ID: 922222343

View in Genome Browser
Species Human (GRCh38)
Location 1:223618331-223618353
Sequence CTGGGTCCTCACCTGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1840
Summary {0: 1, 1: 0, 2: 24, 3: 452, 4: 1363}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922222343_922222353 23 Left 922222343 1:223618331-223618353 CCTTGCACCAGGTGAGGACCCAG 0: 1
1: 0
2: 24
3: 452
4: 1363
Right 922222353 1:223618377-223618399 GCACCATACTATCTCCACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 86
922222343_922222348 -9 Left 922222343 1:223618331-223618353 CCTTGCACCAGGTGAGGACCCAG 0: 1
1: 0
2: 24
3: 452
4: 1363
Right 922222348 1:223618345-223618367 AGGACCCAGGGTTAGTGCGGAGG 0: 1
1: 0
2: 0
3: 11
4: 140
922222343_922222352 22 Left 922222343 1:223618331-223618353 CCTTGCACCAGGTGAGGACCCAG 0: 1
1: 0
2: 24
3: 452
4: 1363
Right 922222352 1:223618376-223618398 TGCACCATACTATCTCCACCAGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922222343 Original CRISPR CTGGGTCCTCACCTGGTGCA AGG (reversed) Intronic
900314311 1:2049586-2049608 CTGGGTGTCCACCTGGTGCCTGG + Intergenic
900426621 1:2583230-2583252 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG + Intronic
900603020 1:3511256-3511278 CTGGGTCCTTCCCAGGTGAAGGG + Intronic
900664966 1:3809038-3809060 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
900710668 1:4111495-4111517 CTGGGGACTCCTCTGGTGCATGG + Intergenic
900720923 1:4175246-4175268 TTGTGTCCTCACATGGTGGAAGG - Intergenic
900729318 1:4243197-4243219 ATGTGTCCTCACATGGTGCAGGG - Intergenic
900874171 1:5329796-5329818 CTGTATCCTCACATGGTGGAAGG + Intergenic
901001621 1:6151750-6151772 CTGGCTCCTGCCATGGTGCAGGG + Intronic
901218925 1:7571240-7571262 CTGCGTCCTCACAGGGTGGAAGG + Intronic
901254594 1:7811598-7811620 CTGTGTCCTCACATGGCACAAGG + Intronic
901291395 1:8126928-8126950 CTGTGTCCCCACATGGTGGAAGG - Intergenic
901506244 1:9687674-9687696 GTGAGTGCCCACCTGGTGCAGGG + Intronic
901558766 1:10052939-10052961 CTGTGTCCTCACTTGGAGGAAGG + Intronic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
901929523 1:12588096-12588118 CTGTGTCCCTACCTGGTGCCCGG + Intronic
902189551 1:14752569-14752591 CTATGTCCTCACATGGTGGAAGG + Intronic
902556785 1:17251441-17251463 CTGTTTCCTCACCTGTTGCCTGG + Intronic
902899753 1:19506778-19506800 CTGTGTCCCCACATGGTGGAAGG + Intergenic
902907743 1:19571210-19571232 CTGTATCCTCACATGGTGGAAGG - Intergenic
903385499 1:22923648-22923670 CTGTGTCTTCACTTGGTGGAAGG - Intergenic
903388732 1:22948145-22948167 CTGTATCCTCACATGGTGGAAGG - Intergenic
903482168 1:23661698-23661720 CTGTGTCCTGACATGGTACAAGG + Intergenic
903528749 1:24013329-24013351 CTGTGTCCTCACATGTTGGAAGG - Intergenic
903666492 1:25010872-25010894 CTGTGTCTTCACTTGGTGGAAGG - Intergenic
903999999 1:27333546-27333568 CTGTGTCCCCACGTGGTGGAGGG + Intronic
904153826 1:28465677-28465699 CTGGATCCTCACCACCTGCAAGG - Exonic
904324708 1:29720862-29720884 CTGTGTCTTCACTTGGTGGAAGG + Intergenic
904451702 1:30617080-30617102 CTGAGTCCTCTCCTGGTCCCAGG - Intergenic
