ID: 922200192

View in Genome Browser
Species Human (GRCh38)
Location 1:223394384-223394406
Sequence GCTGCTGCTGCGGCAGAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 0, 2: 4, 3: 86, 4: 737}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922200186_922200192 4 Left 922200186 1:223394357-223394379 CCAGATGACCCTGGAGCGGGAGC 0: 1
1: 0
2: 1
3: 11
4: 151
Right 922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG 0: 1
1: 0
2: 4
3: 86
4: 737
922200189_922200192 -5 Left 922200189 1:223394366-223394388 CCTGGAGCGGGAGCGCCGGCTGC 0: 1
1: 0
2: 0
3: 31
4: 304
Right 922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG 0: 1
1: 0
2: 4
3: 86
4: 737
922200188_922200192 -4 Left 922200188 1:223394365-223394387 CCCTGGAGCGGGAGCGCCGGCTG 0: 1
1: 0
2: 0
3: 16
4: 144
Right 922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG 0: 1
1: 0
2: 4
3: 86
4: 737

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922200192 Original CRISPR GCTGCTGCTGCGGCAGAGCC AGG Exonic
900093195 1:929480-929502 GCTGCAGCTGCCCCTGAGCCGGG + Intronic
900142828 1:1145679-1145701 GCTGCAGGTCCGGCAGAGCCAGG + Intergenic
900186012 1:1333618-1333640 GCTGCTCCTGCTGCTGAGCCTGG + Exonic
900188385 1:1343308-1343330 GCTGCTGCTGCTGAGGAGGCTGG - Intronic
900432799 1:2611042-2611064 GATGCTGTTGCTGCAGGGCCTGG + Intronic
900505501 1:3028245-3028267 GCGGCAGCTGCAGCAGAGGCTGG - Intergenic
900599763 1:3497969-3497991 GCTGCTGTGCCGGCAGGGCCTGG - Intronic
900986068 1:6073338-6073360 GCTCCTGCTGGGACAGAGCGGGG - Intronic
901057501 1:6455471-6455493 GCAGCTGCTGAGGCAGCGGCAGG + Intronic
901206499 1:7500599-7500621 GCTGCTGCTGCTACAGAAGCGGG - Intronic
901511638 1:9720744-9720766 GCTGCAGCTGCGGGAAATCCTGG + Exonic
901752398 1:11418716-11418738 GCTCCTGCTCCCCCAGAGCCAGG + Intergenic
902187323 1:14735169-14735191 GCTGCTCCTGAGGCTGAGGCAGG - Intronic
902476859 1:16693007-16693029 GCAGCTGCTGAGGCAGCGGCAGG - Intergenic
902511710 1:16970249-16970271 GCAGGTGCTGCGGCAGCGGCAGG + Exonic
902511721 1:16970321-16970343 GCGGCTGCTGCAGGAGCGCCTGG + Exonic
902582878 1:17419990-17420012 GCTCCTGCAGCCGCAGCGCCTGG - Intronic
902585855 1:17438377-17438399 GCTGCTGCTACTGCAGCGCTCGG + Exonic
902833697 1:19033865-19033887 GCTGATGCTGGGCCAGATCCTGG - Intergenic
903112681 1:21150174-21150196 GCTGCTGCTGCAGCAGGGGCGGG - Intronic
903223214 1:21880490-21880512 GCTGCAGGTGCTGCAGAGCCTGG - Exonic
903279022 1:22239515-22239537 GCAGCCGCTGGGGCAGAGCCAGG + Intergenic
903279576 1:22242838-22242860 GCTGGAGCTACTGCAGAGCCAGG + Intergenic
903403735 1:23079072-23079094 GCTGCTGCTTCAGCACACCCAGG - Exonic
903542940 1:24107096-24107118 CCGGCTGCTGCGCCAGAGGCGGG - Exonic
903627938 1:24744988-24745010 GCTGCTGCTGTTGCTGTGCCAGG - Intergenic
903743347 1:25571144-25571166 GCTGCTGGCGAGGCAGAGCAGGG - Intergenic
903749376 1:25611244-25611266 GCTGCTTCTGCTGCAGGACCGGG + Intergenic
903882040 1:26517157-26517179 TCTGCTGCTGTATCAGAGCCTGG + Intergenic
904782931 1:32964387-32964409 GCGGCGGCGGCGGCGGAGCCTGG - Exonic
904807685 1:33143305-33143327 GCTGCTGCTGAGGCTGAGTGGGG + Intergenic
905206778 1:36347105-36347127 GCCGCTTCTGCTGGAGAGCCAGG - Intronic
905534399 1:38708956-38708978 GCTGCTGCTGCTGCTCAGCGCGG + Intergenic
906044373 1:42816986-42817008 GCGGCTGCTGCGGCGGAGTTAGG - Intronic
906197151 1:43936317-43936339 GCTGGTGCAGTGGAAGAGCCCGG + Exonic
906537338 1:46558791-46558813 GCTGCTGTTCCTGCAGGGCCAGG + Exonic
906688609 1:47778354-47778376 GCTTCTGGTGAGGCAGAGGCAGG - Intronic
907185565 1:52606737-52606759 GCTGCAGCTGCTGCAGGGCTCGG - Exonic
907523434 1:55039885-55039907 GCTGCTGCTGCTGCTGCTCCTGG + Exonic
907535259 1:55147698-55147720 GCAGCTGCTGTGGCCGGGCCTGG - Exonic
910254626 1:85235545-85235567 GCTGCTCCTGAGGCTGAGGCAGG - Intergenic
912574682 1:110657156-110657178 GCTACTGCTGAGGCTGAGGCAGG - Intergenic
912993498 1:114511145-114511167 GCTGCGGCTGCGGCTGGGGCTGG - Exonic
913451460 1:118995432-118995454 GCTGCTGCTGGGGAAGAGTTGGG + Intergenic
913610277 1:120503955-120503977 GCTGCTGCTGTGGTATAGGCAGG + Intergenic
914087755 1:144469031-144469053 GCTGCTGGTTGGGCAGAGCTAGG - Intergenic
914310856 1:146465173-146465195 GCTGCTGGTTGGGCAGAGCTAGG + Intergenic
914314317 1:146495536-146495558 GCTGCTGGTTGGGCAGAGCTAGG - Intergenic
914500031 1:148237845-148237867 GCTGCTGGTTGGGCAGAGCTAGG + Intergenic
914580913 1:149018284-149018306 GCTGCTGCTGTGGTATAGGCAGG - Intronic
914591248 1:149107973-149107995 GCTGCTGGTTGGGCAGAGCTAGG - Intergenic
915009094 1:152667764-152667786 GCAGCAGCAGCGACAGAGCCTGG - Intergenic
915010359 1:152679553-152679575 GCAGCAGCAGCGACAGAGCCTGG - Intergenic
915164471 1:153941014-153941036 CCTGCAGCTGCTGCAGAGCCTGG - Exonic
915244160 1:154544407-154544429 GCTGCTCCTCCGCCTGAGCCAGG - Exonic
915246342 1:154558608-154558630 GCGGCGGCGGCGGCGGAGCCCGG - Exonic
915637073 1:157194880-157194902 GGAGCTGCTGCGGCTGGGCCGGG + Intergenic
915684585 1:157618562-157618584 GCCCCAGCTGCCGCAGAGCCTGG - Intergenic
915737102 1:158091876-158091898 GCAGCCCCTGGGGCAGAGCCTGG - Intronic
915902373 1:159855969-159855991 GCTGCTGCTGCGGGGGCTCCGGG - Exonic
916482327 1:165225763-165225785 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
916498255 1:165364775-165364797 GCTGCTGCTGGCTCGGAGCCAGG - Intergenic
916615392 1:166434047-166434069 GCTGCTGCTGATGCAGAGTCAGG - Intergenic
916629101 1:166592737-166592759 GCTGATGCTGCAGAAGAGCAGGG - Intergenic
916786613 1:168091314-168091336 GCTTCTGCCGCGGCTGTGCCCGG - Intronic
916951701 1:169787053-169787075 GCTGCTGCTGCAGTGTAGCCAGG + Intronic
918044775 1:180935310-180935332 GCTGCAGCAGCGCCAGCGCCAGG + Exonic
918064264 1:181089091-181089113 GCTGCTGCGGTGGCGGCGCCGGG - Exonic
918240318 1:182615057-182615079 GCTGATGGTGCCACAGAGCCCGG - Intergenic
919815006 1:201431692-201431714 GCATCTGCTGCAGCAGAGGCTGG + Intergenic
919914797 1:202132727-202132749 ACAGCTGCTGCCTCAGAGCCTGG - Exonic
920500139 1:206480497-206480519 GCTGCTGCTGAGGTAGAGGAGGG - Exonic
920644312 1:207787996-207788018 GCTGATGCTGCTGCTGTGCCTGG + Intronic
920691409 1:208149639-208149661 GGTGCTGCTGAGGCTGACCCTGG + Intronic
920803162 1:209208094-209208116 GCTGCAGCCGCGGGAAAGCCCGG - Intergenic
921060217 1:211578874-211578896 GGGGCTGCTGAGGCTGAGCCGGG - Intergenic
921189850 1:212699678-212699700 GCTGCGGCTGCGGCTGCGGCTGG + Exonic
921217551 1:212950659-212950681 GCTGCTGCTGCTGCTGGGCCTGG - Exonic
921638042 1:217520954-217520976 GCTGCTCCAGCAGCAGAGGCAGG - Intronic
922003634 1:221505227-221505249 GCTGCCCCTGGGGCAGAGCAGGG + Intergenic
922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG + Exonic
922808115 1:228401098-228401120 GCAGCAGCTGCTGCAGAGGCTGG - Exonic
922969625 1:229725127-229725149 GCTGCTGCTGCGGCTGATTGGGG + Intergenic
923033147 1:230265588-230265610 CTTGCCGCTGCAGCAGAGCCTGG - Intronic
924324666 1:242883505-242883527 GCTGCTGCTGCTGCAGTACTTGG + Intergenic
924885372 1:248210010-248210032 GCTGCTGCTGTGGCAGATGGGGG + Intergenic
1062824037 10:555918-555940 GCGGCTGCTGCTGCAGGGCCGGG - Intronic
1063551816 10:7040948-7040970 GGTGCTGCTGCGGTGGCGCCCGG + Intergenic
1063623055 10:7666865-7666887 CCTGCTGCTGGGGCTGTGCCTGG - Exonic
1064505748 10:16027928-16027950 GCTGCTGCTGCTGGAGAGTGAGG - Intergenic
1065023054 10:21516748-21516770 TCTGCTGCGGCGGCTGGGCCCGG + Exonic
1066491813 10:35901465-35901487 GCTGCTGCCCCGGAAGGGCCTGG + Intergenic
