ID: 922196807

View in Genome Browser
Species Human (GRCh38)
Location 1:223365474-223365496
Sequence TCTCACATACTGATGGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922196802_922196807 26 Left 922196802 1:223365425-223365447 CCTGATACAGCTACTAAATCATC 0: 1
1: 0
2: 1
3: 12
4: 96
Right 922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 113
922196803_922196807 4 Left 922196803 1:223365447-223365469 CCTTTGCTTCTATCGACTTTCCC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922196807 Original CRISPR TCTCACATACTGATGGTAGT TGG Intergenic
906038636 1:42768886-42768908 TCTCAAATACAGATTGTATTGGG - Intronic
906079008 1:43071395-43071417 TCTGACAGCCTGAGGGTAGTGGG + Intergenic
906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG + Intronic
910337058 1:86145974-86145996 TCTTACATTCTCATGGTACTGGG + Intronic
911690998 1:100834812-100834834 TCTCACATACTGATGATACCAGG - Intergenic
912703301 1:111894495-111894517 TCTTACATGCTGGTGATAGTGGG - Intronic
915759479 1:158296050-158296072 ACTCACATGCTGGTGGTGGTGGG - Intergenic
916391420 1:164334799-164334821 TCTCTCATACAGAAGGTACTTGG + Intergenic
918205611 1:182306393-182306415 TCTCATATTCTGCTGGTAGGTGG - Intergenic
918227181 1:182494621-182494643 TCTCTGATACTGATGGTAAATGG + Intronic
920601801 1:207333134-207333156 TCTCAGAACCTGATGGTATTTGG + Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
1067780461 10:49199778-49199800 CCTCATATACTGCTGGTAGGAGG + Intergenic
1068839100 10:61590290-61590312 TTTCACATTGTGATGGTGGTAGG + Intergenic
1069021635 10:63494946-63494968 TCTCACATACAGAGGGAAGTGGG - Intergenic
1069490798 10:68858806-68858828 TCTCTCCTACTGATGGAAGAGGG - Intronic
1069783065 10:70969091-70969113 TGTCACTGACTGAGGGTAGTGGG - Intergenic
1071128543 10:82364897-82364919 TCTGACATGCTGATAGGAGTTGG + Intronic
1071175370 10:82920290-82920312 TTTAAGAAACTGATGGTAGTTGG + Intronic
1072076918 10:91985593-91985615 TCTCACATACTGATGGTCAGAGG - Intronic
1072378699 10:94843093-94843115 TCTCACCCAGTGATGGTAGAGGG - Intronic
1074503718 10:114048114-114048136 TCTTACATACTCATGGTCGGGGG - Intergenic
1080674494 11:34412251-34412273 TTTCAAATACTGCTAGTAGTTGG - Intergenic
1082055235 11:47809308-47809330 TCTCATATACTGCTGGTGCTGGG + Intronic
1082896873 11:58201137-58201159 ACCCTCAAACTGATGGTAGTAGG - Intergenic
1084280385 11:68086533-68086555 TCTCTAATACTGAGGGAAGTAGG + Intronic
1090968449 11:131618599-131618621 GCTCACATCCTGATGTTACTGGG - Intronic
1091225313 11:133953594-133953616 ACTCAGATCCTGCTGGTAGTTGG - Intronic
1092120434 12:6039881-6039903 TCTCCCAAACTGCTGGTATTAGG - Intronic
1097812096 12:64029998-64030020 TCTCAAGTACTCATTGTAGTGGG - Intronic
1099530133 12:83768785-83768807 TCTCCAATAGTGATGGCAGTTGG + Intergenic
1103302543 12:119939049-119939071 TCCCACAAACAGATGGTGGTGGG - Intergenic
1103625063 12:122212429-122212451 TCTCACTTTTTGATGGTAGTTGG + Intronic
1106732662 13:32557546-32557568 TCTCATATATTGCTGGTAGAAGG - Intergenic
1108497696 13:51041575-51041597 TCTCTCAGACTCATGGGAGTTGG + Intergenic
