ID: 922200348

View in Genome Browser
Species Human (GRCh38)
Location 1:223395187-223395209
Sequence GGGTGCAGCACATTTCCCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922200344_922200348 -2 Left 922200344 1:223395166-223395188 CCATTAAGAAAAAGGAGCAGAGG 0: 1
1: 0
2: 4
3: 27
4: 335
Right 922200348 1:223395187-223395209 GGGTGCAGCACATTTCCCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922200348 Original CRISPR GGGTGCAGCACATTTCCCAA GGG Exonic
902087181 1:13872646-13872668 GGGTGCAGGGGACTTCCCAAAGG + Intergenic
903282049 1:22255586-22255608 GGGTGCAGCACAATTGCTGATGG + Intergenic
905413322 1:37787496-37787518 CTGTGCAGAACTTTTCCCAAGGG + Intergenic
909447800 1:75766961-75766983 CTGTGCAGCACAGTTCCTAATGG - Intronic
909605836 1:77507228-77507250 CTGTGCAGTGCATTTCCCAAAGG + Intronic
910316816 1:85894855-85894877 GGGGGCAGCAGATTTCAAAAAGG + Intronic
911121326 1:94300046-94300068 GTGTGCAGCAGATTCCCTAAGGG + Intergenic
911927741 1:103857518-103857540 TGTTGCAGCACTATTCCCAATGG + Intergenic
916074542 1:161192904-161192926 GGGTGAAGGACTTGTCCCAAAGG + Intronic
917052761 1:170942177-170942199 GAGTGTAGCACATTTCCTCATGG + Intronic
917405208 1:174698499-174698521 GGGTAGAGCACATTCCCAAAAGG - Intronic
917419657 1:174849343-174849365 GGATTCAGGATATTTCCCAAGGG + Intronic
917701354 1:177584875-177584897 GGGTGAATTACATTTCCCATTGG - Intergenic
918215235 1:182387638-182387660 GGATGCAACACATTACCTAATGG - Intronic
919710549 1:200723021-200723043 GAGTTAAGCACATTTCCCTATGG + Intergenic
922200348 1:223395187-223395209 GGGTGCAGCACATTTCCCAAGGG + Exonic
922737581 1:227996063-227996085 GGGCAGAGCTCATTTCCCAAAGG + Intergenic
923376556 1:233369535-233369557 GGGTTCAGCACACTGCCCTATGG + Intronic
923694485 1:236233846-236233868 GGAAGCAGCACCTTGCCCAAGGG - Intronic
1063401511 10:5750707-5750729 GTGTGCAACACATTTGCAAATGG - Intronic
1064963809 10:20995187-20995209 GGGTGCTGTACATTTCTCAGAGG - Intronic
1075597761 10:123744470-123744492 GGGTCCAGGACATGTCTCAAGGG + Intronic
1076525110 10:131107577-131107599 GGGCGCAGGACTTCTCCCAAAGG + Intronic
1078639680 11:13083012-13083034 TGAGGCAGAACATTTCCCAATGG - Intergenic
1080572244 11:33566983-33567005 GGGTGAAGAATGTTTCCCAAGGG + Intronic
1080915047 11:36648764-36648786 GGGGGCAGCATGTTTCCCCAAGG + Intronic
1083495848 11:63052393-63052415 GGGAGCAGCACCTTTCCCACAGG - Intergenic
1085323659 11:75590352-75590374 GGCTGCAGAACCTATCCCAAGGG + Intronic
1085527540 11:77172989-77173011 GGGTGCCCCCCATTCCCCAAAGG - Intronic
1090279894 11:125446576-125446598 AAGAGCAGCACATTTCTCAAAGG - Intronic
1090447483 11:126776401-126776423 GGCATCAGCACATTTACCAATGG - Intronic
1092057749 12:5521735-5521757 GGATGCAGCACACATCCCACTGG - Intergenic
1092122372 12:6053500-6053522 GGGTGCAGCCCATTTCGCTGTGG - Intronic
1092914159 12:13174505-13174527 GGGCCCAACACATTTCTCAAAGG + Intergenic
1104379401 12:128293970-128293992 TGGTGCAGAATATTTCCGAAGGG + Intronic
1105548352 13:21368502-21368524 TGGTTCAGAACACTTCCCAATGG + Intergenic
1108358052 13:49644701-49644723 GGCTGCAGCTCATTTTCAAATGG - Intergenic
1110256676 13:73440709-73440731 GGGTGGAACACATGGCCCAAGGG + Intergenic
1111927981 13:94483411-94483433 GGGTACAGTCCATTTCCCACAGG + Intergenic
1112166764 13:96928021-96928043 GGATGGCGCACATTTCCCCACGG + Intergenic
1115504998 14:34085374-34085396 GGATGAAGAACATTTCCCAAAGG - Intronic