1066984624 10:42454231-42454253 GTGGCTGCTGCTGTAGAGCCTGG - Intergenic
1067090477 10:43263801-43263823 GGAGGTGCTGCAGCAGAGCCGGG + Intronic
1067462424 10:46467495-46467517 TCTGCTTCTGCAGCAGAGCATGG - Intergenic
1067482634 10:46613641-46613663 CCTACTGCTGGGGCAGGGCCAGG + Intergenic
1067612117 10:47728023-47728045 CCTACTGCTGGGGCAGGGCCAGG - Intergenic
1069621961 10:69842867-69842889 GCTGCTGCTGGGTCACTGCCGGG - Intronic
1069625814 10:69867114-69867136 GCTGCTGCTGCGGCCGTGGGAGG + Intronic
1069658870 10:70110255-70110277 GCTGGTGCTGTGGCCCAGCCTGG + Intronic
1069984629 10:72274780-72274802 GCAGCTGCTGCAGGAGAGCCTGG + Exonic
1071052829 10:81472895-81472917 GCTGCTGCTGCAGGGGAGGCAGG + Intergenic
1071086887 10:81875422-81875444 GCTGCGGCGGCGGCAGCGGCGGG + Exonic
1071430403 10:85602362-85602384 GGGGCTGTTCCGGCAGAGCCCGG - Exonic
1071627539 10:87188266-87188288 CCTACTGCTGGGGCAGGGCCAGG - Intronic
1072102321 10:92240293-92240315 GCTGCTGCTGGGGCTGGGGCTGG + Exonic
1072552317 10:96488351-96488373 GCAGGTGCTGCGGAAGGGCCAGG - Intronic
1072562196 10:96586754-96586776 GCTGCTGCTGCCCCGGACCCGGG - Exonic
1072568956 10:96642004-96642026 GTTGCTGCTGCTTCTGAGCCAGG + Intronic
1072675674 10:97464209-97464231 AGTGCTTCTGCTGCAGAGCCTGG - Intronic
1072961543 10:99933846-99933868 GCTGCTGCGGAGGCTGAGGCAGG - Intronic
1073477439 10:103763536-103763558 ACTGCTGCTGGGGGTGAGCCTGG + Intronic
1074121646 10:110497986-110498008 GCTGCGGCCGCGACGGAGCCCGG - Exonic
1074385904 10:113016570-113016592 CCTGAAGCTCCGGCAGAGCCTGG + Intronic
1075085190 10:119410012-119410034 GCTGCTCCTGCAGCTGCGCCGGG + Intronic
1075483472 10:122801030-122801052 GCTGCTGTTGCTGCAGAGGGCGG - Intergenic
1075563562 10:123486595-123486617 GCTGCAGCCCAGGCAGAGCCAGG - Intergenic
1075688830 10:124381881-124381903 GGTGCTTCTGCAGCATAGCCAGG - Intergenic
1075693892 10:124419322-124419344 GCTGTGGCTGGGGCAGAGCTGGG - Intergenic
1076191688 10:128487722-128487744 GCTGCTGCTGCGGCTGCAACTGG + Intergenic
1076587767 10:131560949-131560971 GCTGATGCTGAGGCTGAGGCTGG + Intergenic
1076736360 10:132460936-132460958 GCTGCAGGTCAGGCAGAGCCTGG - Intergenic
1077094381 11:793123-793145 GCTGCTGCAGTGGCGGAGGCTGG - Intronic
1077922969 11:6655474-6655496 GCGGCAGCGGCGGCGGAGCCGGG - Intronic
1078076725 11:8168920-8168942 GCAGCAGCAGCGACAGAGCCAGG + Exonic
1078097924 11:8311813-8311835 ACTGAGGCTGCGGCAGGGCCTGG - Intergenic
1078463765 11:11535187-11535209 GCTGCTGGTGAGGCAGACCCTGG + Intronic
1078643230 11:13115109-13115131 GCTTCTGCTCCAGCACAGCCAGG + Intergenic
1078668922 11:13348074-13348096 GGAGCTGCTGCAGGAGAGCCAGG + Intronic
1081574302 11:44309744-44309766 GCTGCGGCTGCGGCGGCGGCTGG + Exonic
1082000577 11:47391830-47391852 CCAGCTGGTGCGGCAGAGCGGGG + Intergenic
1082076763 11:47980981-47981003 GCTGCTGCTGCTGCTGCGCCTGG + Exonic
1082076765 11:47980987-47981009 GCTGCTGCTGCGCCTGGGCCAGG + Exonic
1082106720 11:48229007-48229029 GCTGCTGGTGCTGCAGGCCCAGG + Intergenic
1082849914 11:57755207-57755229 GCTACTGGGGCGGCTGAGCCAGG + Intronic
1082996946 11:59262403-59262425 GCTGCTGCTGGAGCTGGGCCAGG + Intergenic
1083160297 11:60850274-60850296 GCTGCTTCTGCAGCAGGGCCAGG - Exonic
1083209566 11:61174650-61174672 GCTGCTCCTTTGGCAGAGTCTGG + Intergenic
1083378296 11:62243952-62243974 TCTGCAGCTTCTGCAGAGCCAGG + Intronic
1083431504 11:62615727-62615749 GCAGCTGCAGCGGCAGGGCCGGG - Exonic
1083735080 11:64675584-64675606 CCGGCTGCTGCTGCAGAGCCAGG + Intronic
1083737057 11:64687435-64687457 CCAGCTGCTGCCCCAGAGCCTGG + Intronic
1083767691 11:64849725-64849747 GCTGCAGCCGCTGCAGAGCGTGG - Intergenic
1083783502 11:64930602-64930624 GCTCCTGCTGCAGCAGGGACAGG - Intronic
1083883035 11:65557848-65557870 GCTGCTGCTGCTGCTGGGCCTGG - Exonic
1083962479 11:66021979-66022001 GCAGCTGCTTACGCAGAGCCGGG - Intronic
1084044639 11:66561580-66561602 CCAGCTGCTGCAGGAGAGCCTGG + Exonic
1084274311 11:68043874-68043896 GCAGCTGCAACAGCAGAGCCAGG + Exonic
1084514499 11:69629145-69629167 GCTACTGCTGTGGCTCAGCCTGG + Intergenic
1084729105 11:71061855-71061877 CCTGCAGCTGGGGCAGAGCGGGG - Intronic
1084857549 11:71998694-71998716 GCTGGGGCTGCGGGAGGGCCAGG - Intronic
1085052924 11:73388980-73389002 GCTGCTGGGCAGGCAGAGCCCGG - Intronic
1085165814 11:74398442-74398464 GCGGCGGCGGCGGCGGAGCCAGG - Exonic
1085215511 11:74827083-74827105 TCTGCTGCAGCGGTGGAGCCTGG - Intronic
1090076881 11:123585181-123585203 TCTCCTGCTGCAGCAGAACCTGG - Intronic
1090331156 11:125933201-125933223 GCTGCTGCTGCTGCTGATCTGGG - Intergenic
1090387708 11:126366241-126366263 GCAGCTGCTGTAGCTGAGCCCGG + Intronic
1090645857 11:128766224-128766246 GCTTCTGCTGCGGAAGGACCTGG - Intronic
1090699381 11:129279910-129279932 GCTGCTGCTGCGGCGGCGGCCGG - Intergenic
1091274706 11:134342442-134342464 GCTGCTGCTGGGGCCGGGGCGGG - Intronic
1093107457 12:15105902-15105924 GCTACTGCTGAGGCTGAGGCAGG - Intergenic
1093443468 12:19227778-19227800 ACTGCTGCTGTGGCAGAGATCGG - Intronic
1093548014 12:20369893-20369915 GCTGGTGCTGAGGCTGAGGCTGG + Exonic
1093641149 12:21527944-21527966 GCTGCTGCTGCTGCCAACCCGGG - Intronic
1093888008 12:24485960-24485982 GCTGCTGCTGCTGTTGAGACAGG + Intergenic
1094480176 12:30875217-30875239 GCTGCTGCTGCGGCCAAGTAAGG + Intergenic
1096111579 12:49031999-49032021 GCGGCAGCTGCAGCAGAGTCAGG - Exonic
1096111837 12:49033490-49033512 GCTGCTGCTGCTGCAGTTTCTGG + Exonic
1096983788 12:55743637-55743659 GCCGCCGCTGCAGCAGATCCTGG + Exonic
1098278714 12:68840615-68840637 GCTGCTCCAGAGGCTGAGCCAGG - Exonic
1098607102 12:72404318-72404340 GCTGCTGCAGAGGCTGAGACAGG + Intronic
1099072353 12:78061064-78061086 GCTGCTGCTGCTGCTGGTCCAGG - Intronic
1100003272 12:89862986-89863008 GCTTCTGCTTCGGCAGAAACAGG - Intergenic
1100015247 12:90002246-90002268 GCTGCTGCTCAGGCAGTCCCAGG - Intergenic
1100845224 12:98651567-98651589 TCTGCTGCTGCAGCAAAGCTGGG + Intronic
1101222285 12:102654228-102654250 TCTCCTGCAGCTGCAGAGCCAGG + Intergenic
1101761793 12:107664747-107664769 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
1101838132 12:108309389-108309411 GCTGGTGCTGTGGAAGAGCATGG + Intronic
1102297693 12:111749573-111749595 GCCTCTGCTGCTACAGAGCCTGG - Intronic
1102371016 12:112382319-112382341 GCGGCGGCGGCGGCAGGGCCGGG - Intronic
1102833172 12:116026602-116026624 GCTGCTGCTGCTGCTGCTCCTGG + Intronic
1103308921 12:119989326-119989348 GCTGGGGCTGCCGCGGAGCCGGG + Intergenic
1103527794 12:121579344-121579366 GCTGCTGTTACCGCCGAGCCGGG - Intronic
1103527803 12:121579371-121579393 GCGGCCGCGGCGGCAGAGCCGGG + Intronic
1103618495 12:122170977-122170999 GCTGCTGCTGCTGCTGGGCCAGG + Intronic
1103713541 12:122929982-122930004 GCTGGTGCAGCGGCAGATGCTGG - Exonic
1103953382 12:124564314-124564336 GCTGCTGCCTGGGGAGAGCCAGG - Intronic
1104811298 12:131621874-131621896 GCTGCGGCAGCAGGAGAGCCAGG - Intergenic
1104830553 12:131747980-131748002 GCCGCTGCCGAGGAAGAGCCTGG + Intronic
1104854962 12:131897169-131897191 GCTGCAGCTCCAGCAGAGCCCGG - Intronic
1104857352 12:131908391-131908413 GCTGCAGCTGCTCCAGAGACGGG - Intronic
1104989566 12:132618316-132618338 GCTGGAGCTGCGGCGGAGGCAGG + Intergenic
1106138952 13:26994789-26994811 TCTGCTTCTGCCGCAGAGCAAGG - Intergenic
1106250163 13:27976930-27976952 GCTGCTGCTGCTGCTAACCCTGG + Intergenic
1106340219 13:28820173-28820195 GCCGCGGCCGCGGCGGAGCCGGG + Intergenic
1106462225 13:29981173-29981195 GCTGCTGCAGCTGCAGAGGCTGG - Intergenic
