ID: 922219740

View in Genome Browser
Species Human (GRCh38)
Location 1:223549459-223549481
Sequence CCCTTGGATGGTATCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922219740_922219751 22 Left 922219740 1:223549459-223549481 CCTCCAAAGATACCATCCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 189
Right 922219751 1:223549504-223549526 GCCAAAAGGGGAGAGCATCATGG 0: 1
1: 0
2: 1
3: 14
4: 173
922219740_922219748 8 Left 922219740 1:223549459-223549481 CCTCCAAAGATACCATCCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 189
Right 922219748 1:223549490-223549512 CGAACTTGGTCTCTGCCAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
922219740_922219746 -6 Left 922219740 1:223549459-223549481 CCTCCAAAGATACCATCCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 189
Right 922219746 1:223549476-223549498 CAAGGGTGTGGAACCGAACTTGG 0: 1
1: 0
2: 0
3: 6
4: 67
922219740_922219750 10 Left 922219740 1:223549459-223549481 CCTCCAAAGATACCATCCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 189
Right 922219750 1:223549492-223549514 AACTTGGTCTCTGCCAAAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 160
922219740_922219753 26 Left 922219740 1:223549459-223549481 CCTCCAAAGATACCATCCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 189
Right 922219753 1:223549508-223549530 AAAGGGGAGAGCATCATGGCAGG 0: 1
1: 0
2: 4
3: 12
4: 225
922219740_922219749 9 Left 922219740 1:223549459-223549481 CCTCCAAAGATACCATCCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 189
Right 922219749 1:223549491-223549513 GAACTTGGTCTCTGCCAAAAGGG 0: 1
1: 0
2: 1
3: 19
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922219740 Original CRISPR CCCTTGGATGGTATCTTTGG AGG (reversed) Intronic
901922617 1:12547828-12547850 TCCTTGGAGGGCAGCTTTGGTGG - Intergenic
908730109 1:67217311-67217333 CCTCAGGATGATATCTTTGGAGG - Intronic
910518220 1:88087875-88087897 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
911508647 1:98784715-98784737 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
911794617 1:102059605-102059627 CCTTTGGATGGGATTTTTGTGGG - Intergenic
913192462 1:116425203-116425225 CCTTTGGCTGGTATCCCTGGGGG - Intergenic
913532046 1:119740486-119740508 CACCTGGATGGTCCCTTTGGGGG - Exonic
915084443 1:153375517-153375539 TCCTTGGATGGGTTCTTAGGTGG - Intronic
915180784 1:154057596-154057618 TCCTTGGATGATATCTTTTGGGG - Intronic
917060455 1:171032442-171032464 CCCTTGGATGGGGTTTTTGTGGG + Intronic
918957748 1:191232253-191232275 CCCTTTGTTGGTATCCTTGATGG - Intergenic
921706906 1:218332544-218332566 CTCTTGGATAGTTTTTTTGGGGG - Exonic
922219740 1:223549459-223549481 CCCTTGGATGGTATCTTTGGAGG - Intronic
923942495 1:238843913-238843935 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
1066494134 10:35925509-35925531 ACCTTGGATGTTATTTTTGCTGG + Intergenic
1067207555 10:44232969-44232991 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
1068598207 10:58926966-58926988 CCCATGGATGGTAGATTTAGTGG + Intergenic
1069584206 10:69586614-69586636 CCCATGGATAGCATCTTTGCTGG - Intergenic
1072834581 10:98696972-98696994 CCCTTGGATGGGGTTTTTGTGGG - Intronic
1073553720 10:104427819-104427841 CCCTTGGCTGGTGTATATGGAGG + Intronic
1075230538 10:120672210-120672232 CCTTTGGATGGGATTTTTGTGGG - Intergenic
1077515256 11:2997690-2997712 CCCTTAGCTGGCATCTTTGGGGG + Intergenic
1077889327 11:6407384-6407406 CCCTGGGATGGTCACTGTGGGGG - Intronic
