ID: 922212167

View in Genome Browser
Species Human (GRCh38)
Location 1:223494811-223494833
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922212156_922212167 18 Left 922212156 1:223494770-223494792 CCAGAGGGTCGTGGTCCCAGAGC No data
Right 922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG No data
922212160_922212167 -4 Left 922212160 1:223494792-223494814 CCCTTGGCTGAGCCCTGCAAGTT No data
Right 922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG No data
922212161_922212167 -5 Left 922212161 1:223494793-223494815 CCTTGGCTGAGCCCTGCAAGTTT No data
Right 922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG No data
922212159_922212167 2 Left 922212159 1:223494786-223494808 CCAGAGCCCTTGGCTGAGCCCTG No data
Right 922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG No data
922212158_922212167 3 Left 922212158 1:223494785-223494807 CCCAGAGCCCTTGGCTGAGCCCT No data
Right 922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type