1106720157 13:32428019-32428041 GCTGCTGCTGCTGCTGGGGCTGG + Exonic
1106776729 13:33016497-33016519 GCTGCTGGTGCTGCTGGGCCTGG + Exonic
1107058519 13:36131240-36131262 GCAGCTGCTGCCGCCCAGCCCGG - Exonic
1107728141 13:43320485-43320507 GATGCTTCTGCAGCAGAGGCCGG + Intronic
1108662738 13:52601147-52601169 GCTGCTGCGGAGGCTGAGGCAGG - Intergenic
1112771532 13:102799472-102799494 GCTGCGGCCGCGGCGGAACCCGG - Exonic
1113376846 13:109772161-109772183 GCGGCTTCTGCCGCAGACCCGGG + Intronic
1113378586 13:109784634-109784656 GCAGCGGATGCGGCAGAGGCGGG + Exonic
1113403604 13:110018299-110018321 GCTGCTGCTGAGGCTGAGGATGG - Intergenic
1113439702 13:110318594-110318616 GCTGTTGCTGCTGCCCAGCCAGG + Intronic
1113734159 13:112665168-112665190 GCACCTGCTGCAGCAGAGGCAGG - Intronic
1113852893 13:113428130-113428152 GCTGCTTCGGCGGCTGAGGCAGG + Intronic
1113899524 13:113788481-113788503 GCCTCTGCTGCGCCAGTGCCAGG - Intronic
1114199913 14:20510507-20510529 GCTGATGCTGCTGCTGGGCCTGG + Exonic
1114399243 14:22394386-22394408 TATGCTGCTGTGGCAGAGCATGG + Intergenic
1114656050 14:24316280-24316302 GCGGCTGCGGCGGAAGCGCCGGG - Exonic
1117107645 14:52414662-52414684 GCTGCTGGTGAGGCTGAGGCAGG + Intergenic
1117258086 14:54000696-54000718 GCTGCTGCAGAGGGTGAGCCAGG + Intergenic
1118324055 14:64769601-64769623 CCTGCTGCAGCGGCAGCACCAGG - Exonic
1118383257 14:65234958-65234980 GCCCCTGCTGTAGCAGAGCCAGG - Intergenic
1119867960 14:77989812-77989834 GCTGATGCAGCGACAGAGGCCGG - Intergenic
1119898812 14:78243070-78243092 GTCGCTGCTGGGACAGAGCCCGG - Intronic
1121023032 14:90593400-90593422 CCCGCTGCTGTGCCAGAGCCTGG - Intronic
1121023044 14:90593441-90593463 CCCGCTGCTGTGCCAGAGCCTGG - Intronic
1121060122 14:90899230-90899252 GGTGCTGCTGGGTCAGAGTCAGG - Intronic
1121111071 14:91313490-91313512 CCTCCGGCTGCAGCAGAGCCTGG - Exonic
1121713095 14:96053608-96053630 GCTGCTGTTGGGGCTCAGCCTGG - Intronic
1121827667 14:97023610-97023632 ATTGCTGCTGCGGCAGAGAGAGG + Intergenic
1122175758 14:99917461-99917483 GCTGCTTCAGAGGCTGAGCCAGG + Intronic
1122260538 14:100517730-100517752 GCTGCTCCTGGGGCTGAGGCAGG + Intronic
1122635341 14:103127120-103127142 GCTGGTGCGGCGCCAGAGCAAGG + Exonic
1122636290 14:103131283-103131305 GCTGCTGCTGCTGCAGGCCGTGG - Intronic
1122917666 14:104866224-104866246 GGTGCCGCTGTGCCAGAGCCAGG - Intronic
1123057319 14:105577518-105577540 GCGGGTGCTGGGCCAGAGCCGGG - Intergenic
1123831596 15:24144999-24145021 GCTGCTGGGGAGGCTGAGCCAGG - Intergenic
1124602705 15:31148382-31148404 GGTGCAGCTGCGCCCGAGCCAGG - Intronic
1124848054 15:33310888-33310910 GCTGAGGCTGAGGCTGAGCCAGG + Intergenic
1125468228 15:39976398-39976420 TCTGCACCTGCGGCACAGCCAGG - Exonic
1125506323 15:40269806-40269828 GCTGCTGCTGCTGCAGGTGCTGG - Intronic
1125510706 15:40291065-40291087 GGAGCTGCTGCGGCAGGGCGAGG - Exonic
1126048007 15:44662554-44662576 GCTGCTGGGGAGGCTGAGCCCGG + Intronic
1127510884 15:59639860-59639882 GCTGCTGCGGAGGCTGAGGCAGG - Intronic
1127803351 15:62496322-62496344 GGTGATGCTGAGGCACAGCCAGG - Intronic
1128341219 15:66823819-66823841 GCAGCTTCTGGGCCAGAGCCGGG - Intergenic
1128535152 15:68484941-68484963 GCTGCTGCTGCTGCGGTGGCCGG + Intergenic
1128567391 15:68710446-68710468 GCTACTGCTGTGGCCTAGCCCGG - Intronic
1128575352 15:68770585-68770607 GCTGCTGGTGCAGCAGGGCTAGG - Intergenic
1129111872 15:73341898-73341920 GCTGCTGCTGGGGGTGAGCATGG + Intronic
1129150355 15:73684399-73684421 GCTGCGGCGGCGACTGAGCCAGG + Exonic
1129188532 15:73924749-73924771 GCAGCTGCTGCAGCAGAGGAGGG - Intergenic
1129293780 15:74588264-74588286 GGGGCTGCTGCGGCAGGACCAGG - Intronic
1129296919 15:74604726-74604748 GCTGTGGCTGTGGCACAGCCCGG + Intronic
1129681493 15:77660888-77660910 GCTGCGGCTGTGCCTGAGCCTGG + Intronic
1129763942 15:78149371-78149393 GCGGCTGTTGCTGCGGAGCCAGG + Exonic
1130110400 15:80959279-80959301 GCTGGAGCTGCCGCAGTGCCTGG + Intronic
1130371115 15:83285533-83285555 ACAGCTGCTGCAGCAGCGCCCGG + Intergenic
1131142923 15:89992308-89992330 GGTGCTGCTGCTGCATAGCCAGG + Intergenic
1132504631 16:301394-301416 CCTGTTGCTGGGACAGAGCCAGG + Intronic
1132513497 16:355072-355094 GCTGCTGCTGTGTCCGGGCCAGG + Intergenic
1132578693 16:675501-675523 GCTGGAGCTGCGCCAGAGCGGGG + Intronic
1132666641 16:1083884-1083906 GTGGCTGCTGTGGCCGAGCCAGG - Intergenic
1132697797 16:1209699-1209721 GCTGCTGCCGAGGCAGGGCCAGG + Intronic
1132712741 16:1276705-1276727 GCTGCTGCTGCTGCTGTTCCTGG - Intergenic
1132714594 16:1284434-1284456 GCTGCTGAGCCGGCAGAGCAGGG - Intergenic
1132807149 16:1780052-1780074 GCTGCTGTTCCGGCTCAGCCAGG - Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133089245 16:3390593-3390615 GCTGCTGATGCGGCTGGCCCAGG - Intronic
1133124874 16:3640290-3640312 GCAGCTGCAGAGGCAGAGCCAGG - Intronic
1133152822 16:3849760-3849782 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
1133188418 16:4116245-4116267 GCAGACGCTGCCGCAGAGCCGGG + Intergenic
1133212375 16:4270850-4270872 GTTGCTGCTGCTGCAGGGCTGGG - Intronic
1133216200 16:4293966-4293988 GCTGCTGCTGCTGCTGAAGCCGG - Intergenic
1133754447 16:8752013-8752035 TCTTCTGCTGCAGAAGAGCCCGG + Intronic
1133847272 16:9466989-9467011 CCTGCTGCTGGGGCTGCGCCTGG - Intergenic
1133980216 16:10627729-10627751 GCTGCGGCTGCGGGAGACACAGG - Exonic
1134062031 16:11205097-11205119 GCGGCTCCTGTGGCAGAGGCTGG - Intergenic
1134162259 16:11901060-11901082 GCTGCTCCGGGGGCTGAGCCTGG + Intronic
1134164036 16:11915854-11915876 GCTGCTGCCGCGGCGACGCCGGG - Exonic
1134849821 16:17470706-17470728 GGTGCTGCTGCTGCAGACGCTGG - Exonic
1135091521 16:19521880-19521902 GCTGCTGGTGACGCGGAGCCCGG - Exonic
1135167784 16:20156086-20156108 GCTGTTGCTGCTGCAGACACAGG - Intergenic
1136025944 16:27469256-27469278 GCTGGTGCTGTGGGAGGGCCTGG - Intronic
1136115350 16:28091067-28091089 GCTGGTGGAGCGCCAGAGCCTGG - Intergenic
1136394621 16:29986339-29986361 GCTGGAGCTGCGGCAGCTCCAGG + Exonic
1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG + Intergenic
1137786471 16:51141501-51141523 TCTGCTGCTGCTGCAGAGCTAGG + Exonic
1139347965 16:66316655-66316677 GCTGCTGCTGCTGCAGATTGAGG + Intergenic
1139805945 16:69565800-69565822 GCTGCTGCTGTTCCTGAGCCGGG - Intronic
1139818104 16:69693620-69693642 GCTGCTGCTGCTGCTGTTCCTGG - Exonic
1139965267 16:70741881-70741903 GCTGCTTGGGCGGCAGGGCCAGG - Intronic
1140287067 16:73613847-73613869 CCTGCTGCTGCGGCAGGGGGAGG + Intergenic
1141283785 16:82652644-82652666 GCTGCTGCTGCTGCTGAGGTTGG + Intronic
1141463144 16:84190140-84190162 GCTGCTGCTGAAGCTGGGCCTGG - Intergenic
1141463146 16:84190146-84190168 GCTGCTGCTGCTGCTGAAGCTGG - Intergenic
1141620506 16:85234744-85234766 GCTGCTGCGGGGGCGGAGCCGGG - Intergenic
1141722157 16:85762450-85762472 GCTCCTGCTGCGTCAGGGCAGGG - Intergenic
1141993345 16:87622507-87622529 GCAGCAGCTGTGGCAGGGCCGGG + Intronic
1142200894 16:88760701-88760723 GGTGCTGCTGCGTCAAAGGCGGG - Intronic
1142246074 16:88970644-88970666 GCTGGTGCTGAGGCAGGGACTGG - Intronic
1203146848 16_KI270728v1_random:1808432-1808454 GCTGGGGCTGTGGCAGGGCCAGG + Intergenic
1142685655 17:1575663-1575685 GCGGCAGCTGCAGCAGAGGCAGG - Exonic
1142867566 17:2799969-2799991 CCTGCTCCTGGGGCAGACCCTGG - Intronic
1143053112 17:4142915-4142937 GCGGCGGCGGCTGCAGAGCCAGG - Exonic
1143628272 17:8123036-8123058 GCTGCTGCTGGAGCGGACCCGGG - Exonic
1144207918 17:12992347-12992369 CCTGCTGCTGCTACAGAGCAGGG - Intergenic
1144615256 17:16765279-16765301 GCTGCTCCTGAGGCTGAGGCAGG + Intronic