1079935146 11:26608100-26608122 CCCTTGGATGGGGTTTTTGTAGG + Intronic
1082738494 11:56883841-56883863 GTGTTGTATGGTATCTTTGGGGG - Intergenic
1083220062 11:61246441-61246463 ACTTTAAATGGTATCTTTGGGGG - Intronic
1084550473 11:69838667-69838689 GCCTTGGATGTTCTCATTGGAGG + Intergenic
1088008429 11:104969902-104969924 CCTTTGGATGGGATTTTTGTAGG - Intergenic
1088017934 11:105082458-105082480 CCTTTGGATGGGATTTTTGTAGG - Intronic
1088020503 11:105112437-105112459 CCTTTGGATGGGATTTTTGTAGG - Intergenic
1088084338 11:105959768-105959790 CCCTTGGATGGGGTGTTTGTGGG + Intronic
1088697833 11:112383351-112383373 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1091056159 11:132420938-132420960 CCCTTGGGTGGAATCTTCAGGGG - Intronic
1092639894 12:10494223-10494245 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1093383241 12:18520907-18520929 CCCTTGGATGGGGTTTTTGTGGG + Intronic
1093808565 12:23465221-23465243 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1094054740 12:26257140-26257162 CCCTTGGATGGGATTTTTGTGGG - Intronic
1094776281 12:33731762-33731784 CCCTTGGATGGGGTTTTTGCAGG + Intergenic
1096409118 12:51364626-51364648 GCCCTGGATGGTATCTTCCGGGG + Intronic
1097749058 12:63331577-63331599 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1099793157 12:87362823-87362845 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
1100028228 12:90154148-90154170 CCCTTGGATGGGATTTTTGTAGG - Intergenic
1102010776 12:109617115-109617137 CCCCTGGATGCTGTCTATGGAGG + Intergenic
1102977062 12:117214400-117214422 CCCTTGGATGCTATTGCTGGAGG + Exonic
1106890027 13:34235385-34235407 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
1108938917 13:55924496-55924518 CACTTGGATTGTATCCTTTGTGG + Intergenic
1108955908 13:56156548-56156570 CTCTTGGAAGGTATCTATGCAGG + Intergenic
1109423469 13:62143823-62143845 CTCTTTGATGGTATTATTGGAGG - Intergenic
1110557934 13:76882027-76882049 TATTTGAATGGTATCTTTGGAGG + Exonic
1114706080 14:24727499-24727521 CCCTTGGATGGGGTCTTTGTGGG - Intergenic
1115928722 14:38467158-38467180 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
1116572607 14:46536560-46536582 CCTTTGGATTGTTTCTTTTGGGG - Intergenic
1116906768 14:50411653-50411675 TACTTGGATGCTATCTTTTGTGG + Intronic
1116977519 14:51132146-51132168 CCCTTGGATGGGGTTTTTTGGGG - Intergenic
1117098242 14:52318758-52318780 CCCTAGACTGGCATCTTTGGAGG - Intronic
1118479013 14:66144645-66144667 CCCTTGGATGGGGTTTTTTGGGG - Intergenic
1126552887 15:49952866-49952888 CCCTTGGATGGGGTTTTTGTGGG + Intronic
1129152952 15:73700534-73700556 CCCTTGGAGGGGACATTTGGGGG - Intronic
1129646069 15:77434582-77434604 CCTTTGGATAGTTTCTTTTGTGG - Intronic
1130036338 15:80365054-80365076 GACTTGGAGGGTATATTTGGTGG - Intronic
1130402524 15:83571079-83571101 CCGTTGGATGTTTTCTTTTGGGG + Intronic
1136659902 16:31748757-31748779 CCCTTGGATGGGGTTTTTGTGGG + Intronic
1137726615 16:50660922-50660944 CCCTTGGCTGTTTTCCTTGGGGG - Intergenic
1139112843 16:63912965-63912987 CCCTTGGTTAGAATCTTTGGAGG - Intergenic
1140777174 16:78260310-78260332 CCTTTGGATGGGGTCTTTGTGGG - Intronic
1143121311 17:4608874-4608896 CCCTTGGGTGGTATATTGGGGGG + Intergenic
1143744856 17:8985193-8985215 CTCTGGGATGGGACCTTTGGGGG - Intergenic
1144120928 17:12151446-12151468 CCTTTGAATGGCATCTTTGTGGG - Intergenic
1147699163 17:42381190-42381212 CACTTGGTTGGTATGTTTGAGGG - Intronic
