ID: 922212156

View in Genome Browser
Species Human (GRCh38)
Location 1:223494770-223494792
Sequence GCTCTGGGACCACGACCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922212156_922212166 17 Left 922212156 1:223494770-223494792 CCAGAGGGTCGTGGTCCCAGAGC No data
Right 922212166 1:223494810-223494832 AAGTTTCTCCGGGCAGCCAGAGG No data
922212156_922212162 6 Left 922212156 1:223494770-223494792 CCAGAGGGTCGTGGTCCCAGAGC No data
Right 922212162 1:223494799-223494821 CTGAGCCCTGCAAGTTTCTCCGG No data
922212156_922212163 7 Left 922212156 1:223494770-223494792 CCAGAGGGTCGTGGTCCCAGAGC No data
Right 922212163 1:223494800-223494822 TGAGCCCTGCAAGTTTCTCCGGG No data
922212156_922212167 18 Left 922212156 1:223494770-223494792 CCAGAGGGTCGTGGTCCCAGAGC No data
Right 922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922212156 Original CRISPR GCTCTGGGACCACGACCCTC TGG (reversed) Intergenic