1144865535 17:18333059-18333081 GCAGCTGCAGCAGCAGAGCCTGG + Intronic
1144872861 17:18381390-18381412 CCTGCTGGTGCTGCAGGGCCTGG - Exonic
1144891043 17:18494559-18494581 GGTGCTGCTGCGGCTGAGGAAGG - Exonic
1144897445 17:18550377-18550399 GCTGCTCCTGAGGCTGAGGCAGG - Intergenic
1144930921 17:18858222-18858244 GCTGAGGCTGCGGCGGGGCCGGG + Exonic
1145014308 17:19386811-19386833 GCAGCAGCAGCGGCAGGGCCAGG + Exonic
1145134927 17:20395340-20395362 GCTGCTCCTGAGGCTGAGGCAGG + Intergenic
1145794743 17:27649174-27649196 GGTGCTGCTGCGGCTGAGGAAGG - Exonic
1147160708 17:38568038-38568060 GCTGCTGCTTTGGGAGAGTCTGG - Intronic
1147210672 17:38870818-38870840 GGGGCTCTTGCGGCAGAGCCCGG - Intronic
1147366972 17:39965567-39965589 GCTCCTCCTGCCTCAGAGCCGGG + Intronic
1147559936 17:41502525-41502547 CCTGCAGCTGCAGCAGATCCAGG - Exonic
1147661870 17:42121147-42121169 GCTGCAGCTGGGGCAGGGGCTGG + Exonic
1147670100 17:42171929-42171951 GCTGCGGCTGCTGCAGAAGCTGG - Exonic
1147701284 17:42396995-42397017 GCTTCTTCTGTGTCAGAGCCAGG - Intergenic
1147948486 17:44093667-44093689 GCTGCTGCTGCTTGAGCGCCAGG + Exonic
1147949259 17:44097882-44097904 GCTGCTGCAGTGGCAGTGACAGG - Intronic
1147981856 17:44279825-44279847 GCTGCTGCCCCGCCAGAGCCTGG - Intergenic
1147988593 17:44320226-44320248 GCTGCTGCTGCGGAGGATCCGGG - Exonic
1148053926 17:44782317-44782339 GCTGGGGCTGCGTCTGAGCCAGG + Intergenic
1148083125 17:44978362-44978384 GCTGCTGCTCTGCCAGAGGCTGG - Intergenic
1148283246 17:46365484-46365506 GCTACTGGGGCGGCTGAGCCAGG - Intergenic
1148305464 17:46583405-46583427 GCTACTGGGGCGGCTGAGCCAGG - Intergenic
1148747017 17:49924194-49924216 GATGCTGCTGAGGCTAAGCCAGG + Intergenic
1148853895 17:50568122-50568144 GCTGCTACAGCACCAGAGCCCGG - Intronic
1149649620 17:58268725-58268747 GCTTCAGCTGCGGGAGACCCAGG - Intergenic
1150115330 17:62543417-62543439 GCAGCTGCTGTGGAAGAGTCTGG - Intronic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1151717144 17:75836687-75836709 GCTCCTCCTGCTGAAGAGCCAGG + Exonic
1151748387 17:76023609-76023631 CCTGCTGGTGCTGCAGGGCCTGG + Exonic
1152039363 17:77892992-77893014 GGAGCGGCTGCGGGAGAGCCTGG - Intergenic
1152071162 17:78134423-78134445 GCTGATGCAGCAGCAGACCCGGG + Exonic
1152120423 17:78415000-78415022 GAAGCTGCTGCTGCAGGGCCTGG - Exonic
1152466417 17:80469186-80469208 TCTGCAGCTGCAGCTGAGCCAGG + Exonic
1152499134 17:80696607-80696629 CCGGCTGGTGCGTCAGAGCCTGG + Intronic
1152503518 17:80729998-80730020 GCGGCAGCTGCGGAGGAGCCTGG + Intronic
1152514702 17:80816541-80816563 GCTGCCGCTGGAGCAGATCCTGG + Intronic
1152674189 17:81628988-81629010 GCTGCTGGTGAGGCTGAGGCAGG - Intronic
1152743305 17:82028032-82028054 CCTTCTGCTCCGACAGAGCCAGG - Exonic
1152747977 17:82049947-82049969 GCCTCTGCTGAGGCAGAACCCGG + Exonic
1152764212 17:82127287-82127309 CCTGCTCCTGGGGAAGAGCCAGG - Intronic
1152885274 17:82845654-82845676 GATGCTGCTGCGGAAGGGACCGG - Intronic
1152899804 17:82934012-82934034 ACCGCTGCTGGGGCAGTGCCGGG + Intronic
1153073392 18:1132708-1132730 GCTGCTGCGGGTGCAGATCCTGG - Intergenic
1153796313 18:8625937-8625959 GCTGCAGCTGCGGCCCAGACAGG - Intronic
1156203614 18:34861372-34861394 GCTGCTGCAGAGGCTGAGACAGG + Intronic
1157534640 18:48449353-48449375 GATCCTTCTGGGGCAGAGCCTGG + Intergenic
1157610306 18:48951510-48951532 GCTGCGGCGGCGGCTGAGCCCGG + Intergenic
1157794944 18:50564804-50564826 CCTGCTGCTTGGGCAGTGCCTGG + Intronic
1160021330 18:75184156-75184178 CCTGCTTCTGCGGCAGAGCTGGG - Intergenic
1160073899 18:75653632-75653654 GCTGCAGCACCTGCAGAGCCAGG + Intergenic
1160462102 18:79047120-79047142 GCGGCTGCTGCGAAAGAGCAAGG - Intergenic
1160509498 18:79445284-79445306 GCAGCCACTGCTGCAGAGCCAGG - Intronic
1160565930 18:79786576-79786598 GCACCTGCTGGGGCAGGGCCAGG + Intergenic
1160701091 19:507773-507795 GCTGCTGCTGCAGCAGGAGCTGG - Exonic
1160701093 19:507779-507801 CCTGCTGCAGCAGCAGCGCCTGG + Exonic
1160818571 19:1047494-1047516 CCTGCTCCTCCAGCAGAGCCAGG - Exonic
1161074009 19:2276231-2276253 GCTGCTGCTGCAGCTGAGCGCGG - Exonic
1161235652 19:3196792-3196814 GCTGCTGCTGCAGCACTGGCAGG + Intronic
1161302009 19:3547361-3547383 ACTTCTGCGGAGGCAGAGCCAGG + Exonic
1161304033 19:3557205-3557227 GCTGCTGCTGCTGCTGGGCCAGG - Exonic
1161407656 19:4099408-4099430 GCTCCGGCTGCAGCAGAGCCAGG + Exonic
1161447997 19:4328721-4328743 CCTGCTGCTGCGGCCCAGCGGGG - Exonic
1161648219 19:5467481-5467503 GCTGCTGCTGCGGGGGTGGCAGG + Intergenic
1161725782 19:5927770-5927792 GCTGCTGGTGGGGAAGTGCCAGG + Intronic
1161816817 19:6504268-6504290 GCTACTGGGGCGGCTGAGCCAGG - Intergenic
1162125749 19:8498754-8498776 GCTGCTGCAGCCGGAGCGCCGGG - Exonic
1162394051 19:10405801-10405823 GTTGCTGCTGCCCCAAAGCCTGG - Intronic
1163124758 19:15238895-15238917 GCTGCTGCTGCTGCTGCTCCTGG + Exonic
1163125678 19:15243101-15243123 GCTGCTGCTGGGGTGGAGGCTGG + Exonic
1163313841 19:16529774-16529796 GCTGCTGCTGCTGCTGGGCCAGG + Exonic
1163563902 19:18038311-18038333 GCTGCTGGGGCGGCTGAGGCAGG - Intergenic
1163696834 19:18768502-18768524 GCAGCTGCTGCTCCAGAGACAGG - Exonic
1165144532 19:33722828-33722850 GCAGCTGCAGAGGCTGAGCCAGG - Intronic
1165556130 19:36634100-36634122 GCTGCTGATGAAGCAGAGCTAGG - Intergenic
1165830018 19:38725822-38725844 GCTGCTGCTCCAGCAGGTCCAGG - Exonic
1165860677 19:38907613-38907635 GCTACTGCTGCTGCAGGGGCCGG - Exonic
1166299121 19:41904244-41904266 GCTGCTGCTGCTCCAGCGCCAGG + Exonic
1166503686 19:43358677-43358699 GCTGTTTCGGCGGCAGAGCTGGG - Intronic
1166506768 19:43376081-43376103 GCTGTTTCGGCGGCAGAGCTGGG + Intergenic
1166694848 19:44846585-44846607 GCTGCTGCTGCTGCTGCTCCTGG + Exonic
1166898563 19:46040289-46040311 GCAGCTGGAGCCGCAGAGCCGGG + Exonic
1167358199 19:49016684-49016706 GCTGTTGCTGCTGCTGAGCATGG - Exonic
1167359697 19:49023573-49023595 GCTGTTGCTGCTGCTGAGCATGG - Exonic
1167361434 19:49032512-49032534 GCTGTTGCTGCTGCTGAGCATGG + Exonic
1167362219 19:49036273-49036295 GCTGTTGCTGCTGCTGAGCATGG - Exonic
1167363864 19:49044585-49044607 GCTGTTGCTGCTGCTGAGCATGG + Exonic
1167364634 19:49048342-49048364 GCTGTTGCTGCTGCTGAGCATGG - Exonic
1167365919 19:49054978-49055000 GCTGTTGCTGCTGCTGAGCATGG - Exonic
1167435365 19:49475702-49475724 CCTGCTGCTGCTGCTGAGCTCGG + Exonic
1167513372 19:49908846-49908868 CCTGCAGCTGCGCCAGGGCCAGG + Exonic
1167696622 19:51019067-51019089 GCAGCAGCTTCGCCAGAGCCCGG + Exonic
1167738666 19:51311662-51311684 GCTGGAGCTGCTGCAGACCCGGG - Intergenic
1167744684 19:51343614-51343636 GCTGCTGCAGAGGCTGAGACGGG - Intergenic
1167847033 19:52173002-52173024 GCTGCTCCGGAGGCAGAGGCAGG + Intergenic
1168115198 19:54218410-54218432 GCATCTGCTGGGGCAGAGCAAGG + Exonic
1168124478 19:54276000-54276022 GCATCTGCTGGGGCAGAGCAAGG + Exonic
1168152017 19:54454465-54454487 GCAGCTGCTGAGGGGGAGCCTGG - Exonic
1168177508 19:54635538-54635560 GCATCTGCTGGGGCAGAGCAAGG - Exonic
1168268942 19:55239349-55239371 GCGCCTGCTGCTGCAGAGGCAGG + Intronic
1168295787 19:55376886-55376908 GCTCCTGCTGCTGCAGGGCTCGG + Exonic
1168337102 19:55602959-55602981 GCTGGTGCTGGGCCTGAGCCAGG + Exonic
1168471726 19:56645727-56645749 TCTGCTGCCTCGGGAGAGCCGGG + Exonic
1202710874 1_KI270714v1_random:18833-18855 GCAGCTGCTGAGGCAGCGGCAGG - Intergenic
925607480 2:5673510-5673532 GCTGCGGGTGCAGCGGAGCCAGG - Intergenic
925665216 2:6246921-6246943 GCTGCTGGGGAGGCAGAGGCAGG + Intergenic
925960814 2:9013565-9013587 GCTGCTGCTGCAAGGGAGCCTGG + Intergenic