1147885460 17:43681303-43681325 CCCCTGGATGGAATTTTTGCTGG - Intergenic
1149242060 17:54662661-54662683 CCCTTGGATGGGGTTTTTGTTGG + Intergenic
1149589582 17:57818593-57818615 CCCTTGGCTGGCATCTCTGCTGG - Intergenic
1153367220 18:4270663-4270685 GCTTTGGAAGGTATATTTGGAGG - Intronic
1153693853 18:7620320-7620342 CCTTTGCATGGTATCTTGGTGGG + Intronic
1155117392 18:22783412-22783434 CCTTTGGATGGGGTTTTTGGAGG + Intergenic
1158640074 18:59196205-59196227 CCCTCTGCTGGTGTCTTTGGAGG - Intergenic
1160529368 18:79554594-79554616 CCCTTGGGTGGTAACTTTCTGGG - Intergenic
1166225426 19:41392160-41392182 CCCTTGGATGGTTCCCTTGGTGG - Intronic
925447388 2:3940042-3940064 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
927000923 2:18793565-18793587 ACCTTTGATCGTTTCTTTGGTGG + Intergenic
930223611 2:48769530-48769552 CCTTTGTATGGTTTCTTAGGTGG - Intronic
930545881 2:52766460-52766482 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
932013582 2:68001455-68001477 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
932589226 2:73053875-73053897 CCCTTGGCTGGTGTCCTGGGAGG - Intronic
932826853 2:74948698-74948720 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
936848976 2:116873373-116873395 CCCTTGGATGGGGTTTTTGTAGG + Intergenic
937931619 2:127209339-127209361 CCCTTGGATGGGGTTTTTGTGGG - Intronic
939674182 2:145051268-145051290 CTCTTAGATGGTGACTTTGGAGG + Intergenic
939860528 2:147415078-147415100 CCCTTGGATGGGGTTTTTTGTGG + Intergenic
940273269 2:151914636-151914658 CCCTTGGATGGGTTTTTTGTGGG + Intronic
941088434 2:161146482-161146504 CCCTTGGATGGGGTTTTTGTGGG + Intronic
941524718 2:166592620-166592642 TCCTTTGTTGGTATATTTGGAGG + Intergenic
941591486 2:167426009-167426031 TCCTTGGATTGTTTCTTTGAAGG - Intergenic
945439633 2:209864000-209864022 CCCTTGGATGGGGTTTTTGTGGG + Intronic
945990528 2:216392154-216392176 AATTTGGATGGTATTTTTGGTGG - Intergenic
1168933413 20:1643738-1643760 CCCTTGGATGGGGTTTTTGTGGG + Intronic
1169695658 20:8384689-8384711 CCCTTGGATGGAGTATTTGTGGG + Intronic
1172133353 20:32670885-32670907 CACTTGCATGTCATCTTTGGAGG - Intergenic
1173909574 20:46654918-46654940 CCCTTGGTTCTTATTTTTGGTGG + Intronic
1177734970 21:25077668-25077690 CCTCTGAATGTTATCTTTGGAGG - Intergenic
1178521427 21:33290952-33290974 CACTAGGATGGTTTCCTTGGAGG + Intronic
1182690968 22:32162302-32162324 CCCTTTTATGGTCTCTTTTGTGG - Intergenic
949157713 3:848749-848771 CCCTTCTCTGGTCTCTTTGGGGG - Intergenic
949592817 3:5511187-5511209 CCCTTGGCTGGGATTTTTGTGGG - Intergenic
950794426 3:15499022-15499044 CCCTTGGACGGTCTCGGTGGGGG - Intronic
952659741 3:35831279-35831301 CCCTTGGAAGGTCACTGTGGTGG - Intergenic
952679313 3:36073440-36073462 CCTTTGGATGGGATTTTTTGTGG + Intergenic
953390485 3:42531052-42531074 CCCTTGGCTGATATCCTTGCAGG - Intronic
955832008 3:63015040-63015062 CCCTTGGATGGGATTTTTGTGGG + Intergenic
955923391 3:63981809-63981831 CCCTTGGAGAATATCTTTTGAGG - Intronic
956124508 3:65998673-65998695 CCATTTGATGGTTTTTTTGGGGG + Intronic
957291455 3:78282281-78282303 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
957584227 3:82114042-82114064 CCCTTGGATGGGGTTTTTGTAGG + Intergenic
958481845 3:94653629-94653651 CCCTTGGATGGGATTTTTGTGGG + Intergenic
960233563 3:115255633-115255655 CCCTTGGGTGGAGTTTTTGGGGG - Intergenic
962637087 3:137342506-137342528 CCCTTGGTTGGTACCTTGGCTGG - Intergenic