904614987 1:31744720-31744742 CCGGCTCCTCACCTGGAACACGG + Exonic
904869877 1:33610005-33610027 CTGCGTCCTCACATGGTGGAAGG - Intronic
904905527 1:33894852-33894874 CTGGGTCCCCATCTCCTGCAGGG + Intronic
905208220 1:36355194-36355216 GTGTGGCCTCACCTGGTGCAGGG + Exonic
905236008 1:36548737-36548759 CTGTGTCCTCACACGGTGCCAGG - Intergenic
905350178 1:37340117-37340139 CTGTGTCTTCACATGGTGGAAGG - Intergenic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
906619528 1:47264182-47264204 TTGTGTCCTCACGTGGTGAAAGG - Intronic
906697851 1:47836793-47836815 CTGTGTCCTCATATGGTGGAAGG - Intronic
906730042 1:48072932-48072954 CTGCGTCCTCACATGGTGGAAGG - Intergenic
906866209 1:49423445-49423467 CTGGGTCCTCACATAATTCATGG - Intronic
906935565 1:50211346-50211368 CTGTGTCCTCACATGGTAGAAGG + Intergenic
907078509 1:51599922-51599944 CTGTGTCCTCACCTGGAAGAAGG + Intronic
907519595 1:55014464-55014486 CTGGGGGCTCACCAGGTGCTAGG - Intergenic
907586576 1:55623239-55623261 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
907598664 1:55745002-55745024 CTGTATCCTCACATGGTGGAAGG + Intergenic
907709468 1:56865397-56865419 CTGTGTCCTCACGTGGTGGAAGG + Intronic
907810600 1:57865983-57866005 CTGTGTCCTCACATGGTGGAGGG + Intronic
907934737 1:59032119-59032141 CTGTGTCCTCACATGGTACAAGG - Intergenic
907945215 1:59129698-59129720 CTGTATCCTCACATGGTGGAAGG - Intergenic
907964166 1:59313130-59313152 CTGTGTCCTCACATGGTAGAAGG + Intronic
908089597 1:60671819-60671841 CTGTGTCTTCACATGGTGGAAGG - Intergenic
908211507 1:61905251-61905273 CTGTGTCCTCACATAGTGGAAGG + Intronic
908267361 1:62392585-62392607 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
908388531 1:63664851-63664873 CTGTGTCCTCCCATGGTGGACGG + Intergenic
908388904 1:63667921-63667943 CTGTGTCCTGACATGGTGGAAGG + Intergenic
908403772 1:63794359-63794381 CGGGTTCCTCACCTGGAACATGG - Intronic
908554632 1:65245552-65245574 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908715076 1:67061249-67061271 CTGTGTCCTCACATGTTGGAAGG - Intergenic
908740239 1:67319900-67319922 CTGCGACCTCACATGGTGGAAGG - Intronic
908905684 1:69006194-69006216 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908905853 1:69007932-69007954 CTGTGTCCTCACATGGTGGAAGG + Intergenic
909052419 1:70782637-70782659 CTGCATCCTCACATGGTGGAAGG - Intergenic
909134607 1:71782219-71782241 CTGAGTCCTTACATGGTGGAAGG - Intronic
909167687 1:72249179-72249201 CTGTGTTCTCACATGGTGGAAGG - Intronic
909198327 1:72655776-72655798 CTGTGTTCTCACATGGTGGAAGG - Intergenic
909354891 1:74697119-74697141 TTGTGTCCTCACATGGTGGAAGG - Intergenic
909706349 1:78589298-78589320 CTGTGTCCTCACGTGGTTGAGGG + Intergenic
909817929 1:80020055-80020077 CTGGGTCATCATATGGCGCAAGG - Intergenic
910084245 1:83380285-83380307 CTGTGTCTTCACATGGTGAAAGG + Intergenic
910143383 1:84051861-84051883 CTGTGTCCTCACATGATGAAAGG + Intergenic
910253481 1:85222517-85222539 CTGTGTCCTCACATGGTAGATGG + Intergenic
910544641 1:88400110-88400132 CTGTGTCCTCACATGGTAGAAGG + Intergenic
