ID: 922207628

View in Genome Browser
Species Human (GRCh38)
Location 1:223462103-223462125
Sequence CATGTCTGCCCCTCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922207619_922207628 25 Left 922207619 1:223462055-223462077 CCTTAAAGGGTTTTCAGTGGCCC No data
Right 922207628 1:223462103-223462125 CATGTCTGCCCCTCCTTTGTGGG No data
922207621_922207628 4 Left 922207621 1:223462076-223462098 CCTTGTCCATATTACCCATGTGT No data
Right 922207628 1:223462103-223462125 CATGTCTGCCCCTCCTTTGTGGG No data
922207622_922207628 -2 Left 922207622 1:223462082-223462104 CCATATTACCCATGTGTCCCTCA No data
Right 922207628 1:223462103-223462125 CATGTCTGCCCCTCCTTTGTGGG No data
922207623_922207628 -10 Left 922207623 1:223462090-223462112 CCCATGTGTCCCTCATGTCTGCC No data
Right 922207628 1:223462103-223462125 CATGTCTGCCCCTCCTTTGTGGG No data
922207620_922207628 5 Left 922207620 1:223462075-223462097 CCCTTGTCCATATTACCCATGTG No data
Right 922207628 1:223462103-223462125 CATGTCTGCCCCTCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922207628 Original CRISPR CATGTCTGCCCCTCCTTTGT GGG Intergenic
No off target data available for this crispr