ID: 922213201

View in Genome Browser
Species Human (GRCh38)
Location 1:223500935-223500957
Sequence GGGGGATTTCAAGTGCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922213194_922213201 13 Left 922213194 1:223500899-223500921 CCTAGCTGCTTACATTTGTCAGT No data
Right 922213201 1:223500935-223500957 GGGGGATTTCAAGTGCTAGCTGG No data
922213191_922213201 27 Left 922213191 1:223500885-223500907 CCCCATTAAAGAGGCCTAGCTGC No data
Right 922213201 1:223500935-223500957 GGGGGATTTCAAGTGCTAGCTGG No data
922213192_922213201 26 Left 922213192 1:223500886-223500908 CCCATTAAAGAGGCCTAGCTGCT No data
Right 922213201 1:223500935-223500957 GGGGGATTTCAAGTGCTAGCTGG No data
922213193_922213201 25 Left 922213193 1:223500887-223500909 CCATTAAAGAGGCCTAGCTGCTT No data
Right 922213201 1:223500935-223500957 GGGGGATTTCAAGTGCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922213201 Original CRISPR GGGGGATTTCAAGTGCTAGC TGG Intergenic
No off target data available for this crispr