910593175 1:88950055-88950077 CTGTGTCCTTACATGGTGGAAGG - Intronic
911255483 1:95628313-95628335 CTGTGTCCTCACATAGTGAAAGG - Intergenic
911378033 1:97075628-97075650 CTGTGTCCTCACATGGTAGAGGG - Intergenic
911998259 1:104795668-104795690 CTGTGTCCTCACATGGTATAAGG - Intergenic
912269708 1:108196721-108196743 CTGTGTCCTCACATGGTGGAAGG + Intronic
912405135 1:109431319-109431341 CTGGGTCACCACCTTGTGCTAGG - Intergenic
912429032 1:109619581-109619603 CTGGGCCCTCACTTCGTGCCAGG + Intronic
912453050 1:109779136-109779158 CTGTGTCCTCACATGGTAGAAGG + Intergenic
912667607 1:111596736-111596758 CTGTGTCCTCACATGGTAGAAGG + Intronic
912695642 1:111840081-111840103 CTGCATCCTCACATGGTGGAAGG + Intronic
912720889 1:112019014-112019036 CTGTGTCCTCACATGGTGGAAGG - Intergenic
912908726 1:113734833-113734855 CTGTGTCCTCACATGGTGGAAGG - Intronic
913050293 1:115111664-115111686 CTGTGTCCTCACATGGTAGAAGG - Intergenic
913056103 1:115161241-115161263 CTGTGTCCTCATATGGTGGAAGG + Intergenic
913162921 1:116161668-116161690 CTGTGTCCTCACATGGTGGAAGG - Intergenic
913173108 1:116249963-116249985 CTGTGTCCTCACATGGCGGAAGG - Intergenic
913575542 1:120170016-120170038 CTGTTTCCTCACATGGTGGATGG - Intronic
913649206 1:120894441-120894463 CTGTGCCCTCACATGGTGGAAGG - Intergenic
914017609 1:143834707-143834729 ATGTGTCCTCACATGGTGGAAGG + Intergenic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
914172399 1:145237606-145237628 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914297277 1:146340072-146340094 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914328581 1:146645197-146645219 CTGGGCACTTACCTGGTGCTGGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914527044 1:148478609-148478631 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914557852 1:148785658-148785680 CTGTTTCCTCACATGGTGGATGG - Intergenic
914614982 1:149344572-149344594 CTGTTTCCTCACATGGTGGATGG + Intergenic
914639354 1:149588526-149588548 CTGTGTCCTCACATGGTGGAAGG - Intergenic
914656219 1:149743239-149743261 ATGTGTCCTCACATGGTGGAAGG + Intergenic
915083894 1:153371326-153371348 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915258181 1:154651724-154651746 TTGTGTCCTCACATGTTGCAAGG - Intergenic
915292564 1:154896481-154896503 CTGGGTCCTCATCTGCTCCCTGG - Intergenic
915500268 1:156311122-156311144 CTGGACCCTCAGCTGGTGCCAGG - Exonic
915553321 1:156647467-156647489 CTGGGTGCTCACCTGGCTCAGGG + Intronic
915647504 1:157284238-157284260 CTGCGTCCTCACATGGTGGAAGG + Intergenic
915647514 1:157284299-157284321 CCGTGTCCTCACATGGTGGAAGG + Intergenic
915647524 1:157284360-157284382 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915647530 1:157284390-157284412 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915647555 1:157284543-157284565 CTATGTCCTCACATGGTGGAAGG + Intergenic
915647559 1:157284574-157284596 CTGTGTCCTCACATGGTGAAAGG + Intergenic
915663137 1:157420189-157420211 CTGTGTCCTCACATGGTGGAAGG - Intergenic
915663147 1:157420250-157420272 CTGTGTCCTCACATGGTAGAAGG - Intergenic