963400354 3:144790460-144790482 CCCTTGGATGGGGTTTTTTGTGG + Intergenic
965783361 3:172311427-172311449 CCCTTGGAAGGTATCTACGGTGG + Intronic
966250399 3:177859597-177859619 CCCTTGGATGGGGTTTTTGCAGG + Intergenic
971605134 4:28649557-28649579 CCCTTGTAAGGCATGTTTGGTGG + Intergenic
976538092 4:86241997-86242019 CCCTTGGATGGGGTTTTTGTGGG + Intronic
976807311 4:89062939-89062961 CCCTTGGATGGGGTTTTTGTGGG + Intronic
977049519 4:92111025-92111047 CCCTTTGATGGTATATTAGTTGG - Intergenic
979586409 4:122423439-122423461 CCCTTGGCTTGTATCCTTGATGG - Intronic
979742509 4:124168477-124168499 CCTTTGGATGGGATTTTTGTGGG - Intergenic
980489496 4:133506501-133506523 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
980626383 4:135380026-135380048 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
980864952 4:138543184-138543206 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
981092963 4:140752146-140752168 CCATTGGATGGTTCATTTGGGGG - Intronic
982887951 4:160807044-160807066 CTTTTGGATGGTAACTATGGTGG - Intergenic
984335120 4:178379949-178379971 TCCTTGGATGGGGTTTTTGGGGG - Intergenic
984625999 4:182008888-182008910 CCCTTGGATGGTGTTTTTGTGGG + Intergenic
986140767 5:5027201-5027223 CCCTTGGATGGAGTTTTTGTGGG - Intergenic
986221409 5:5771963-5771985 CCCTTGAATGTTACCTTTTGTGG - Intergenic
986431014 5:7681359-7681381 CTCCTGGGTTGTATCTTTGGAGG + Intronic
986492533 5:8307298-8307320 CCCTTGGATGGGGTTTTTGTAGG - Intergenic
988167733 5:27616439-27616461 CCTTTGGATGGTGTTTTTGTGGG + Intergenic
988364825 5:30283913-30283935 ACCTTTGATGGTATCTCTTGGGG - Intergenic
988924466 5:35975470-35975492 TGCATGGATGGTAGCTTTGGTGG - Intronic
989092158 5:37744252-37744274 CCCTTGGATGGGGTTTTTGTGGG - Intronic
990138979 5:52681839-52681861 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
993098487 5:83507654-83507676 GCATTAGATGTTATCTTTGGAGG + Intronic
993255011 5:85579787-85579809 TACTTGGATTTTATCTTTGGAGG - Intergenic
995003118 5:107158748-107158770 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
995110906 5:108428021-108428043 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
995258204 5:110072064-110072086 CCTTTGGATGGTTTTTTTTGTGG + Intergenic
995685246 5:114765757-114765779 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
996287616 5:121813182-121813204 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
997801415 5:136866277-136866299 CTCCTGGTTGGTATCTTTGAAGG + Intergenic
1000277258 5:159748873-159748895 TCCTTGTAGGGTAACTTTGGTGG - Intergenic
1000410156 5:160929327-160929349 CCCTTTGATGGGATATCTGGGGG - Intergenic
1000523627 5:162328229-162328251 CCCTTGGATGAGATTTTTGTGGG - Intergenic
1001788935 5:174437774-174437796 CCCTTGGATGGGATTTTTGTGGG - Intergenic
1005641179 6:27797948-27797970 CACATAGAGGGTATCTTTGGGGG - Intergenic
1005670397 6:28099698-28099720 CCCTTGGATGGGATTTTGTGGGG - Intergenic
1005802812 6:29444643-29444665 CCCTTGGTAGCTATCTATGGTGG - Intronic
1008244142 6:49150152-49150174 CCTTTGGATGGTATTTTTGTGGG + Intergenic
1008468142 6:51854085-51854107 CCCTTGGATAGGATTTTTGTGGG + Intronic
1008741666 6:54615753-54615775 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1010943055 6:81941908-81941930 CCCTTGGATGGTGCGTATGGTGG + Intergenic
1011321205 6:86095239-86095261 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1011510018 6:88089926-88089948 CCATTGGTTGGTATCTGTGGTGG - Intergenic
