ID: 922196803

View in Genome Browser
Species Human (GRCh38)
Location 1:223365447-223365469
Sequence GGGAAAGTCGATAGAAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922196803_922196805 -3 Left 922196803 1:223365447-223365469 CCTTTGCTTCTATCGACTTTCCC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 922196805 1:223365467-223365489 CCCAAAATCTCACATACTGATGG 0: 1
1: 0
2: 1
3: 22
4: 170
922196803_922196807 4 Left 922196803 1:223365447-223365469 CCTTTGCTTCTATCGACTTTCCC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 113
922196803_922196808 5 Left 922196803 1:223365447-223365469 CCTTTGCTTCTATCGACTTTCCC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 922196808 1:223365475-223365497 CTCACATACTGATGGTAGTTGGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922196803 Original CRISPR GGGAAAGTCGATAGAAGCAA AGG (reversed) Intergenic
904159164 1:28509893-28509915 GGAAAAATCGATGGTAGCAACGG + Intronic
905695913 1:39973363-39973385 GTGAAACTGGAGAGAAGCAAGGG - Intergenic
906245878 1:44273811-44273833 GGGAAAGGCGATGTAAGAAAAGG + Intronic
906381094 1:45332577-45332599 GCCAAAGGCGATAGAGGCAATGG + Exonic
907060507 1:51418308-51418330 GGCAAAGTCAATGGAAGCAAAGG + Intronic
907133275 1:52116414-52116436 GGGAAAGTGCATAGAAGCACTGG - Intergenic
907805114 1:57811047-57811069 GGGAGATTTGATAGAAGAAAAGG - Intronic
908988473 1:70055449-70055471 GTGAAAGTCAATGGAAACAATGG + Intronic
912375069 1:109203235-109203257 GGGAAACAAGATACAAGCAAGGG - Intronic
920865484 1:209748692-209748714 GGGAAAGGCTTTAGAAGAAACGG + Intergenic
922196803 1:223365447-223365469 GGGAAAGTCGATAGAAGCAAAGG - Intergenic
923048735 1:230375042-230375064 GGGAAATTCCAAAGAAGAAAGGG - Intronic
924178936 1:241421960-241421982 GGGAAGGTGGTTAGAACCAAGGG - Intergenic
924904979 1:248442475-248442497 GGAAAAGTCGAGAGAAGTCAGGG - Intergenic
924922906 1:248649568-248649590 GGAAAAGTCGAGAGAAGTCAGGG + Intergenic
1066094601 10:32060087-32060109 GGGAAAGGAGGTAGAAGGAAGGG + Intergenic
1075963002 10:126585427-126585449 GGGAAAATGGAAAGAAGGAAAGG + Intronic
1079126902 11:17723623-17723645 GGGGAACGCCATAGAAGCAAAGG + Intergenic
1079344852 11:19642964-19642986 AGCCAAGTCAATAGAAGCAAAGG - Intronic
1083740300 11:64706728-64706750 GGGGAAGTCGTTTGAAGCAAAGG - Intronic
1084163974 11:67366619-67366641 GGGAAAGAAGGGAGAAGCAAGGG + Intronic
1085385540 11:76155892-76155914 GGGAAAATCCACAGAAGCAAGGG + Intergenic
1087770001 11:102198345-102198367 GGGAAACTGGTGAGAAGCAAAGG + Intronic
1088827345 11:113507045-113507067 GGGAAAGAGAATAGAAGCACTGG + Intergenic
1089070977 11:115699450-115699472 GGGAAAGACAAGAAAAGCAAAGG - Intergenic
1089963014 11:122632480-122632502 GGGAAACAGGATATAAGCAAAGG + Intergenic
1091388142 12:108122-108144 AGGAAACTCTATAGAAGCTAGGG - Intronic
1092031987 12:5294044-5294066 GGGGAGGTGGCTAGAAGCAAAGG + Intergenic
1094677423 12:32634620-32634642 TGGAAAGTCTATAGAAGAATAGG + Intronic