916017183 1:160760462-160760484 CTGTGTTCTCACATGGTGAAAGG - Intergenic
916365054 1:164017301-164017323 GTGGGTGCTGACCTGGTGCTGGG - Intergenic
916539223 1:165736097-165736119 CTGCATCCTCACATGGTGGAAGG - Intronic
916671406 1:167024640-167024662 CTGTGTCCCCACATGGTGGAAGG - Intergenic
916953762 1:169810059-169810081 CTGCATCCTCACTTAGTGCAAGG + Intronic
917354313 1:174109946-174109968 CTGTGTCCTCACCTGCTAAAAGG - Intergenic
917685953 1:177416268-177416290 CTGTGTCCTCACATGGTGGAAGG - Intergenic
917919053 1:179734584-179734606 CTGTGTCCTCACGTGCTGGATGG + Intergenic
918025490 1:180740886-180740908 CTGTGTCCTCACATGGTAAAAGG + Intronic
918119643 1:181527255-181527277 CTGTGTCCTCACATGGTAGAAGG + Intronic
919019719 1:192088511-192088533 CTGGGTCCTCACGTGGTAGAAGG - Intergenic
919066353 1:192696578-192696600 CTGTGTCCTCACGTGGTGGGAGG - Intergenic
919159124 1:193805773-193805795 CTGTGTCCTCACATGGTGAAAGG + Intergenic
919221330 1:194633105-194633127 CTGGGTCCTCACATCATGGAAGG - Intergenic
919412720 1:197266329-197266351 ATGTGTCCTCATGTGGTGCAAGG + Intergenic
919461852 1:197885991-197886013 ATGTGTCCTCACATGGTGGAAGG + Intergenic
919861097 1:201739983-201740005 CTGGGTGCCCACCCGGTGAATGG + Intronic
920028397 1:203018819-203018841 CTTTGTCCTCACATGGTGGAAGG + Intronic
920178709 1:204119407-204119429 CTGTGTCCTCAGGTGGTGAAAGG + Intronic
920582584 1:207125615-207125637 CTGCGTCCTCACATGGGGGAAGG - Intronic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
920724990 1:208426708-208426730 CTGTGTCCTCACATGGTAGAAGG + Intergenic
921249749 1:213285850-213285872 CTGCATCCTCACATGGTGGAAGG - Intergenic
921361056 1:214331442-214331464 CTGTTTCCTCATCTGCTGCATGG - Intronic
921887093 1:220317982-220318004 CTGTGTCCTCACATGGTGGAAGG + Intergenic
922222343 1:223618331-223618353 CTGGGTCCTCACCTGGTGCAAGG - Intronic
922321279 1:224489852-224489874 CTGGGTCCTCACGTGTTGAAAGG + Intronic
922396376 1:225205328-225205350 CTTTGTCCTCACATGGTGGAAGG - Intronic
922514181 1:226194688-226194710 CTGAGTCCTCACATGGTAGAAGG + Intergenic
922527059 1:226312081-226312103 CTGTGTCCTCACATGGTAGAAGG + Intergenic
922790685 1:228309285-228309307 CAGAGGCCTCACCTTGTGCAGGG - Exonic
922811821 1:228420213-228420235 CTGCGTCCTCATGTGGTGCAAGG - Intergenic
922824636 1:228509128-228509150 CTGTGTCCTCACATGGTGGAAGG - Intergenic
922885711 1:229019007-229019029 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923043664 1:230338348-230338370 GTGGGTTCTCATCTGGTGCTTGG + Intronic
923091650 1:230745589-230745611 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923394972 1:233552790-233552812 CTGTGTCCTCACATGGTGGAAGG - Intergenic
923411436 1:233713779-233713801 CTGTGTCATCACATGGTGGAAGG - Intergenic
923476883 1:234342318-234342340 CTGTGTCCTCACATGGTGGCAGG - Intergenic
923515005 1:234689413-234689435 CTGTGTCCTCACATGGTGAAAGG + Intergenic
923548635 1:234943540-234943562 CTGTGTCCTCACATGGTGGGAGG + Intergenic
923899717 1:238312394-238312416 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923948048 1:238912757-238912779 CTGTGTCCTCAAGTGGTGGAAGG + Intergenic
