975628553 4:76375500-76375522 GATGATTTAGTAGCACTGGCTGG - Intronic
975686461 4:76920637-76920659 GCTGATATAGAAGCTGTAGCGGG - Intergenic
978094501 4:104759054-104759076 GATGAGATAGGAGCTGTTTCAGG - Intergenic
979467846 4:121060962-121060984 GATGAGTGAGTAGATGTACCAGG + Intronic
980917451 4:139047042-139047064 GGTTATTTAGAAGCTGTATGTGG + Intronic
982495247 4:156083275-156083297 CAAGATTTAGGAGCTGCATCTGG - Intergenic
983367222 4:166808240-166808262 GTTGATTTAGTAGCTGATTTTGG + Intronic
984360682 4:178727521-178727543 GCTCATATAGTATCTGTATCTGG + Intergenic
984445368 4:179829868-179829890 GAAGAGTGAGTTGCTGTATCTGG + Intergenic
989074896 5:37554163-37554185 CATGACTTAGTAGCTGTCTTTGG - Intronic
999034918 5:148337123-148337145 CATGATTTAGTAGCTGTGAGAGG + Intronic
1000461341 5:161522727-161522749 CATGAGTGAGTAGGTGTATCAGG + Intronic
1003895113 6:10600054-10600076 CATGATTTAGCAGCTGAACCTGG + Intronic
1009642622 6:66357686-66357708 GATGACTTATCATCTGTATCAGG + Intergenic
1012727540 6:102834266-102834288 GAAGATTTTGTGGCTGTATTAGG - Intergenic
1016597420 6:145816963-145816985 GATGTTTTAGTATGTGTATTAGG + Intergenic
1020641234 7:10756422-10756444 TATAATTTAGATGCTGTATCTGG - Intergenic
1022054159 7:26711935-26711957 GATGTTTTAGTGGCAGAATCAGG + Intronic
1026487486 7:70833974-70833996 AATCATTTAGTAGCTGGCTCAGG + Intergenic
1028626137 7:92879975-92879997 GATGGATTAGTAGATGTATCTGG + Intergenic
1030723135 7:112893336-112893358 GATGATTTAGAAGCTGCAGCAGG - Intronic
1036243065 8:7095148-7095170 GATGTTTTAGTAGATAAATCGGG + Intergenic
1036685806 8:10909258-10909280 GAAGATTGAGAAGCTGCATCTGG - Intronic
1037333789 8:17772041-17772063 AATGATTTAGAAGCAGAATCAGG + Intronic
1040724293 8:50363144-50363166 GATGATTTAGTCGCTAAATCTGG - Intronic
1042740551 8:72039758-72039780 GATGATTGAGAAGCTCTATGCGG + Exonic
1047625849 8:126655339-126655361 GATGAAATATTAGCTGCATCTGG - Intergenic
1048578921 8:135714991-135715013 TGTGATTTAGTAGCTGTTTCTGG - Intergenic
1050494581 9:6227669-6227691 GAAGATTTAGTAGCATTATAAGG - Intronic
1051002435 9:12300819-12300841 AATGTTTTATTAGCTATATCTGG - Intergenic
1051592440 9:18790102-18790124 AATCATTTATTAGCTTTATCTGG + Intronic
1187005650 X:15230551-15230573 GATGATTTAGAATCTCAATCAGG - Intergenic
1188627192 X:32299149-32299171 CTTGATTCAGTAGCTGTACCAGG - Intronic
1194570965 X:95554222-95554244 GATTGTTTACTAGCTGTATGAGG - Intergenic
1194643942 X:96435125-96435147 AATGAATTAGAAGATGTATCTGG + Intergenic
1201862233 Y:18611531-18611553 GAGGGTTAAGTAGCTGTCTCAGG - Intergenic
1201871090 Y:18708849-18708871 GAGGGTTAAGTAGCTGTCTCAGG + Intergenic