1097726953 12:63086425-63086447 AGGAAGGTCTATAGCAGCAAGGG - Intergenic
1098689924 12:73474091-73474113 AGGAAATTGGATATAAGCAAAGG + Intergenic
1098812037 12:75106801-75106823 GAGAAAGCAGATATAAGCAATGG + Intronic
1099432983 12:82610215-82610237 GGAAAAGGTGATAGAAGGAAGGG + Intergenic
1099488435 12:83256343-83256365 GGTAAAGCCCATAGAAGAAAAGG - Intergenic
1101500997 12:105303362-105303384 GTGCAAATCGATAAAAGCAAGGG + Intronic
1102212222 12:111135878-111135900 CTGAAAGTAGATAGAGGCAATGG + Intronic
1103103138 12:118198157-118198179 GGGGAAGGCCATAGAAGCTATGG - Intronic
1103830725 12:123776986-123777008 GGGAAAGTTGATAGGTGGAAAGG + Intronic
1106837944 13:33656278-33656300 GGGAAAAGCGATAGAAGGGAGGG + Intergenic
1107674464 13:42780236-42780258 GGGCAAGAACATAGAAGCAAGGG + Intergenic
1111792204 13:92871701-92871723 GGGAAAGAGAAGAGAAGCAATGG + Intronic
1113971316 13:114192775-114192797 AGGAAATTCCATAGATGCAAGGG + Intergenic
1120607715 14:86600052-86600074 GGGACAGCAGATAGAAGGAAAGG - Intergenic
1124295600 15:28500404-28500426 GGGAAAGAGGAGAGAAGGAAGGG + Intergenic
1125082209 15:35688064-35688086 GAGAAAGTAGGGAGAAGCAATGG + Intergenic
1130288526 15:82575396-82575418 GGGGGAGTACATAGAAGCAAGGG + Intronic
1131530627 15:93188502-93188524 GGGTGAGTGGATAAAAGCAAGGG + Intergenic
1132758190 16:1496128-1496150 GGGAAAGGCAAGAGAAGGAAGGG - Intronic
1133953429 16:10418436-10418458 TTGCAAGACGATAGAAGCAAAGG + Intronic
1136285866 16:29241244-29241266 GGGAAAGTCGATACAAACTGGGG + Intergenic
1139470165 16:67174132-67174154 GGGAAAGGGGAGAGAAGTAATGG - Intronic
1140693542 16:77508738-77508760 GGGAAAGTCCTTGGAAGAAATGG - Intergenic
1140868897 16:79088819-79088841 GGCAAAGTCCATAGAAGCCCAGG + Intronic
1141015507 16:80445503-80445525 GGTAAAGTCCAGAGAAGCGATGG + Intergenic
1142091205 16:88211430-88211452 GGGAAAGTCGATACAAACTGGGG + Intergenic
1146763251 17:35496486-35496508 GGGGAAGTCGGAAGAAGGAAGGG - Intronic
1147389627 17:40101159-40101181 GGCAAAGTCCAGAGAAGGAAAGG + Intergenic
1147901585 17:43789790-43789812 GGGAAAGAAGGTAGAAGGAAGGG - Intergenic
1149827116 17:59838937-59838959 GGGAAACTCGAGGGAAGCACAGG + Intronic
1149989306 17:61372548-61372570 GGGAAACTCGAGAGAAGGAAAGG - Intronic
1150938683 17:69666006-69666028 GAGAAAATCTATAAAAGCAAAGG + Intergenic
1156018875 18:32577285-32577307 GGGAAAGTCAATGGAATCAGAGG - Intergenic
1156047388 18:32892223-32892245 TGGAAAGCCTATGGAAGCAATGG + Intergenic
1156802845 18:41138839-41138861 GGGATAGTCCATAGACACAAAGG - Intergenic
1156872924 18:41968222-41968244 GGGAAGGTAGAGAGAAGGAAGGG + Intronic
1158047093 18:53169493-53169515 GGATAAGTCGATTGAAGTAAAGG - Intronic
1158188317 18:54796643-54796665 GTGAAAGTCGAGAGGAGCAGAGG - Intronic
1158759563 18:60368526-60368548 GGGAAGGACAATAGAAGCCATGG - Intergenic
1160849616 19:1184020-1184042 GGGAAATTCCAGAGAAGCCAGGG + Intronic
1163347706 19:16754332-16754354 TGGAAAGAAGATAGAAACAATGG - Intronic
1166377112 19:42333873-42333895 GGGAAGGTGGAGAGAGGCAAAGG + Intronic