924047537 1:240047274-240047296 CTGTGTCTTCACATGGTGGAAGG - Intronic
924119244 1:240779495-240779517 CTGTGTCCTCACCTGGTGGGAGG - Intronic
924124695 1:240838225-240838247 CTGTTTCCTCACATGGTGGAAGG + Intronic
924187594 1:241511227-241511249 CTGTGTCCTCACATGGTAGAAGG - Intronic
924282610 1:242453204-242453226 CTGTGTCCTCACCTGGGGGAAGG - Intronic
924330461 1:242935971-242935993 CTGTGTCCTCACATGGTGGAAGG - Intergenic
924485739 1:244481776-244481798 CTGGGTCCTCGCATGGCGGAAGG - Intronic
924562740 1:245170654-245170676 CTGTGTCCTCACGTAGTGGAAGG + Intronic
924572999 1:245255146-245255168 CTGGGTCATAACATGGTGGAGGG - Intronic
1062781769 10:217679-217701 CTGGGTGCTCACATTGTGCCAGG + Intronic
1062845788 10:703897-703919 CTGGGTGCTCTCCTGCTGCAGGG - Intergenic
1062963519 10:1591142-1591164 CTGGGGCCTCACCGGGAGCCTGG + Intronic
1063010192 10:2014073-2014095 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1063023535 10:2154934-2154956 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1063023557 10:2155023-2155045 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1063031511 10:2239866-2239888 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1063089054 10:2845412-2845434 CTGTGTCCTCACATGGCGGAAGG + Intergenic
1063108171 10:3012007-3012029 CTGTGTCCTCACATGGTAGATGG - Intergenic
1063168786 10:3487269-3487291 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1063226099 10:4016414-4016436 CTGTGTCCTCGCCTGGTAGAAGG - Intergenic
1063286468 10:4694070-4694092 CTGTGTCCTCACATAGTGCAGGG - Intergenic
1063551640 10:7039449-7039471 CTGTGTCCTCACCTGGGGAGTGG - Intergenic
1063762250 10:9093087-9093109 CTGTGTCCTCACCTGGAGGAAGG - Intergenic
1063801068 10:9578855-9578877 CTGGGTTCTCACATGGTAGAAGG + Intergenic
1064001600 10:11668185-11668207 CTGCGTCCTCACCTGGAAGAAGG + Intergenic
1064286506 10:13996101-13996123 CTGTGTCCTCACATGGTGGAAGG + Intronic
1064328195 10:14370380-14370402 CTATGTCCTCACATGGTGGAAGG - Intronic
1064433656 10:15292102-15292124 CTGCATCCTCACGTGGTGGAAGG + Intronic
1064801746 10:19082999-19083021 CTGTGTTCTCACATGGTGGAAGG + Intronic
1064856461 10:19773757-19773779 CTGTGTCCTCATATGGTGGAAGG + Intronic
1064934087 10:20660694-20660716 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1065327466 10:24561481-24561503 CTGTGTCCTCACATGGTAGAGGG - Intergenic
1065361033 10:24889178-24889200 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1065433563 10:25684135-25684157 CTGCATCCTCACATGGTGGAAGG + Intergenic
1065483875 10:26217981-26218003 CTGAGTCTTTACCTGTTGCATGG - Exonic
1065774093 10:29103223-29103245 CTGTGTCCTCACATGGGGGAAGG - Intergenic
1065780753 10:29164417-29164439 ATGGGTCTTCCCCAGGTGCAAGG + Intergenic
1065857600 10:29842867-29842889 CTATGTTCTCACCTGGTGGAAGG + Intergenic
1066136298 10:32449860-32449882 CTGTGTCCTCACATGATGGAAGG - Intronic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1066184727 10:32998156-32998178 CTGTGTCCTCACATGGTGGAAGG + Intronic
