ID: 922212158

View in Genome Browser
Species Human (GRCh38)
Location 1:223494785-223494807
Sequence AGGGCTCAGCCAAGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922212158_922212171 22 Left 922212158 1:223494785-223494807 CCCAGAGCCCTTGGCTGAGCCCT No data
Right 922212171 1:223494830-223494852 AGGGCTGCAGCTCATTGCGGAGG No data
922212158_922212163 -8 Left 922212158 1:223494785-223494807 CCCAGAGCCCTTGGCTGAGCCCT No data
Right 922212163 1:223494800-223494822 TGAGCCCTGCAAGTTTCTCCGGG No data
922212158_922212162 -9 Left 922212158 1:223494785-223494807 CCCAGAGCCCTTGGCTGAGCCCT No data
Right 922212162 1:223494799-223494821 CTGAGCCCTGCAAGTTTCTCCGG No data
922212158_922212167 3 Left 922212158 1:223494785-223494807 CCCAGAGCCCTTGGCTGAGCCCT No data
Right 922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG No data
922212158_922212166 2 Left 922212158 1:223494785-223494807 CCCAGAGCCCTTGGCTGAGCCCT No data
Right 922212166 1:223494810-223494832 AAGTTTCTCCGGGCAGCCAGAGG No data
922212158_922212170 19 Left 922212158 1:223494785-223494807 CCCAGAGCCCTTGGCTGAGCCCT No data
Right 922212170 1:223494827-223494849 CAGAGGGCTGCAGCTCATTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922212158 Original CRISPR AGGGCTCAGCCAAGGGCTCT GGG (reversed) Intergenic