926761618 2:16283350-16283372 GGGAAGGTAGACAGAACCAATGG + Intergenic
928426787 2:31185543-31185565 GGGAAATTACCTAGAAGCAATGG - Intronic
935891386 2:107682445-107682467 TTGAAAGTCAATAGAAGCATTGG + Intergenic
938581703 2:132652321-132652343 GGAAAAGACGACAGAAGGAAAGG + Intronic
939934795 2:148278149-148278171 GTGAAAGAAGATAGAATCAAAGG - Intronic
942755509 2:179336974-179336996 GGCAAAGTAGAAATAAGCAATGG + Intergenic
944974987 2:205039823-205039845 GGGTAAGTGCATAGAAGTAAGGG - Intronic
946047460 2:216833197-216833219 GGGAAAGTCAAGAGAAGCCACGG - Intergenic
946090048 2:217213851-217213873 GGGCAAGTGGAAAGAAGCTATGG - Intergenic
947635359 2:231677954-231677976 GGGAAAGGCGATTAAGGCAAGGG + Intergenic
948643344 2:239388826-239388848 GGAAAGGTGGATAGAAGTAATGG - Intronic
1169554470 20:6735003-6735025 GGGAAAGTAGAGAGTAGAAAAGG - Intergenic
1171172404 20:23027208-23027230 GGGGAGGTCAAGAGAAGCAAAGG + Intergenic
1174251514 20:49223294-49223316 GGAAAAGGAGAAAGAAGCAAAGG + Exonic
950497956 3:13345483-13345505 GGGAGAGTGGACAAAAGCAAAGG + Intronic
951846156 3:27086951-27086973 GGGAAAGTGGGCAGAAGGAAAGG + Intergenic
952415254 3:33084215-33084237 GGGAACATGGATAGAGGCAAGGG + Intronic
956492552 3:69788877-69788899 GGAAAACTAGATAGATGCAATGG + Intronic
957248100 3:77737982-77738004 GGGAATGGGGATTGAAGCAAAGG + Intergenic
960158759 3:114326015-114326037 GGGGAAGGAGAGAGAAGCAATGG + Intergenic
962122828 3:132581538-132581560 AAGAAAGTCAATAGAAGTAAAGG + Intronic
962425424 3:135265218-135265240 TGGAAAGTAGGTTGAAGCAAGGG + Intergenic
965592931 3:170379440-170379462 GGGAAAGGGGAAAGAAGGAAAGG - Intronic
967553349 3:190825760-190825782 GGGAAAGTGGAAAAAAGAAAAGG - Intergenic
968162819 3:196440789-196440811 GGGAAAGTCAAGAGAATCAGAGG - Intergenic
970343540 4:15131134-15131156 GGGAAAGGCCACAGAAGCAGGGG + Intergenic
971001126 4:22323660-22323682 AGGAAAGTGGGTGGAAGCAAAGG + Intergenic
976589821 4:86838004-86838026 GGGTAATTGGATGGAAGCAATGG - Intronic
979582522 4:122377725-122377747 GGGAAAGTGGATGGAAGGAATGG + Intergenic
979640910 4:123012087-123012109 AGGAAAGTGGAGAGAAGGAAGGG + Intronic
979640986 4:123012342-123012364 AGGAAAGTGGAGAGAAGGAAGGG + Intronic
980506594 4:133731960-133731982 GGGAGAGTCTAGAAAAGCAAGGG - Intergenic
980657243 4:135805185-135805207 GGGAGAGTTGAAGGAAGCAATGG - Intergenic
983617169 4:169720186-169720208 GGGAAAGGAGAGAGAAGGAAAGG + Exonic
983952207 4:173655379-173655401 TACAAAGTAGATAGAAGCAAAGG + Intergenic
984174338 4:176397489-176397511 GGGAAAGAGGATAAAAGTAATGG - Intergenic
985245729 4:187977918-187977940 TGGAAAGTCGGCAGCAGCAACGG + Intergenic
987960346 5:24799323-24799345 GGGAAAGGCTAAAGAAGGAAGGG - Intergenic
988907958 5:35809467-35809489 GGGAAAGTGGAGAGAGGGAAAGG + Intronic
990689162 5:58343408-58343430 GGGAAAGACAATGGAAGAAAAGG + Intergenic
991072725 5:62502741-62502763 AGGAAAGTCGAGAGAATTAAGGG + Intronic
991610124 5:68441198-68441220 TGAAAAGTGGATAGAAGCCATGG - Intergenic
