ID: 922212684

View in Genome Browser
Species Human (GRCh38)
Location 1:223497779-223497801
Sequence CAGTGCAAAAAGCTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922212681_922212684 10 Left 922212681 1:223497746-223497768 CCTGGGGATTTGCGGGTTTATCC No data
Right 922212684 1:223497779-223497801 CAGTGCAAAAAGCTGGAGCCAGG No data
922212680_922212684 11 Left 922212680 1:223497745-223497767 CCCTGGGGATTTGCGGGTTTATC No data
Right 922212684 1:223497779-223497801 CAGTGCAAAAAGCTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922212684 Original CRISPR CAGTGCAAAAAGCTGGAGCC AGG Intergenic
No off target data available for this crispr