1066251592 10:33638050-33638072 CTGTGTCCTCAAGTGGTGGAAGG - Intergenic
1066298526 10:34076646-34076668 CTGTGTCCTCACTTGGTGTAAGG - Intergenic
1066353447 10:34659122-34659144 CTGGTTCCTCACTTTGTGCTGGG - Intronic
1066385626 10:34939048-34939070 CTGTGTCCTTACATGGTGGAGGG + Intergenic
1067150077 10:43724742-43724764 CTGTGTCCTCACATGATGAATGG - Intergenic
1067158557 10:43803145-43803167 CTGTGCCCTCACATGGAGCAAGG + Intergenic
1067343587 10:45422496-45422518 AGGTGACCTCACCTGGTGCAGGG - Intronic
1067449460 10:46372705-46372727 CTCTGTCCTCACATGGTGGAAGG + Intronic
1067583185 10:47458414-47458436 CTGTGTCCTCCCATGGTGGAAGG + Intergenic
1067587915 10:47488055-47488077 CTCTGTCCTCACATGGTGGAAGG - Intronic
1067635035 10:47996163-47996185 CTCTGTCCTCACATGGTGGAAGG - Intergenic
1067838563 10:49657257-49657279 CTGTGTCCTCACATAGTGGAAGG + Intronic
1068004321 10:51374592-51374614 CTGGGTCCTCACAAGATACAAGG - Intronic
1068106860 10:52628850-52628872 CTGGGTCCTCACATGATGAAAGG - Intergenic
1068153121 10:53160021-53160043 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1068174955 10:53446425-53446447 CTGAGTGCTCACATGGTGGAAGG + Intergenic
1068286251 10:54939796-54939818 TTGTGTCCTCAGATGGTGCAAGG + Intronic
1068293094 10:55031740-55031762 CTGTATCCTCACATGGTGGAAGG - Intronic
1068298563 10:55108066-55108088 CTTTGTCCTCACCTGGTGTTTGG - Intronic
1068524774 10:58116080-58116102 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1068657635 10:59591556-59591578 CTGGGTCATCACCAGGCCCATGG - Intergenic
1068712548 10:60150202-60150224 CTGGGACCTCATCCGGTGCCTGG + Intronic
1068848533 10:61708578-61708600 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1069036992 10:63656032-63656054 CTGAGTCCTCACATGGTGGAAGG - Intergenic
1069164786 10:65140456-65140478 CTGTGTCCTCACATGGCGGAAGG + Intergenic
1069376176 10:67795210-67795232 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1069746402 10:70717579-70717601 CAGGGTCCTCTCCTGGCCCAGGG + Intronic
1069747549 10:70725559-70725581 CTGTGTCCTCACATGGTAGAAGG + Intronic
1069854506 10:71432583-71432605 GTTGGTCCTCACCTGGGGAAAGG + Intronic
1070532476 10:77349250-77349272 CTGTGTCCTCACATGGTGGAAGG - Intronic
1070557737 10:77542102-77542124 CTGTGTCCTCACATGATGGAAGG - Intronic
1070573375 10:77658557-77658579 CTGTGTCCTCACGTGGTAGAAGG - Intergenic
1070578920 10:77704075-77704097 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1070583575 10:77743480-77743502 CTGTGTCCTCACATGGTAAAGGG - Intergenic
1071200577 10:83217631-83217653 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1071519454 10:86320011-86320033 CTGGGGCCTCCCCTCGTGCCTGG + Intronic
1071549150 10:86552861-86552883 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1071610082 10:87023868-87023890 CTCTGTCCTCACATGGTGGAAGG + Intronic
1071787459 10:88917925-88917947 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1071860234 10:89664834-89664856 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1071884130 10:89931007-89931029 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1071899150 10:90100383-90100405 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1071966868 10:90860395-90860417 CTGTGTCCTCACCTGGCAAAGGG + Intergenic