926167916 2:10533038-10533060 GCTGATGGTCCCGCAGAGCCAGG - Intergenic
926980398 2:18561302-18561324 GCTGCTGCTGCTGCAGATCTGGG + Intronic
926990765 2:18677297-18677319 GCTGCTGGAGGGGCAAAGCCAGG + Intergenic
927217733 2:20677961-20677983 GCTGCTGCTGCTGCTGCCCCAGG - Intergenic
927243825 2:20941085-20941107 GCCGCTGCTCGGGCAGGGCCAGG + Intergenic
927391899 2:22605419-22605441 TCTGCTGCTGTCCCAGAGCCGGG - Intergenic
927927513 2:27024206-27024228 TCTGCTGGCGCGGCAGGGCCAGG + Exonic
928374489 2:30763834-30763856 AATGCTGCTGCGCCAGAGCCTGG - Intronic
928667015 2:33559536-33559558 GCTCATGCGGAGGCAGAGCCTGG - Intronic
929539628 2:42810100-42810122 GCTGGGGCTGGGGCTGAGCCGGG - Intergenic
930011486 2:46941242-46941264 GCGGCGGCGGCGGCAGCGCCAGG + Exonic
931087483 2:58849097-58849119 GCTACTGGTGCGGCTGAGGCAGG + Intergenic
932757877 2:74421505-74421527 GCTGGGGATGCGCCAGAGCCAGG - Intronic
933673780 2:85034731-85034753 GCTGCTCCGGAGGCTGAGCCAGG - Intronic
933813586 2:86048520-86048542 GCTGCTCATGCAGCGGAGCCAGG - Intronic
934560079 2:95308612-95308634 TCTGCTGCTGCTGCAAAGGCTGG - Intronic
934710137 2:96509022-96509044 GCTGCTTAGGCGGCAGACCCGGG - Intergenic
934744856 2:96752680-96752702 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
934754697 2:96816868-96816890 GCTGCTGCTGCTGGCCAGCCTGG + Exonic
935192998 2:100793357-100793379 GCTGGTGCGGAGCCAGAGCCGGG - Intergenic
936058643 2:109280222-109280244 GCTGCTGCTTCTCCACAGCCAGG - Intronic
936111588 2:109670127-109670149 GCTACAGCTGCAGAAGAGCCTGG + Intergenic
936290270 2:111217452-111217474 GCAGCTGCAGCTGCAGACCCAGG - Intergenic
936521121 2:113212709-113212731 GCTGCTGTTGCTGCAGAGTCGGG - Intergenic
936572471 2:113627948-113627970 GCTACTGCTTCTGCACAGCCAGG - Intronic
936598126 2:113868889-113868911 TCTGCTGCTGCTGCTGTGCCTGG - Intergenic
937132522 2:119524193-119524215 GCTGCTGCAGCGGCGGCGACAGG + Exonic
937259900 2:120578591-120578613 GCTGCTGCAGAGCCAGGGCCTGG - Intergenic
937322724 2:120970563-120970585 GTTGCTGCTGCTGCTGAGCTGGG - Exonic
937543612 2:122988961-122988983 GCAGCTGCAGCTGCACAGCCCGG - Intergenic
937668595 2:124515269-124515291 GCTGATACTGGGGCAGAGCGGGG + Intronic
937930275 2:127199420-127199442 TCTCCTGCAGCGTCAGAGCCTGG + Exonic
938201836 2:129378414-129378436 GCAGATATTGCGGCAGAGCCAGG - Intergenic
938305472 2:130251644-130251666 GCAGCTGCTGGGGCAGGACCTGG - Intergenic
938435526 2:131281182-131281204 CCTGCTGCAGAGGCAGAGGCTGG + Intronic
938922728 2:136009771-136009793 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
938927651 2:136059164-136059186 GCTGCTGCTTAGGCAGAACTGGG - Intergenic
942277972 2:174336425-174336447 GCTGCCGCGGCGGCAGCGGCCGG + Exonic
942558730 2:177198586-177198608 CCTGCGGCTGCCCCAGAGCCCGG + Intergenic
943684378 2:190802225-190802247 GCTTCTGCAGCAGCAGTGCCTGG - Intergenic
943736884 2:191366039-191366061 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
944172977 2:196799737-196799759 GCTGCAGCTGCGGCGCAGACCGG - Intergenic
944265981 2:197727266-197727288 TCTGCTGCTGCTGCTGAGCATGG + Exonic
944686929 2:202125833-202125855 GCTGCTGCTGCTTCAGACCAAGG + Intronic
946154217 2:217796536-217796558 GGTGGTGTTGAGGCAGAGCCCGG + Intergenic
946306629 2:218860073-218860095 GCTGCTGCTGCTCCTGTGCCCGG + Exonic
946307833 2:218866081-218866103 GCTGCTGAGGCGGCTGGGCCGGG - Intronic
946493192 2:220170199-220170221 GCAGTGGCTGTGGCAGAGCCTGG + Intergenic
947476158 2:230449366-230449388 GTTCCTGCTGCCGCTGAGCCTGG + Intronic
947809809 2:232997251-232997273 GCTGCTGCTGGGGCTGAGACTGG + Intronic
947834875 2:233167891-233167913 GCTACTCCTGAGGCAGAGACAGG + Intronic
947971575 2:234329273-234329295 GCTGTCACTGGGGCAGAGCCTGG - Intergenic
947992256 2:234497053-234497075 GCGGCTGCTGCGGCGGCGCGGGG - Exonic
948174701 2:235934105-235934127 GCTGCTGCTGCTGCTGCTCCTGG - Intronic
948227062 2:236319371-236319393 GCTGCAGCCTGGGCAGAGCCTGG - Intergenic
948231140 2:236350564-236350586 GAGGCTGCTGAGGCAGAGCCAGG + Intronic
948572234 2:238924943-238924965 GCGGCTGCTGTCGCAGAGGCAGG - Intergenic
948630738 2:239301046-239301068 CCTGCTGCTGCTGCTCAGCCGGG + Intronic
948809271 2:240466580-240466602 GCTGCTTCTGCGGCGGTGCAGGG - Exonic
948817579 2:240520484-240520506 GCTGCTGCTGCGCCGGGGCGCGG - Exonic
1168958886 20:1854763-1854785 GCTGCTGCTGCTGCTGGTCCTGG - Intergenic
1169065615 20:2692929-2692951 GCTGCTGCTGCTGCTGCTCCAGG + Exonic
1169216574 20:3797648-3797670 GCTGCGGCTGCGGAAGAGCAGGG - Exonic
1169664521 20:8019499-8019521 GCTGCCGCCGGAGCAGAGCCGGG - Exonic
1171035208 20:21708291-21708313 GCTGCTGCTGAGTCAAAGCCTGG - Intronic
1171236490 20:23529948-23529970 GCTTCTTCTGGGGCAGAGCAGGG - Intergenic
1171344859 20:24458522-24458544 TCTGCTCCTGGGGCAGTGCCAGG - Intergenic
1171533708 20:25868323-25868345 GCTGCAGCTGCGGCGGCGGCTGG + Intergenic
1172045429 20:32076742-32076764 GCTGCTGCTGCTGCTGCTCCAGG + Intronic
1172293357 20:33791433-33791455 CCTGCAGCTCCGCCAGAGCCAGG - Exonic
1172350392 20:34234700-34234722 GCTGAGGCTGAGGCTGAGCCAGG + Intronic
1172406681 20:34694934-34694956 GCTGCTGCAGAGGCTGAGACAGG + Intergenic
1172413007 20:34740548-34740570 GGTCCTGCTGAGGCAGTGCCCGG + Exonic
1172484901 20:35292175-35292197 GCTGGTGCTGCGGCACAGCGAGG - Exonic
1172970933 20:38872627-38872649 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
1173518411 20:43681629-43681651 GCTGCTGCAGCTGTAGTGCCTGG + Intronic
1173942934 20:46927320-46927342 GCTGCTGCAGCGGGAGATCCCGG - Intronic
1174734996 20:52957376-52957398 GCTGCTGCTGCTGCTGATCCAGG - Intergenic
1175166053 20:57045473-57045495 GCTGCTGATGCTGCAGGCCCGGG - Intergenic
1175362638 20:58425693-58425715 GCTGCTGCTGCTGCTGGCCCAGG - Intronic
1175641457 20:60633849-60633871 GATGGTGCAGCGGCAGTGCCTGG + Intergenic
1175794412 20:61762709-61762731 GCTTCTGTAGCTGCAGAGCCTGG - Intronic
1175894739 20:62331055-62331077 GCTGCTGATGCAGCTGACCCGGG + Exonic
1175908484 20:62393357-62393379 GCTGATGCTGCTGCAGTCCCTGG + Intronic
1176030210 20:63007991-63008013 GCTCCTCCTGGGGCGGAGCCTGG - Intergenic
1176179342 20:63742114-63742136 GCCCCTGTTGCTGCAGAGCCCGG + Exonic
1176236538 20:64056264-64056286 GGTGCTGCAGTGGCATAGCCAGG + Intronic
1176303445 21:5111009-5111031 GCTGCTGCTGAATCAGGGCCTGG + Intergenic
1177237572 21:18412732-18412754 GCTGCTGCTGCTGCTGAGTTGGG + Intronic
1177431710 21:20998306-20998328 GCCGCGGCGGCAGCAGAGCCGGG - Exonic
1178534928 21:33403410-33403432 GCTGCTGCTCGGGAAGAGGCGGG + Exonic
1179299106 21:40090524-40090546 GCTGCTGCTGCTGGAAAGTCAGG - Intronic
1179422407 21:41247333-41247355 GCTGCAGCTGCGCCAGTGGCTGG - Intronic
1179541411 21:42085453-42085475 GCAGCTGCTCAGGCAGACCCAGG + Intronic
1179552749 21:42153917-42153939 GCTGCTCCTGCTGCTGGGCCGGG - Intergenic
1179595980 21:42443571-42443593 GCTGCTGCTGCTGCAGTAACCGG + Intronic
1179714144 21:43279159-43279181 GCAGCTGGTGTGGCAGAGGCAGG + Intergenic
1179853587 21:44150941-44150963 GCTGCTGCTGAATCAGGGCCTGG - Intergenic
1179967890 21:44817620-44817642 GCTGCTGCTCCTGCAGAGCGCGG - Intronic
1179971435 21:44838231-44838253 GCTGCTGGTCCCGCAGAGCTGGG + Intergenic
1179971438 21:44838253-44838275 GCAGCTGCTGCCTCAAAGCCTGG + Intergenic
1179988538 21:44933878-44933900 GCTGCCTCTGAGGCAGGGCCCGG + Intronic
1180097103 21:45560930-45560952 GCAGCAGCTGAGGCTGAGCCAGG - Intergenic
1180188821 21:46153201-46153223 GCTGCCGCTGGGGCAGGGCTGGG - Intronic
