ID: 922212160

View in Genome Browser
Species Human (GRCh38)
Location 1:223494792-223494814
Sequence AACTTGCAGGGCTCAGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922212160_922212166 -5 Left 922212160 1:223494792-223494814 CCCTTGGCTGAGCCCTGCAAGTT No data
Right 922212166 1:223494810-223494832 AAGTTTCTCCGGGCAGCCAGAGG No data
922212160_922212167 -4 Left 922212160 1:223494792-223494814 CCCTTGGCTGAGCCCTGCAAGTT No data
Right 922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG No data
922212160_922212170 12 Left 922212160 1:223494792-223494814 CCCTTGGCTGAGCCCTGCAAGTT No data
Right 922212170 1:223494827-223494849 CAGAGGGCTGCAGCTCATTGCGG No data
922212160_922212171 15 Left 922212160 1:223494792-223494814 CCCTTGGCTGAGCCCTGCAAGTT No data
Right 922212171 1:223494830-223494852 AGGGCTGCAGCTCATTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922212160 Original CRISPR AACTTGCAGGGCTCAGCCAA GGG (reversed) Intergenic