1072171093 10:92862491-92862513 CTGCATCCTCACATGGTGGAAGG - Intronic
1072465427 10:95657914-95657936 CTGTATCCTCACGTGGTGGAAGG - Intergenic
1072912321 10:99514341-99514363 CTAGGTCAACACCTGGTCCATGG + Intergenic
1073080903 10:100860072-100860094 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1073429288 10:103475979-103476001 CTGCTTCCTCACCTGGAGAATGG + Intronic
1073470645 10:103720179-103720201 CTGTGTCCTCACATGATGGAAGG + Intronic
1073765308 10:106675865-106675887 CTGTATCCTCACGTGGTGGAAGG - Intronic
1073960466 10:108921096-108921118 TTGTGTTCTCACCTGGTGAAAGG - Intergenic
1073983214 10:109178309-109178331 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1074079703 10:110157790-110157812 CTCTGTCCTCACATGGTGGAAGG + Intergenic
1074270596 10:111949895-111949917 CTGTGTCCTCACATGGTACAAGG - Intergenic
1074480446 10:113815503-113815525 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1074625433 10:115178720-115178742 CTGTGTCCTCACATGGTGGAAGG - Intronic
1074769490 10:116724072-116724094 CTGGGCCCTCCCCAGGTGCAGGG - Intronic
1074917762 10:117974018-117974040 CTATGTCCTCACATGGTGGAAGG + Intergenic
1074983267 10:118636424-118636446 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1075098264 10:119487924-119487946 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1075161832 10:120031121-120031143 CTGGGTCCTCACAGGGTGGAAGG - Intergenic
1075217742 10:120553394-120553416 CTGTGTCATCACATGGTGGAAGG - Intronic
1075222333 10:120596067-120596089 CTGTGTCCTCACATGGTGGCAGG + Intergenic
1075359416 10:121816576-121816598 CTGTGTCCTCATGTGGTGGAAGG - Intronic
1075406629 10:122199854-122199876 CTGTGTCCTGACATGGTGAAAGG + Intronic
1076087203 10:127644147-127644169 CTGTGTCCTCACATGGTGGGAGG - Intergenic
1076514162 10:131033804-131033826 GTGGGTGGGCACCTGGTGCAGGG + Intergenic
1076595018 10:131619990-131620012 CTGTGCCCTCTCCTGGTGGAGGG + Intergenic
1076779639 10:132717145-132717167 CTGCGTCCTCACGTGGTGGAGGG + Intronic
1077220965 11:1416047-1416069 CTCAGGGCTCACCTGGTGCACGG + Intronic
1077501709 11:2912401-2912423 CTGGCTCCTGGCCTGGTGCGGGG + Intronic
1077548902 11:3190727-3190749 CTGTGTCCTCACGGGGTGGAAGG + Intergenic
1077554884 11:3221137-3221159 CTCCCACCTCACCTGGTGCATGG + Intergenic
1077977506 11:7263310-7263332 CTGTGTCCTCACATGGTGGAAGG + Intronic
1077980386 11:7294079-7294101 CTGTGTCCTCATATGGTGGAAGG + Intronic
1078056659 11:8014795-8014817 CTGTATCCTCACTTGGTGGAAGG + Intergenic
1078233195 11:9461016-9461038 CTGTTTCCTGTCCTGGTGCATGG + Exonic
1078412696 11:11140439-11140461 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1078414264 11:11152442-11152464 CTGTGTCATCACATGGTGGAAGG + Intergenic
1078471944 11:11595321-11595343 CTGTGTCCTCACATGGTAAAAGG - Intronic
1078499017 11:11850884-11850906 CTGTGTCCTCACATGGTGGAAGG + Intronic
