ID: 922212162

View in Genome Browser
Species Human (GRCh38)
Location 1:223494799-223494821
Sequence CTGAGCCCTGCAAGTTTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922212156_922212162 6 Left 922212156 1:223494770-223494792 CCAGAGGGTCGTGGTCCCAGAGC No data
Right 922212162 1:223494799-223494821 CTGAGCCCTGCAAGTTTCTCCGG No data
922212159_922212162 -10 Left 922212159 1:223494786-223494808 CCAGAGCCCTTGGCTGAGCCCTG No data
Right 922212162 1:223494799-223494821 CTGAGCCCTGCAAGTTTCTCCGG No data
922212158_922212162 -9 Left 922212158 1:223494785-223494807 CCCAGAGCCCTTGGCTGAGCCCT No data
Right 922212162 1:223494799-223494821 CTGAGCCCTGCAAGTTTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922212162 Original CRISPR CTGAGCCCTGCAAGTTTCTC CGG Intergenic