1109907600 13:68865449-68865471 TCTCAAATACTGAGGTCAGTTGG - Intergenic
1110326232 13:74218738-74218760 TCTAACATAATGATGTTAGCTGG + Intergenic
1112230024 13:97580551-97580573 TCTATCATACTGGGGGTAGTAGG + Intergenic
1114828798 14:26112794-26112816 TCTCTCATACATATCGTAGTTGG - Intergenic
1116098687 14:40406834-40406856 TTTCACATACTGCTCCTAGTGGG + Intergenic
1116468898 14:45264884-45264906 ACTCACATACTGCTGCTGGTAGG - Intergenic
1116671497 14:47847900-47847922 TCTGACATCATGATGCTAGTTGG - Intergenic
1118959259 14:70513882-70513904 TATCTCATACTGATGGGATTGGG - Intergenic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1131828512 15:96339461-96339483 TCTCACAGACTGAAGGTAAAGGG - Exonic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1142039836 16:87885888-87885910 GCTCACATTCTGATGGAAGGAGG - Exonic
1142912399 17:3105804-3105826 TCTCATACACTGCTGGCAGTAGG - Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1155458401 18:26047131-26047153 TCTCACATCCTTGAGGTAGTAGG - Intronic
1156596920 18:38558111-38558133 TCTCCCATAATGATGGCAGAGGG + Intergenic
1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG + Intronic
928994196 2:37269347-37269369 TCACACATACAGATGTTTGTCGG - Intronic
935538568 2:104323041-104323063 TATCTCATACTGTTGGTAGGAGG + Intergenic
939440503 2:142243505-142243527 TCTCACATATTGATGATGGGAGG + Intergenic
940422186 2:153492108-153492130 TCTGGCAGAATGATGGTAGTGGG + Intergenic
940425386 2:153525648-153525670 TTTCACATACTGGTGGGGGTGGG - Intergenic
940594586 2:155773658-155773680 TATCACATACTGGTGGGAATTGG - Intergenic
944037728 2:195316169-195316191 ACTTGCATACTGATGGTAGTTGG - Intergenic
945537789 2:211040627-211040649 TCTCACGTACTGTTGGAACTTGG + Intergenic
946973972 2:225127247-225127269 TCTCCCATACTGTAGGTTGTAGG + Intergenic
1169825052 20:9758584-9758606 TGTCACAAAGTCATGGTAGTGGG - Intronic
1177005685 21:15669483-15669505 TCTCACAAACAGATTGCAGTTGG - Intergenic
1177780380 21:25615911-25615933 TGTTCCATACTGATGGTATTTGG + Intergenic
1181076269 22:20379393-20379415 TCACACATACTGGTGGTGGAGGG - Intronic
1183910116 22:41072690-41072712 TCTCACACACTGAGAGTAGAGGG + Intergenic
949518853 3:4831424-4831446 TCTCACATACCGATGTCATTAGG - Intronic
951295566 3:20929863-20929885 TCACACATATTGAGGGTTGTTGG + Intergenic
954868727 3:53750913-53750935 TCTCACTTACTCTGGGTAGTGGG - Intronic
963482940 3:145899950-145899972 TCTCAAATTCTGAGGTTAGTTGG + Intergenic
965165581 3:165191971-165191993 TTTCATATACTGATGTTATTAGG - Intronic
965340357 3:167483183-167483205 TATCTCATACTGCTGGTATTAGG - Intronic
967117743 3:186356936-186356958 CCTCTCCTACTGATGGGAGTTGG - Intronic
967118051 3:186360016-186360038 CCTCTCCTACTGATGGGAGTTGG - Intronic
968065638 3:195757528-195757550 TCCAACATACTGATTGTAGCGGG + Intronic
970823289 4:20244443-20244465 TCTCACATAGTGCTAGGAGTGGG - Intergenic
974304618 4:60117631-60117653 TCTTACAAGGTGATGGTAGTAGG - Intergenic
976209256 4:82651129-82651151 TGTCTCACACAGATGGTAGTTGG + Intronic
