ID: 922212159

View in Genome Browser
Species Human (GRCh38)
Location 1:223494786-223494808
Sequence CAGGGCTCAGCCAAGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922212159_922212170 18 Left 922212159 1:223494786-223494808 CCAGAGCCCTTGGCTGAGCCCTG No data
Right 922212170 1:223494827-223494849 CAGAGGGCTGCAGCTCATTGCGG No data
922212159_922212166 1 Left 922212159 1:223494786-223494808 CCAGAGCCCTTGGCTGAGCCCTG No data
Right 922212166 1:223494810-223494832 AAGTTTCTCCGGGCAGCCAGAGG No data
922212159_922212167 2 Left 922212159 1:223494786-223494808 CCAGAGCCCTTGGCTGAGCCCTG No data
Right 922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG No data
922212159_922212171 21 Left 922212159 1:223494786-223494808 CCAGAGCCCTTGGCTGAGCCCTG No data
Right 922212171 1:223494830-223494852 AGGGCTGCAGCTCATTGCGGAGG No data
922212159_922212163 -9 Left 922212159 1:223494786-223494808 CCAGAGCCCTTGGCTGAGCCCTG No data
Right 922212163 1:223494800-223494822 TGAGCCCTGCAAGTTTCTCCGGG No data
922212159_922212162 -10 Left 922212159 1:223494786-223494808 CCAGAGCCCTTGGCTGAGCCCTG No data
Right 922212162 1:223494799-223494821 CTGAGCCCTGCAAGTTTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922212159 Original CRISPR CAGGGCTCAGCCAAGGGCTC TGG (reversed) Intergenic