1181104628 22:20566625-20566647 GCAGCTGCTGGGGCAGAGCCTGG - Exonic
1181125943 22:20702586-20702608 GCTGCTGCGGAGGCGAAGCCAGG + Intergenic
1181174229 22:21026892-21026914 GCTCCTGCTGCGTCTGGGCCTGG + Exonic
1181430423 22:22878096-22878118 GGTGCTGCTGGGGCAGTGACAGG - Intronic
1181649499 22:24250987-24251009 GCTGCTCCGGCGGCTGAGACAGG - Intergenic
1181707872 22:24659759-24659781 GCTGCTCCGGCGGCTGAGACAGG + Intergenic
1181725133 22:24806230-24806252 GCTGCTGCTGCAGCCGCGGCGGG - Intronic
1182041020 22:27239221-27239243 GCTGCAGCTGACACAGAGCCTGG - Intergenic
1182122983 22:27798965-27798987 GCTGCTGCTGTTGCAGGGACTGG + Exonic
1182353201 22:29710413-29710435 GCAGCTGCTGCGGCCAAGTCAGG - Intergenic
1182428551 22:30287339-30287361 GCTGGTGCTGATGCAGAGCAGGG - Intronic
1182445485 22:30387205-30387227 GCTGCCGCTGTGGCTGGGCCTGG - Exonic
1182463713 22:30501141-30501163 GCTACTGCTGAGGCTGAGCTTGG - Intronic
1182498967 22:30731828-30731850 GCTGCTGCTGTGGCCGGTCCTGG + Intronic
1183222211 22:36522708-36522730 GTTGCTACTGCGGCAGTGTCGGG + Intronic
1183370204 22:37427744-37427766 GCAGCTGCAGCGGCGGCGCCAGG - Intergenic
1183370206 22:37427753-37427775 GCCGCTGCAGCTGCAGCGCCCGG + Intergenic
1183463522 22:37967560-37967582 GTTCCTTCTGCGGCAGAGCTGGG + Intronic
1183489112 22:38107402-38107424 GCTGCTGGATCGACAGAGCCAGG + Intronic
1183601585 22:38843471-38843493 GCTGCTGCTGCTGCAGAGCACGG - Exonic
1183606897 22:38871453-38871475 GATGCTGCTGGGGCTGGGCCAGG + Intronic
1183945759 22:41324909-41324931 GCTGCTGCAGCAGGAGTGCCAGG - Intronic
1183953726 22:41367265-41367287 GCTGCAGCTGGCGCAGGGCCAGG + Intergenic
1184075537 22:42174921-42174943 GCTGCTGGGGCGGCTGAGGCAGG + Intronic
1185138880 22:49089320-49089342 GCCTCTGCTGGGGCAGACCCTGG - Intergenic
1185329752 22:50246920-50246942 GTGGCTGCTGCAGCAGAGGCTGG + Exonic
1185427716 22:50782931-50782953 GCTACTGCTTCTGCACAGCCAGG + Exonic
950148832 3:10670527-10670549 GCTACTCCTGAGGCAGAGGCAGG - Intronic
950494371 3:13324812-13324834 GCTGCTGCTGCTGCTGTTCCAGG - Intronic
950515270 3:13460804-13460826 GCTGCTGCTGTGGCGGGGGCTGG + Intergenic
950710554 3:14810581-14810603 GCGGCGGCTGGGGCAGCGCCGGG - Intergenic
951543602 3:23806023-23806045 GCTGCGGCTGCGGCTGGGCCTGG - Exonic
951543604 3:23806029-23806051 GCTGCTGCTGCGGCTGCGGCTGG - Exonic
951849804 3:27126557-27126579 GCTGCTGCTGCTGCTGATCCAGG - Intronic
952662723 3:35871105-35871127 GCTGCTGCTGCTGCTGACACAGG - Intergenic
953405358 3:42657149-42657171 GAGGCTGCTGTGGTAGAGCCGGG + Intronic
953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG + Intronic
954069351 3:48131457-48131479 CCTGCTGCTGCGGCTGCTCCAGG + Intergenic
954110208 3:48429336-48429358 GCTGCGGCTCCGCCAGACCCGGG - Exonic
954442697 3:50530467-50530489 CCGGCTGCTGCGGCGGGGCCGGG + Intergenic
954853369 3:53622160-53622182 GCTACTGCTGAGGCTGAGGCAGG - Intronic
955387630 3:58492135-58492157 GCGGCTGCTGCGGCCGGGCCGGG - Intronic
956604048 3:71053656-71053678 GCTGCTGCTGGAGGAGAACCTGG + Exonic
957939816 3:86990852-86990874 GCTGCTACTGCGGCGAAGGCGGG + Exonic
960573430 3:119206855-119206877 GCTGGGGCTGGGGCTGAGCCTGG - Intergenic
960848202 3:122023782-122023804 GCTGCTGCTGCTGCTGTGCTAGG - Intergenic
961457080 3:127029600-127029622 GCTGCTGCAGCGTGGGAGCCCGG - Intronic
961458906 3:127038027-127038049 GCTGCTCCTGCCGCAGAGGGTGG + Intergenic
961509394 3:127391770-127391792 ACAGCTCCTGCAGCAGAGCCTGG - Intergenic
962444246 3:135450590-135450612 TCTGCTGCTGCCTCAGAGGCAGG + Intergenic
962847944 3:139287451-139287473 GCTGCTGCTGCTGCTGAGCTGGG + Intronic
963916354 3:150862128-150862150 GCTAAGGCTGAGGCAGAGCCTGG - Intergenic
964421549 3:156509392-156509414 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
964789344 3:160437240-160437262 GCTGCTCCAGAGGCAGAGGCGGG + Exonic
964791058 3:160453357-160453379 GCAGCTGCAGCGGCAGGGCCAGG + Intronic
966003582 3:174980386-174980408 GCTGCTGCAGAGGCTGAGCCAGG + Intronic
966853394 3:184177964-184177986 GCTGCAGCTGTGGCAAGGCCTGG + Intronic
967858511 3:194135078-194135100 GCCGCGGCTGCGGCCGGGCCGGG - Intergenic
967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG + Intergenic
968046794 3:195628626-195628648 GCAGATGCTGCGGAACAGCCTGG - Intergenic
968092924 3:195909432-195909454 GCTGCTGCTCCGGCAGCGCAGGG + Intronic
968433815 4:575171-575193 GCTGCAGCAGCGGCCGAGCGAGG - Intergenic
968613758 4:1568370-1568392 GGTGCTGCTGGGCCGGAGCCTGG - Intergenic
968698103 4:2042405-2042427 GCTGCTGCTGCTGCTGAGTCTGG + Exonic
968871656 4:3245707-3245729 GCTGCTGGGGCTGCAGAGCCTGG - Intronic
969296024 4:6270911-6270933 GAAGCTGATGGGGCAGAGCCTGG + Intronic
969434889 4:7183299-7183321 TCTGCTGCTGCAGCCCAGCCTGG + Intergenic
969481911 4:7451266-7451288 GCTGCTGCTGCTGAAGACCTAGG - Intronic
970202890 4:13627515-13627537 GCTGCGGCTGCGGCTGCGGCGGG + Exonic
971005518 4:22370267-22370289 ACTGGTCCTGCGGCAGTGCCTGG - Intronic
971195705 4:24470765-24470787 GCTGCTGCTGCCGCGGCGGCGGG + Intergenic
971457819 4:26860853-26860875 GCTGCTGCTGCGGCGAGACCGGG - Exonic
971457907 4:26861191-26861213 GCTGCTGCGGCGGCGGCGCTGGG + Exonic
971766843 4:30843311-30843333 GCTACTCCAGCGGCAGAGGCAGG - Intronic
972496345 4:39638625-39638647 GCGGCGGCTGCGGCAGAACAGGG - Intronic
972809018 4:42562406-42562428 GCTGCTGCTGCTGCTGCTCCTGG + Intronic
973759118 4:54100774-54100796 GCCGCCGCCGCGGCCGAGCCAGG - Exonic
974788697 4:66657044-66657066 GCTACTCCTGCGGCTGAGGCAGG + Intergenic
974968299 4:68792446-68792468 GCTGCTGCTGCGCTCCAGCCTGG + Intergenic
975983497 4:80183919-80183941 CCAGCTGCTGCAGCAGAGACCGG + Intronic
977167017 4:93711755-93711777 GCTGCTGCTGGGGCATGGGCGGG + Intronic
978503437 4:109433473-109433495 GCTGCTGCTCCGGCCCGGCCAGG - Intergenic
978701767 4:111655370-111655392 GCTGCTGGGGCGGCTGAGGCAGG - Intergenic
979099642 4:116598994-116599016 GCTGCTGCTCCAGCAGGTCCAGG - Intergenic
979349669 4:119628981-119629003 GCGGCGGCAGCGGCAGCGCCCGG + Exonic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
980752688 4:137112506-137112528 GCTGCTCAGGAGGCAGAGCCAGG - Intergenic
980932049 4:139191569-139191591 ATGGCTGCTGGGGCAGAGCCAGG - Intergenic
982157458 4:152536014-152536036 GCAGCGGCAGCGGCAGCGCCCGG + Exonic
982176501 4:152710151-152710173 GCTCCTGCTGGGGCAGGACCTGG - Intronic
982257621 4:153466221-153466243 GCTGCTGCAGCTCCAGACCCGGG - Intergenic
982257626 4:153466236-153466258 GCAGCAGCTGCGGCAGCGGCGGG + Intergenic
982765772 4:159346877-159346899 GCTGCTGCTGGGGCTGTGGCAGG - Exonic
983491741 4:168397899-168397921 GCAGCTGCAGCTGCAGACCCAGG + Intronic
984201430 4:176725413-176725435 GCTGCTGAGGAGGCAGAGGCAGG - Intronic
984829747 4:183961373-183961395 GCTGCTGCTGCTGCATAGAACGG + Intronic
984883753 4:184431737-184431759 GCTGCAGCTGAGCCTGAGCCTGG + Intronic
985093820 4:186392077-186392099 GCTGCTGCTGCTGCAGGACAGGG - Intergenic
985445932 4:190021405-190021427 CCTGCTCCTCCAGCAGAGCCCGG + Intergenic
985503652 5:265314-265336 ACTGCTCCTGGGGCAGAGCTAGG - Intergenic
985517781 5:355784-355806 ACTGCAGCTGCGGCAGAGGTGGG - Intronic
985570164 5:640526-640548 GCTGCTGCTGCTGCTCAGCAAGG - Exonic
985579389 5:688988-689010 GCTGCTGGTGCCTCAGGGCCAGG - Intronic
985594235 5:781047-781069 GCTGCTGGTGCCTCAGGGCCAGG - Intergenic
985744814 5:1640518-1640540 GCAGATGCTGCGGAACAGCCTGG + Intergenic
989523096 5:42423825-42423847 GCGGCGGCTGCTGCTGAGCCCGG + Intronic
990308730 5:54518264-54518286 GCTGTGGCTGCAGCAGCGCCTGG - Exonic