1117231015 14:53718732-53718754 CGGTGCAGTACATTTCCATATGG - Intergenic
1118505269 14:66404155-66404177 GGCTCCAACACATTTCCAAAGGG - Intergenic
1123936323 15:25195871-25195893 GGGTACAGCCCATGTCCCATTGG + Intergenic
1126483844 15:49157167-49157189 GGATTCAGGACACTTCCCAAGGG - Intronic
1127390549 15:58501858-58501880 GGGTGCAGAACATTCCTGAAGGG - Intronic
1127601493 15:60542174-60542196 GGTGGCAGCACATTTCACATCGG + Intronic
1129478721 15:75806357-75806379 TGTTGCAGCACATTTTCCAGTGG + Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1143497041 17:7318303-7318325 GGTTCCAGCACTTTTCCCACTGG + Exonic
1147054109 17:37821004-37821026 GGGTAGACCACATTTCCCCAAGG + Intergenic
1150988648 17:70229192-70229214 GAGTACAGCACATTGCCAAATGG + Intergenic
1153355366 18:4128731-4128753 GGCTGGACCACATTTACCAATGG + Intronic
1154302005 18:13202741-13202763 GGGTGGAGCTCCTTTCCCCAAGG + Intergenic
1163736892 19:18987269-18987291 AGGATCAGCCCATTTCCCAATGG - Intergenic
1164672281 19:30078879-30078901 CAGTGAAGCACATTCCCCAAAGG + Intergenic
1168183980 19:54685391-54685413 GAGTGTAGCACATTTCCCCATGG + Intronic
926743434 2:16131018-16131040 GGGGGCTCCACATTTCCAAAGGG - Intergenic
928564256 2:32527489-32527511 GGGTGCAGAAAATTTTCAAAAGG + Intronic
929571818 2:43027409-43027431 GGGTGCAGCTCATTTCTCGCTGG + Intergenic
936054796 2:109254389-109254411 GGGGGCAGCACATTCCTCATTGG + Intronic
936380739 2:111983633-111983655 GGGTACATCACATTGCCCAATGG - Intronic
943637917 2:190326552-190326574 GGTTGCAGCACATTTCCAAGAGG - Intronic
1168736888 20:148172-148194 CAGTACAGCACATTTCCCCAGGG + Intergenic
1171143369 20:22761888-22761910 TGGTGTAGCAGATTTCCCACCGG + Intergenic
1173062338 20:39674653-39674675 GGGTTCAGATCTTTTCCCAATGG - Intergenic
1173986122 20:47262892-47262914 GGGAGCTGGAGATTTCCCAAGGG - Intronic
1174538831 20:51273754-51273776 GGGTGCAGCCCAGCTCCCCAGGG - Intergenic
1178810647 21:35878321-35878343 GGCTGCATCCCATTTCCAAAGGG + Intronic
1179922444 21:44514420-44514442 TGGTGCCACACACTTCCCAAGGG - Intronic
1181003806 22:20000068-20000090 GTGAGGAGCACCTTTCCCAAGGG - Intronic
1183492696 22:38125046-38125068 GGGGGACCCACATTTCCCAAGGG - Intronic
1184271647 22:43387865-43387887 GGGAGCAGCTCTTTCCCCAAAGG - Intergenic
952858056 3:37789249-37789271 GGATTCAGGACATTTCCCAAGGG + Intronic
956058629 3:65327431-65327453 GCCAGCAGCACATTTACCAATGG + Intergenic
960872209 3:122261292-122261314 GGGAGCATCCCAATTCCCAATGG - Intronic
965376629 3:167932378-167932400 GAATGTAACACATTTCCCAATGG - Intergenic
966440455 3:179939092-179939114 AGGTGCAGTGAATTTCCCAAAGG - Intronic
967833239 3:193940350-193940372 GCATGCAACATATTTCCCAAAGG + Intergenic
968660247 4:1795805-1795827 GGGTGCAGGGCCTTTCCCGAAGG + Intronic
969437415 4:7196382-7196404 GGGCACAGCACATTCCCCATAGG - Intronic
969868033 4:10087834-10087856 GTGGTCAGCACATTTCCCATGGG - Exonic
974288834 4:59904940-59904962 GAGTGTAGCACATTTCCTAATGG + Intergenic
978191125 4:105913664-105913686 TGGTACAGCACATTTTCAAATGG + Intronic
978900932 4:113948885-113948907 GGATGTAGCACATTTCTTAAAGG - Intronic
978983089 4:114975514-114975536 GAGTGCTGCTCATTTCCCAGTGG + Intronic
979719809 4:123885534-123885556 AGGTGCAGCCCATTTCTGAAAGG + Intergenic
981209229 4:142082451-142082473 GGACGCAGCACACTACCCAAGGG + Intronic
983220909 4:165043672-165043694 CGGTCCAGTGCATTTCCCAAGGG + Intergenic
