ID: 922197641

View in Genome Browser
Species Human (GRCh38)
Location 1:223373514-223373536
Sequence TTTCCTGTCCCCATTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922197641_922197648 25 Left 922197641 1:223373514-223373536 CCAATACCAATGGGGACAGGAAA No data
Right 922197648 1:223373562-223373584 CCCAAACACAGGAGAGCACCAGG No data
922197641_922197644 14 Left 922197641 1:223373514-223373536 CCAATACCAATGGGGACAGGAAA No data
Right 922197644 1:223373551-223373573 AGAGTCCTCCTCCCAAACACAGG No data
922197641_922197651 27 Left 922197641 1:223373514-223373536 CCAATACCAATGGGGACAGGAAA No data
Right 922197651 1:223373564-223373586 CAAACACAGGAGAGCACCAGGGG No data
922197641_922197650 26 Left 922197641 1:223373514-223373536 CCAATACCAATGGGGACAGGAAA No data
Right 922197650 1:223373563-223373585 CCAAACACAGGAGAGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922197641 Original CRISPR TTTCCTGTCCCCATTGGTAT TGG (reversed) Intergenic
No off target data available for this crispr