991688276 5:69201745-69201767 GCTGCTTCTGAGGCTGAGGCAGG + Intronic
992151578 5:73909699-73909721 GGAGCTGCTGCTGCGGAGCCGGG + Exonic
992372925 5:76163581-76163603 GGTGGTGCTGGGGCAGAGTCAGG - Intronic
992487434 5:77210401-77210423 GCGGCTGCGGCCGCGGAGCCGGG + Intergenic
992837474 5:80654872-80654894 GCTGCAGCCGCTGCAGCGCCAGG - Exonic
993902278 5:93592687-93592709 GCTGCTGCTGCTTCAGAACTGGG - Intronic
994046370 5:95314906-95314928 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
994320715 5:98392000-98392022 CCTGCGGCTGCCCCAGAGCCCGG - Intergenic
994487954 5:100402678-100402700 GCTGCTGCGGAGGCTGAGGCAGG + Intergenic
997338020 5:133121591-133121613 GCTCCTGCTACAGCAGAGCTCGG - Intergenic
997395817 5:133558957-133558979 GCTTCAGCTGGAGCAGAGCCAGG - Intronic
997612689 5:135226319-135226341 GCTGCTGCTGCGCCCGGCCCGGG + Intronic
997643737 5:135466735-135466757 GCTGCTGCTACGGCAGGCCCTGG - Intergenic
997984105 5:138490008-138490030 GCTGGGGCTGCTGCAGTGCCAGG + Intergenic
998794439 5:145803204-145803226 TCTGCAGCAGCAGCAGAGCCAGG - Intronic
999539671 5:152557729-152557751 CCTGGTGCTGAGGCAGAGCCTGG - Intergenic
1000091230 5:157931313-157931335 GCTGCAGGGGCTGCAGAGCCTGG + Intergenic
1000209889 5:159099245-159099267 GCAGCTGCTGCCGCGGGGCCGGG - Intronic
1001228253 5:169963930-169963952 GATGCTGCTGCTGCAGCTCCAGG + Intronic
1001376701 5:171266534-171266556 GCTGCTCCAGAGGCAGAGGCAGG + Intronic
1001389878 5:171370265-171370287 GCTACTGGGGCGGCTGAGCCAGG - Intergenic
1001528503 5:172445941-172445963 GCTTCTGCAGAGGCAGAGTCCGG + Intronic
1001722281 5:173866706-173866728 GCAGCAGCTGAGGCGGAGCCTGG - Intergenic
1001779563 5:174356208-174356230 CCTGGTGCTGGTGCAGAGCCAGG - Intergenic
1002052382 5:176578422-176578444 GCTGCTGGACCGGGAGAGCCAGG + Exonic
1002352074 5:178590233-178590255 GGTGCTGCTGGGGCAGAGGCTGG + Exonic
1002382601 5:178841088-178841110 GCTGCTTCTGCAGCAGGGGCAGG - Intergenic
1002762921 6:215720-215742 GCTTCTGCTGTGGCACAGGCTGG + Intergenic
1003252864 6:4447054-4447076 ACTGCTGCTGCAGCACAGACTGG + Intergenic
1003270480 6:4603393-4603415 GAGGGTGCTGAGGCAGAGCCGGG + Intergenic
1003422910 6:5974180-5974202 CCTGCTGTGGCGGGAGAGCCCGG + Intergenic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1003995784 6:11538123-11538145 GCTGCAGCAGCAGCAGCGCCCGG + Intergenic
1004121725 6:12829844-12829866 GCTGCTGGGGAGGCAGAGACAGG + Intronic
1004241317 6:13924970-13924992 GCTCCGGCTGCGGCGGCGCCTGG - Exonic
1004396357 6:15248863-15248885 GCGGGGGCTGCCGCAGAGCCGGG + Intronic
1006267898 6:32940768-32940790 GCTGCTGCTGGGGCTCAGCCTGG - Exonic
1006431527 6:34000287-34000309 CCTCCTGTTGAGGCAGAGCCTGG + Intergenic
1006458607 6:34145375-34145397 GCTCCTGCTGCGGCGGAGCCCGG + Intronic
1006472625 6:34237221-34237243 GCGGCGGCCGCGGCGGAGCCAGG + Exonic
1006498151 6:34438999-34439021 GCTCCTGCTGGGGCAGAGAAAGG - Intergenic
1006752613 6:36387968-36387990 GCTCCCACTGGGGCAGAGCCGGG + Intergenic
1006912025 6:37569788-37569810 GCTGATGGAGGGGCAGAGCCAGG + Intergenic
1007576683 6:42929633-42929655 GCTGCTGCTGCTGCCGGCCCCGG + Exonic
1007588312 6:43006459-43006481 GCTGGGGCTGCGGCTGGGCCTGG - Exonic
1007625337 6:43243494-43243516 GCGGCGGCAGCGGCAGAGCGGGG - Intergenic
1007832820 6:44651860-44651882 GCTGCTGCTGCCGCTGGTCCCGG + Intergenic
1008298426 6:49805541-49805563 GCAGCTGCTGTGGCAGATCATGG + Intergenic
1008501462 6:52187605-52187627 ACTGCTACTGCTGCTGAGCCTGG + Exonic
1008507623 6:52246395-52246417 GCAGCTGGGGCAGCAGAGCCAGG + Intergenic
1010001767 6:70956207-70956229 GCTGTGGCTGCGGCCGAGACTGG + Exonic
1010083141 6:71886861-71886883 GCAGCAGCAGCAGCAGAGCCGGG - Intronic
1011319051 6:86069720-86069742 GCTGCTGCTGCTGCTGTACCTGG - Intergenic
1011419397 6:87155690-87155712 GCTACAGCTGCGGGAGAGCCGGG + Exonic
1011652358 6:89518288-89518310 GCTGCTGCGGAGGCTGAGGCAGG + Intronic
1012815720 6:104019353-104019375 GCTGCTGCTGCTGCTGAACAAGG + Intergenic
1013590128 6:111612786-111612808 GTTGCTGCTAGGGCAGAGACAGG + Intergenic
1014137533 6:117907169-117907191 GCGGCGGCGGCGGCAGAGCGGGG - Intergenic
1014137688 6:117907735-117907757 GCTGCTGCTGCGGCTGCTCAGGG - Exonic
1014224102 6:118828495-118828517 GCTGCTGCAGAGGCTGAGGCAGG - Intronic
1015512074 6:134047931-134047953 TCTGCTGCTGCTTCAGAGCCTGG + Intronic
1016648161 6:146434253-146434275 GCTGCTGCTGCTGGAGAGGAGGG - Exonic
1016655798 6:146517120-146517142 ACTGTTGCTGGGGAAGAGCCAGG + Intergenic
1017233214 6:152094497-152094519 GGTGCTGCTGCTGCAGGGTCAGG - Exonic
1018862320 6:167720121-167720143 GCTCCTGCAGAGGCAGAGGCTGG - Intergenic
1019153979 6:170026533-170026555 GCTGAAGCGGGGGCAGAGCCCGG - Intergenic
1019158406 6:170053680-170053702 GCTCCAGCTGGGGCAGAGGCCGG + Intergenic
1019318427 7:402399-402421 GCGGCTGCTTCTGCAGAGCAGGG - Intergenic
1019343321 7:518523-518545 GCGGCTGCTGCGGAAGCCCCTGG - Intronic
1020049474 7:5072397-5072419 GCTGCTGCTGCTGCTGCTCCCGG + Exonic
1020085430 7:5307763-5307785 GCTGCTGCTGCGTGGGGGCCCGG - Exonic
1020152644 7:5695437-5695459 GCTGCTGCTGCCTCGGAGCCCGG + Intronic
1021570152 7:22056925-22056947 GCTGCTGCTGCTGCTGATCTGGG + Intergenic
1021884587 7:25125940-25125962 GCTGCATTTGCGGCAGAGACAGG + Intergenic
1022094551 7:27130562-27130584 GCTGCTGCAGCGGCAGGTGCTGG + Exonic
1022140803 7:27491711-27491733 GCTGCTTCTGCAGCAGGGCTAGG + Intergenic
1023418143 7:39950831-39950853 GCTGCGGCGGCGGCCGTGCCGGG - Exonic
1024023607 7:45392171-45392193 TCTGCTGCAGCTGCTGAGCCAGG - Intergenic
1024076805 7:45825154-45825176 GCTGTTGCTGCTGAAGAGACAGG - Intergenic
1024192456 7:47026798-47026820 GCAGCTTCTGCTCCAGAGCCAGG + Intergenic
1024325220 7:48104104-48104126 GCTGCTGGTGAGGCTGAGGCAGG + Intronic
1024580001 7:50793507-50793529 GCGGCGGCGGCGGCAGAGGCGGG - Intergenic
1025615705 7:63114416-63114438 GCCGCCGCCGCGGCAGCGCCTGG - Intergenic
1025974078 7:66355791-66355813 GCTGCTCCTGAGGCTGAGGCAGG + Intronic
1026163069 7:67887981-67888003 GCTGCTCCTGAGGCTGAGGCAGG - Intergenic
1026806809 7:73434034-73434056 GCTGCTGCTGTGGCAGCTGCTGG + Exonic
1027052978 7:75031290-75031312 GCTGCTGCTGCTGGTGACCCGGG - Intronic
1028285453 7:88991500-88991522 GGAGCTGCTGGGGCAAAGCCAGG - Intronic
1028505452 7:91565753-91565775 GCTGCTGCTGAGACATAGACTGG - Intergenic
1028748054 7:94349822-94349844 GCTACTGCGGCGGCTGAGGCAGG + Intergenic
1029660583 7:101958362-101958384 GCTGCTGCTGCTGCAGCTTCAGG - Intronic
1030074927 7:105728712-105728734 GCTGATTCTGGGGCAGAGGCAGG + Intronic
1030358623 7:108570334-108570356 GCAGCTTCTGCGGCGGGGCCTGG + Intronic
1031597143 7:123661227-123661249 TCTGCTTCTACGGTAGAGCCCGG - Intronic
1031711530 7:125052959-125052981 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
1032045056 7:128599108-128599130 GCAGCTGCTGTGGAAGAGTCTGG - Intergenic
1032096826 7:128942391-128942413 GCTGCTGCTGATGCCGGGCCCGG + Intronic
1032391218 7:131556524-131556546 CCTGCCGCTGCAGCAGAGCCGGG + Exonic
1032635974 7:133709403-133709425 TCACCTGCTGGGGCAGAGCCTGG - Intronic
1033159123 7:138981333-138981355 GCTGCGGCTGCGGCTGGGACGGG + Intergenic
1033801435 7:144906920-144906942 GCTGCTGCGGAGGCTGAGGCAGG + Intergenic
1033899447 7:146116932-146116954 GCAGCTGCCTCTGCAGAGCCTGG + Exonic
1034192891 7:149224846-149224868 CCAGCTGCTGGGGAAGAGCCAGG + Exonic
1034341792 7:150361935-150361957 GCGGCTGCTGGGGCAGTGTCTGG + Intergenic
1034424436 7:151007195-151007217 GCGGCTGCTGCAGCTGGGCCAGG + Exonic
1035663421 8:1363803-1363825 GCTGCGGGTGTGACAGAGCCCGG + Intergenic