1013010748 6:106117876-106117898 CCTTTGGATGGTGCCTATGGGGG + Intergenic
1013379812 6:109557150-109557172 CCCTTGGATGGGGTTTTTGTGGG + Intronic
1013461638 6:110379552-110379574 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1014369168 6:120583777-120583799 CCCTTAGATGGCATTTTTGTGGG + Intergenic
1024099620 7:46016387-46016409 CCCTTGGATGGGATTTTTGCGGG - Intergenic
1028027764 7:85867408-85867430 CCTTTGGATGGGATTTTTGTAGG - Intergenic
1028049017 7:86159103-86159125 CCCTTGGAAGGGATTTTTGTGGG - Intergenic
1029039604 7:97558501-97558523 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1030692077 7:112546601-112546623 CCTTTGGATGGTTTTTTTGTGGG + Intergenic
1033879203 7:145860807-145860829 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1034224566 7:149472723-149472745 CCCTTGGAGGGCATGTTTGGGGG + Intergenic
1034875157 7:154719209-154719231 CACTTGGATGTTATCTATGCCGG + Intronic
1036443578 8:8802749-8802771 CCCTGGGAAGCTATCTTGGGGGG + Intronic
1038293728 8:26272222-26272244 CCCAAGGATGGTCTCTTTGATGG + Intergenic
1040736662 8:50516269-50516291 CCTTTGGATGGGATTTTTTGTGG - Intronic
1040763200 8:50874988-50875010 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1042220991 8:66473962-66473984 CCCTTGGAAGGGATCTTGGTGGG - Intronic
1043234694 8:77848370-77848392 CACTTTGGTGGTTTCTTTGGTGG - Intergenic
1043297774 8:78686473-78686495 CAATTAGATGGTTTCTTTGGTGG - Exonic
1044135781 8:88584214-88584236 CCCTTGAATGGCATTTTTGTGGG + Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1050660851 9:7880853-7880875 CCCTTGGATGGGGTTTTTGTAGG - Intronic
1051003525 9:12314703-12314725 CCCTTGGATGGGGTTTTTGTAGG + Intergenic
1051036056 9:12746910-12746932 CCCTTGGATGGGATTTTTGTGGG + Intergenic
1052546759 9:29889583-29889605 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1059746103 9:117203503-117203525 CCCTTGGATGGGGTTTTTGTGGG + Intronic
1059895243 9:118856573-118856595 CCCTTGGATGAGATTTTTGTGGG - Intergenic
1062061519 9:134498931-134498953 CCCTAGGTTGGTCTGTTTGGGGG - Intergenic
1185846166 X:3440374-3440396 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
1185865267 X:3618766-3618788 CCCTTGGAAGGTACCTATGATGG + Intronic
1186175731 X:6924053-6924075 CCCTTAGATGGTGACTTTGCAGG - Intergenic
1186431048 X:9504278-9504300 CCCTTGGATGAGATTTTTGTGGG - Intronic
1186977332 X:14922453-14922475 ACATTGAATTGTATCTTTGGAGG - Intergenic
1188884450 X:35532045-35532067 CCCTTGGATGGGGTTTTTGCAGG - Intergenic
1189571995 X:42307453-42307475 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1189730491 X:44015208-44015230 CCCATGAAGGGTAGCTTTGGAGG - Intergenic
1191022652 X:55878797-55878819 CCCTGGGATGGAGTTTTTGGGGG + Intergenic
1193048274 X:77076283-77076305 CCCTTGGATGGAATTTTTGTGGG + Intergenic
1193227335 X:78998979-78999001 CCCTTGGATGAGGTTTTTGGGGG - Intergenic
1193687270 X:84592429-84592451 CCTTTGGATGGGATTTTTGTGGG - Intergenic
1193719396 X:84970818-84970840 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
1193768434 X:85560583-85560605 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
1195147276 X:102030003-102030025 CCCTTGGATGGGGTTTTTGTGGG - Intergenic
1195979244 X:110560573-110560595 CCCTTGGTTGGGATTTTTGTGGG + Intergenic
1196517162 X:116627925-116627947 CCCTTGGATGGGGTTTTTGTGGG + Intergenic
1200798426 Y:7362729-7362751 CCCTTGGAGGGTACCTATGATGG - Intergenic
1202193538 Y:22271225-22271247 CTCTTGTATGGTTTCATTGGAGG + Intergenic