ID: 922212161

View in Genome Browser
Species Human (GRCh38)
Location 1:223494793-223494815
Sequence AAACTTGCAGGGCTCAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922212161_922212171 14 Left 922212161 1:223494793-223494815 CCTTGGCTGAGCCCTGCAAGTTT No data
Right 922212171 1:223494830-223494852 AGGGCTGCAGCTCATTGCGGAGG No data
922212161_922212170 11 Left 922212161 1:223494793-223494815 CCTTGGCTGAGCCCTGCAAGTTT No data
Right 922212170 1:223494827-223494849 CAGAGGGCTGCAGCTCATTGCGG No data
922212161_922212166 -6 Left 922212161 1:223494793-223494815 CCTTGGCTGAGCCCTGCAAGTTT No data
Right 922212166 1:223494810-223494832 AAGTTTCTCCGGGCAGCCAGAGG No data
922212161_922212167 -5 Left 922212161 1:223494793-223494815 CCTTGGCTGAGCCCTGCAAGTTT No data
Right 922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922212161 Original CRISPR AAACTTGCAGGGCTCAGCCA AGG (reversed) Intergenic