1035777193 8:2197036-2197058 GCTGCTGCAGCCACAGAGGCTGG + Intergenic
1036579060 8:10055485-10055507 GCTGCTGCTGCGGCAGGTGGGGG - Intronic
1037805177 8:22054865-22054887 CCTGCTGCCGCGGCTGAGCCGGG + Intronic
1038147798 8:24914192-24914214 CCTGCTTCTGCCGCAGCGCCTGG - Exonic
1038507202 8:28094628-28094650 GCTGAGGCTGAGGCAGAGGCGGG + Intronic
1039468561 8:37799961-37799983 GCTTCTGCTGAAGGAGAGCCTGG - Intronic
1039756433 8:40528300-40528322 GCTGCTCCAGAGGCAGAGGCAGG - Intergenic
1039757353 8:40537902-40537924 GCTACAGCTGAGGCAGAGCAAGG + Intronic
1040415238 8:47189238-47189260 GCTGCTGCGGCGGCCGCGGCCGG - Intergenic
1041167345 8:55102676-55102698 GCTGCTGCTGCTGCTGCGCCGGG + Exonic
1041340957 8:56844958-56844980 GAAGCTGCTGAGGAAGAGCCAGG + Intergenic
1041359283 8:57033973-57033995 TCTGCTGCTGAGGCAGCCCCTGG + Intergenic
1041698841 8:60765637-60765659 GCGGCTGCTGCTGCTGAGCTTGG + Intronic
1041728026 8:61036367-61036389 CCTGCAGCTGCCACAGAGCCTGG - Intergenic
1042575798 8:70217365-70217387 GCAGCTGCTGCAGGAGAGCCAGG - Intronic
1043482570 8:80668229-80668251 GCTGCTGCTGCTGCAGTGAGGGG - Intronic
1044989146 8:97779937-97779959 GCTGCTGGGGAGGCAGAGGCAGG + Intronic
1047961801 8:130016498-130016520 GCTGCTGCTGCCGCCGCGGCGGG - Intronic
1049095734 8:140547136-140547158 GCTGCTGCTGCTGCTGAGCCAGG + Intronic
1049376079 8:142289839-142289861 CCTGCGGCTGCGAGAGAGCCGGG + Intronic
1049461544 8:142731713-142731735 GCTCCTGCAGCAGCAGGGCCGGG + Intronic
1049480839 8:142821744-142821766 GCTGATTCTGCCGCAGAGGCTGG + Intergenic
1049682450 8:143925641-143925663 GCAGCAGCTGCGGCAGAGCTCGG - Exonic
1049682856 8:143927421-143927443 GCAGCTGCTCCCGCACAGCCTGG + Exonic
1049683367 8:143929652-143929674 CCAGCAGCTGCTGCAGAGCCTGG - Exonic
1049725502 8:144143826-144143848 GCTGGGACTGCGGCAGAGGCAGG + Intergenic
1049808504 8:144552341-144552363 GCTGCTGTCCCTGCAGAGCCTGG + Intronic
1049853777 8:144849114-144849136 GCTGCTGTTCCTGCAGGGCCAGG + Intronic
1049923771 9:389586-389608 GCTGCTGCTGCTGCTGGTCCAGG - Intronic
1050259614 9:3827819-3827841 GCTGCTCCTGATGCAAAGCCAGG - Exonic
1051710510 9:19926405-19926427 GCGGCTGGCGCGGGAGAGCCAGG - Intergenic
1052142412 9:25003850-25003872 GCTGCAGCTGAGGCAGAGGGTGG + Intergenic
1052192703 9:25677793-25677815 GGTGCAGCTGCAGCAGGGCCCGG + Exonic
1052782397 9:32794881-32794903 GCTGCTGCTTGGGCATAGCTGGG - Intergenic
1052844561 9:33323639-33323661 GCTGCTCCGGCGGCTGAGGCAGG + Intronic
1052872636 9:33523643-33523665 CCTGTGGCTGCGGCCGAGCCAGG + Intergenic
1053122964 9:35560108-35560130 GCTGCTGCTGCTACAGCCCCTGG + Exonic
1053139965 9:35676119-35676141 GCAGATGCAGCTGCAGAGCCCGG - Exonic
1053643122 9:40106764-40106786 GCGGCGGCTGCGGCGCAGCCCGG + Intergenic
1055095883 9:72413914-72413936 GCTGCTGGGGAGGCTGAGCCAGG - Intergenic
1057029730 9:91766332-91766354 GCTTCTGCTGCGGCAGCCCAGGG + Intronic
1057426056 9:94950709-94950731 GCTGCTGCCACGCCTGAGCCAGG - Intronic
1057492190 9:95529054-95529076 GCTGCTGCTGCTGCTGCTCCAGG - Intergenic
1057684731 9:97221891-97221913 GCTGTGGCTGCGGCCAAGCCAGG - Intergenic
1057690276 9:97277680-97277702 TCTGATGATGCGACAGAGCCTGG + Intergenic
1058051820 9:100413805-100413827 GCTGCTCCGGCGGCTGAGGCAGG + Intergenic
1060552330 9:124491517-124491539 GCTGCTGGTGCTGCTGGGCCTGG - Intronic
1060599640 9:124869381-124869403 GCGGCGGCGGCGGCGGAGCCAGG + Exonic
1060667805 9:125443396-125443418 GCAGCTGCTGTGGCAGAGCAGGG - Intronic
1060779256 9:126399611-126399633 GCTGCTGCTGGGACAGAGGTTGG + Intronic
1060817358 9:126642172-126642194 GCTGCTGCTACAACAGGGCCTGG + Intronic
1060875753 9:127082437-127082459 GCTGCTGCTGCTGCATAGGCAGG + Intronic
1060940920 9:127542396-127542418 CCTGCTCCTGGGGCAGGGCCTGG + Intronic
1061248968 9:129415453-129415475 GCTGTGGCTTCGGCAGAGCCGGG - Intergenic
1061595722 9:131628004-131628026 GCTGCTGCAGGGGGAGAGGCGGG + Exonic
1061598273 9:131646910-131646932 GATGCTGCTGCCGGACAGCCTGG - Intronic
1061804615 9:133131109-133131131 GGTGCTGCTGGGGCAGTGTCTGG - Intronic
1061820856 9:133226519-133226541 GCTGCGGCTCTGGCAGGGCCAGG - Intergenic
1061821482 9:133229320-133229342 GCTGGTGATGGGGCAGAGGCAGG + Intergenic
1061833957 9:133317043-133317065 GCTGGTGATGGGGCAGAGGCAGG - Intergenic
1061920405 9:133779411-133779433 GCTGCTGCTGCTGCTGGGCCAGG - Intronic
1061968982 9:134033650-134033672 GGAGCTGCTGCTGCTGAGCCTGG + Exonic
1061974124 9:134059850-134059872 GCTGCTGCTGCTGCTGCGACAGG - Intronic
1062028317 9:134350685-134350707 GCTGCTCCTGCGGGGGAGGCTGG - Intronic
1062073560 9:134572258-134572280 ACTGGTGCTGCGGCAGAGTGGGG - Intergenic
1062237766 9:135520754-135520776 GCTGGTGATGGGGCAGAGGCAGG - Intergenic
1062287452 9:135779355-135779377 GCTGAGGCTGGGGAAGAGCCTGG - Exonic
1062309472 9:135928350-135928372 GTGCCTGCTGCGGCGGAGCCTGG + Intergenic
1062617241 9:137403416-137403438 GCTGCTGCTGCTGCTGGGCTGGG - Intronic
1203669421 Un_KI270754v1:37880-37902 GCTGCCGCCCCGGCAGCGCCTGG + Intergenic
1185915794 X:4034003-4034025 GCTGCTGCGGAGGCTGAGGCAGG - Intergenic
1186660831 X:11665799-11665821 GCTGGAGCTGGGGCGGAGCCAGG + Intergenic
1187695308 X:21913386-21913408 GCTACTGGTGCGGCTGAGGCAGG + Intergenic
1187950053 X:24462741-24462763 GATGCTGCTGCCGCAGGTCCAGG + Intergenic
1188006715 X:25020840-25020862 GCTGCTGCTCCGGGCGACCCTGG + Intergenic
1188934238 X:36153779-36153801 GGTGCTGCTTCAGCAGACCCAGG - Intergenic
1189893691 X:45632232-45632254 CCTGCGGCTGCCCCAGAGCCTGG - Intergenic
1190061683 X:47215685-47215707 GCTGGGGCGGCGGCAGGGCCGGG - Intergenic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1190406280 X:50090851-50090873 GCTGGGACTGCGGCAGTGCCTGG + Exonic
1190641735 X:52486859-52486881 ACAGCTGCTGTTGCAGAGCCAGG - Intergenic
1190645937 X:52526006-52526028 ACAGCTGCTGTTGCAGAGCCAGG + Intergenic
1192207706 X:69107196-69107218 GATGCTGCTGCAGCAGTGGCTGG - Intergenic
1193443703 X:81574066-81574088 GCTGCTCCAGAGGCAGAGGCAGG + Intergenic
1196950907 X:120875145-120875167 GCTGCTGCTGTCCCAGAGGCTGG - Exonic
1196951745 X:120931520-120931542 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196952429 X:120936381-120936403 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953114 X:120941242-120941264 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953799 X:120946102-120946124 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196954484 X:120950963-120950985 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955167 X:120955823-120955845 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955854 X:120960706-120960728 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196956536 X:120965567-120965589 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957218 X:120970427-120970449 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957900 X:120975287-120975309 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196958582 X:120980147-120980169 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196959263 X:120985007-120985029 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1200134392 X:153867848-153867870 GCACCTGCTGACGCAGAGCCAGG - Exonic
1201222199 Y:11782501-11782523 GCTGCTGCTGCTGCAGTACTTGG + Intergenic
1201345318 Y:12976967-12976989 GATGCTGCTGTTGGAGAGCCAGG - Intergenic
1202025283 Y:20515799-20515821 GCTTCTGCTCCGGCAGAGTGTGG + Intergenic
1202583282 Y:26403271-26403293 GCTGGGGCTGGGGCAGGGCCAGG + Intergenic