976608870 4:87008234-87008256 TCTCACATATTTAAAGTAGTAGG + Intronic
976669158 4:87632867-87632889 TCTCACATATTTAGGGTATTGGG - Intergenic
980282912 4:130743425-130743447 TCTCAAATACTTTAGGTAGTAGG + Intergenic
980731968 4:136835479-136835501 ACCCACAAAGTGATGGTAGTAGG + Intergenic
983114349 4:163794183-163794205 TCTCATACACTGATGTTAGCTGG - Intronic
984022521 4:174503243-174503265 GCTCCCATACTCATGGCAGTTGG + Intronic
995012820 5:107276882-107276904 TCTCGCATACTGAATTTAGTAGG - Intergenic
996181937 5:120430427-120430449 TCTGACATCATGATGCTAGTTGG + Intergenic
997050453 5:130373897-130373919 TCTCCAATAGTGATGGTATTAGG + Intergenic
997305589 5:132833655-132833677 TCTCCCTTAGTGATGGTGGTTGG + Intergenic
997840315 5:137233772-137233794 TCTCACTTACTGATTCTAGGAGG + Intronic
1014314722 6:119849186-119849208 TGTAAAATCCTGATGGTAGTAGG + Intergenic
1016019411 6:139220038-139220060 ACTCTCAAACTGATGGTATTAGG + Intergenic
1016499708 6:144705618-144705640 ACTCCCATAGTGATGGTATTGGG - Intronic
1017568613 6:155716040-155716062 GCTCACAAACTGAAGGTATTGGG - Intergenic
1018425713 6:163678827-163678849 TGCCACATAAAGATGGTAGTGGG + Intergenic
1024344278 7:48297057-48297079 ATTCACATACAGATGGTATTGGG + Intronic
1026471948 7:70701226-70701248 TCTCACAAGCTGATTGTGGTGGG + Intronic
1030827481 7:114177338-114177360 TTTCACACATTGATGGTAGAAGG - Intronic
1030969434 7:116036490-116036512 ATTCACATGCTGATGGTATTTGG - Intronic
1031646488 7:124232211-124232233 TCTCTCATACTGATGTTTATTGG + Intergenic
1031646912 7:124237235-124237257 TCTCTCATACTGATGTTTATTGG + Intergenic
1031647330 7:124242231-124242253 TCTCTCATACTGATGTTTATTGG + Intergenic
1039596692 8:38796897-38796919 TCTCACATAGTCTTTGTAGTTGG + Intronic
1040014286 8:42688733-42688755 TCTTACATACTGATGTCAGAGGG + Intergenic
1041782033 8:61587315-61587337 TGACACAGATTGATGGTAGTAGG + Intronic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1050146425 9:2573003-2573025 TCTCACAGATTGATGCTATTAGG - Intergenic
1051501386 9:17781665-17781687 TCTCAAATACTGCTGGTAGGAGG - Intronic
1054849021 9:69827541-69827563 GTACACATACAGATGGTAGTGGG - Intronic
1055451163 9:76432656-76432678 TTTCACATACTGATAGCGGTAGG + Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1061424301 9:130489578-130489600 TCTCACATGAGGATGGCAGTGGG - Intronic
1186467954 X:9798949-9798971 TCTCACATGCTGATGCCATTAGG + Intronic
1186549546 X:10488410-10488432 TCTCACAAACTGCTGGAGGTGGG - Intronic
1187565774 X:20448108-20448130 TCTCACATACTCTCGGTGGTAGG + Intergenic
1188281529 X:28275937-28275959 TCTCATATACTGCTGGTGGTAGG - Intergenic
1189246904 X:39570358-39570380 TCTCACACACTGATCTTAGCTGG - Intergenic
1189593146 X:42536836-42536858 ACTCACACACTGTTGGTAGGAGG + Intergenic
1193209562 X:78789972-78789994 TCTGACATCATGATGCTAGTTGG - Intergenic
1193471149 X:81906203-81906225 TCTCACAGACTGAAGGTAAAGGG - Intergenic
1198624885 X:138559691-138559713 TCTCACATGATGATTGTAGTTGG + Intergenic
1198701703 X:139403922-139403944 TGGCACATACTGATGGGATTGGG + Intergenic