986092877 5:4527715-4527737 TGTTGCAATACATTTCCCAAAGG - Intergenic
989552345 5:42750616-42750638 CGGTGCAGCCCAGTTCCTAATGG - Intergenic
989784002 5:45305175-45305197 CGGTATAGCACATTTCCCCAAGG - Intronic
990669130 5:58107591-58107613 GGGTAAGGCACAATTCCCAAAGG + Intergenic
995561787 5:113389704-113389726 GGGTGCTGCACACATCTCAAAGG - Intronic
997887974 5:137648434-137648456 AGGTTCAGTACATTTCCAAAAGG + Intronic
999381370 5:151123797-151123819 GGGTGCAGTACTCTTCCCACTGG + Intronic
1003502465 6:6713743-6713765 GGATGCAGCACTCTTCCCATGGG - Intergenic
1004859135 6:19783124-19783146 GGGTGCAGAGCTTTACCCAAAGG - Intergenic
1007437451 6:41825520-41825542 GTGTTCAGCACATTTACCACAGG - Intronic
1009407649 6:63330172-63330194 GGGTGCAGCTTATTTCTCATTGG + Intergenic
1011565933 6:88671675-88671697 GGAGGCATCACATTACCCAACGG + Intronic
1011867812 6:91853278-91853300 GGGTGCAGCACATTTATCTCTGG - Intergenic
1012130656 6:95487737-95487759 GGAAGCAGCACATTTACTAATGG + Intergenic
1012242590 6:96890769-96890791 GGATTCAGGACATTTCCCAAGGG + Exonic
1015829201 6:137349499-137349521 GAATGCAGCTTATTTCCCAAGGG - Intergenic
1017642339 6:156506516-156506538 GCGTGCATCACATTTTTCAAAGG - Intergenic
1018797063 6:167194381-167194403 GGGATCAGCACATTTACTAAAGG - Intronic
1018819276 6:167360707-167360729 GGGATCAGCACATTTACTAAAGG + Intronic
1019621427 7:1994328-1994350 GGGTCCAGCTCAATTCCCAGGGG + Intronic
1021068216 7:16203277-16203299 GGGTGGGGCACATTCCCCACAGG - Intronic
1021830709 7:24605019-24605041 GGGTGCTGAAAATTGCCCAAAGG - Intronic
1022241624 7:28517854-28517876 GGGTGAAGCAGAATTCCAAAAGG + Intronic
1022747016 7:33182912-33182934 GGTAGCAGCCCATTTCCCATGGG + Intronic
1023656639 7:42429077-42429099 GGCTGCGGCACCTTTCCCAGTGG + Intergenic
1028412180 7:90541887-90541909 GAGTGCTTCACCTTTCCCAAAGG + Intronic
1030703344 7:112665920-112665942 GGGAGCAGCAGATTTCACACAGG + Intergenic
1031882143 7:127209630-127209652 GGGTGCATTACAATCCCCAAAGG - Intronic
1036286828 8:7450111-7450133 AGGTGAAGCACATTTCCCCCAGG - Intronic
1036334649 8:7861412-7861434 AGGTGAAGCACATTTCCCCCAGG + Intronic
1042747065 8:72119630-72119652 GGGTGAAGAGCATTTCCCAAGGG - Intergenic
1046579861 8:116078675-116078697 GGGTCCATGAGATTTCCCAAAGG + Intergenic
1046666943 8:117014736-117014758 AGGTGCATCTCATTTCCCAGGGG - Intronic
1047629351 8:126690037-126690059 GGGTGCTGCACACATCCTAAGGG - Intergenic
1051332070 9:16033277-16033299 TTGTGCAGCCCATTTCCTAACGG - Intronic
1051939168 9:22484099-22484121 GGGTGCAGCTCATTTCTTAGAGG - Intergenic
1055758669 9:79582886-79582908 GGGGGCAGCACATTTACGCATGG + Intronic
1056766357 9:89446908-89446930 GGGGGCAGCACCTATCCCACAGG - Intronic
1057079307 9:92160340-92160362 GGGCGCAGGACTTCTCCCAAAGG + Intergenic
1060191017 9:121592782-121592804 GCCTGCAGCACCTTCCCCAAGGG - Intronic
1061876203 9:133545382-133545404 GGGTGAAGCCCATCTCCTAAGGG + Intronic
1187665286 X:21601900-21601922 GGTGGCTTCACATTTCCCAAAGG + Intronic
1188436989 X:30172159-30172181 GGGAGAAGAACATTTCACAAAGG + Intergenic
1193085008 X:77441159-77441181 TGGTGCTACACATTTCCCTAAGG - Intergenic
1194201432 X:90957644-90957666 GGGTTCAGCCCCTTTCCCCAGGG - Intergenic
1194906675 X:99585576-99585598 GGGTGTATCACATTTATCAACGG - Intergenic
1199241545 X:145553659-145553681 GGCTGCAGCACACTTCACACTGG - Intergenic
1200547272 Y:4533099-4533121 GGGTTCAGCCCCTTTCCCCAGGG - Intergenic