992673779 5:79084989-79085011 GGGAAGGTGGAAAGAAGCAGAGG - Intronic
992823136 5:80518642-80518664 GGGAAAGGGGCTAGAAGCTAAGG + Intronic
994471430 5:100212763-100212785 GGGACAGAAGATAGGAGCAAGGG - Intergenic
996539644 5:124616209-124616231 GAGAAATTCAATAGAAGGAAAGG - Intergenic
998274608 5:140740781-140740803 GGAAAAGTAGAAAGAAGAAAAGG - Intergenic
999725769 5:154436253-154436275 GGTATTGTGGATAGAAGCAAAGG - Intergenic
1000556307 5:162730286-162730308 TGTAAAATTGATAGAAGCAAAGG + Intergenic
1002537593 5:179886055-179886077 GAGAAACTCGAAAGAAGCAGGGG - Intronic
1002990518 6:2234137-2234159 GGGAAAGTCAGGAGAAGTAAGGG - Intronic
1005160939 6:22862859-22862881 GGGAACGTGAATAGAAGCAAAGG + Intergenic
1005235960 6:23762496-23762518 GGGCAAATTGATAGAAACAAAGG - Intergenic
1009513751 6:64587218-64587240 GGGAAAGTCACCAGCAGCAAGGG + Intronic
1021300876 7:18971688-18971710 GGCAAAGTCTATAAAAACAAGGG - Intronic
1021695712 7:23274102-23274124 GGGAATGTGGTCAGAAGCAAAGG + Exonic
1021754511 7:23838499-23838521 GACAAAGTCGACAAAAGCAATGG + Intergenic
1022303287 7:29121756-29121778 GGGAAATTTCAAAGAAGCAATGG + Intronic
1023097958 7:36681967-36681989 GAGAAAGTAGAGGGAAGCAATGG + Intronic
1023554431 7:41406069-41406091 AGGCAAGTCCATAGAAGCAGAGG + Intergenic
1024611799 7:51071831-51071853 GGGAAAGTCTAAACAAGAAAAGG - Intronic
1024613769 7:51089579-51089601 GACAAAGACGAGAGAAGCAATGG - Intronic
1031821002 7:126501521-126501543 GGAAAAGACAATAGAAGAAAAGG + Intronic
1032509061 7:132457404-132457426 GGGAAGGTTGATGGATGCAATGG - Intronic
1035157046 7:156922853-156922875 GAGAAAGGAGATAGAAGAAAGGG + Intergenic
1035158980 7:156937168-156937190 AGGAAAGTGGATAGAAAGAACGG + Intergenic
1039343290 8:36674662-36674684 TGGAAAGTGGAGAGAAGGAAAGG + Intergenic
1041334606 8:56766991-56767013 GAGAAAATCAATAGAACCAAAGG - Intergenic
1042401967 8:68360207-68360229 GGCAAAGACGAGAAAAGCAAGGG - Intronic
1043188262 8:77183132-77183154 TGGCAAGTGGAAAGAAGCAAAGG - Intergenic
1043361475 8:79477596-79477618 GGGAAAGAAGACAGACGCAAAGG + Intergenic
1044080270 8:87874203-87874225 GGAAAACTCGAGAGAAGCAGCGG - Intergenic
1045045425 8:98270966-98270988 GACAAAGTCGACAAAAGCAATGG - Intronic
1046619117 8:116509164-116509186 GGAAAAGGGGATAGAATCAATGG + Intergenic
1048054117 8:130847114-130847136 TGGAAAATGGATAGAAGGAAAGG + Intronic
1050191906 9:3035172-3035194 GGGAAAGAAGATAGCAGCAAAGG + Intergenic
1050896696 9:10891544-10891566 GAGAAAGTAGAGAGAAGCAATGG - Intergenic
1052876599 9:33572332-33572354 AAGAAAGTAGATAGGAGCAAGGG - Exonic
1052930009 9:34048588-34048610 GGGAAAGTAGGAAGAAGCACAGG + Intronic
1053097289 9:35339594-35339616 GGGAAGGTGGATAGATACAAAGG + Intronic
1055828218 9:80352126-80352148 GGGAAAGTGGTTAAAAGCATTGG - Intergenic
1189201163 X:39196773-39196795 GGGACATTCAATAGCAGCAAGGG - Intergenic
1199640545 X:149857185-149857207 GGGAAAGTCCATAGAATTCATGG + Intergenic
1200591997 Y:5087127-5087149 TGGAAAGTAGAGGGAAGCAAGGG - Intronic