ID: 922213675

View in Genome Browser
Species Human (GRCh38)
Location 1:223503924-223503946
Sequence ATTACCAGCATCACTTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922213675_922213684 29 Left 922213675 1:223503924-223503946 CCCCACAAAGTGATGCTGGTAAT No data
Right 922213684 1:223503976-223503998 TGACTCTGTGTCTCGGGCCATGG No data
922213675_922213683 23 Left 922213675 1:223503924-223503946 CCCCACAAAGTGATGCTGGTAAT No data
Right 922213683 1:223503970-223503992 TGGAAATGACTCTGTGTCTCGGG No data
922213675_922213679 3 Left 922213675 1:223503924-223503946 CCCCACAAAGTGATGCTGGTAAT No data
Right 922213679 1:223503950-223503972 CACCCTCAACTCAGACTAAATGG No data
922213675_922213682 22 Left 922213675 1:223503924-223503946 CCCCACAAAGTGATGCTGGTAAT No data
Right 922213682 1:223503969-223503991 ATGGAAATGACTCTGTGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922213675 Original CRISPR ATTACCAGCATCACTTTGTG GGG (reversed) Intergenic
No off target data available for this crispr