1078928531 11:15895447-15895469 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1078964754 11:16325896-16325918 CTGTGTCCTCACATGGCGGAAGG - Intronic
1079242536 11:18730615-18730637 GTGGGTCCTCACCAGGGTCACGG + Intronic
1079461107 11:20678708-20678730 CTGTGTCCTCAAATGGTGGAAGG + Intronic
1079519119 11:21303914-21303936 CTGCGTCCTCACATGGTGGAAGG + Intronic
1079551271 11:21701459-21701481 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1079877790 11:25881529-25881551 CTGTGTCCTAACATGGTGAAAGG - Intergenic
1079966528 11:26987017-26987039 CTATGTCCTCACATGGTACAAGG - Intergenic
1080025050 11:27604617-27604639 CTGTGTTCTCACATGGTGAAAGG - Intergenic
1080095759 11:28404465-28404487 CTGTATCCTCACATGGTGGAAGG + Intergenic
1080116443 11:28626483-28626505 CTGTGTCCTCACATGGTGTAAGG + Intergenic
1080116979 11:28632026-28632048 CTGTGTCCTCATGTGGTGAAAGG - Intergenic
1080195487 11:29603631-29603653 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1080233684 11:30045636-30045658 CTGGGTGCTCAACTTGTGCCTGG - Intergenic
1080294090 11:30705274-30705296 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1080335333 11:31188976-31188998 CTGCATCCTCACATGGTGGAGGG - Intronic
1080420936 11:32109922-32109944 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1080450098 11:32371941-32371963 CTGTGTCCTTACATGGTGGAGGG - Intergenic
1080492698 11:32783579-32783601 CTGTGTCCTCACATGGTGGAAGG + Intronic
1080777284 11:35397746-35397768 CTGTGTCCTGACCTGGTGGAAGG - Intronic
1080792215 11:35531612-35531634 CTGAGTCCTCACATGGTGGAAGG + Intergenic
1080827052 11:35857247-35857269 CTGCATCCTCACCTGGTAGAAGG + Intergenic
1080942372 11:36933966-36933988 CTGTGTCCTCACATGGTTGAAGG + Intergenic
1081062670 11:38500018-38500040 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1081163517 11:39781871-39781893 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1081174635 11:39912453-39912475 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1081261917 11:40971699-40971721 CTGGGGCTTTACCAGGTGCAAGG - Intronic
1081337084 11:41880075-41880097 CTATGTCCTCACATGGTGGAAGG - Intergenic
1081348302 11:42017669-42017691 CTGTGTCCTCACATGGTGGTAGG + Intergenic
1081439137 11:43061251-43061273 CTGCATCCTCACATGGTGGAAGG + Intergenic
1081848258 11:46256757-46256779 CTGCGTCCTCATGTGGTGAAAGG - Intergenic
1082095538 11:48126578-48126600 CTGGGTCTTCACGTGGTTGAAGG + Intronic
1082114312 11:48311586-48311608 CTGTGTCCTCACATGGTGGTAGG + Intergenic
1082874778 11:57977325-57977347 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1084100269 11:66943324-66943346 CTGCGTCCTCACAGGGTGGAAGG - Intronic
1084721016 11:70905650-70905672 CTGTGTCCTCACATGGCGGAAGG - Intronic
1084775251 11:71370608-71370630 CCAGGTCCTCACCTGGTGCTGGG - Intergenic
1084788129 11:71455629-71455651 CTGTGTCCTCACATGGTAGAAGG - Intronic
1085250242 11:75138681-75138703 CTGTGTCCTCACATGGTGGAAGG + Intronic
1085536966 11:77227559-77227581 CTGAGTCCACACTTTGTGCAAGG - Intronic
1085853654 11:80151338-80151360 CTGAGTCCTTACCTCCTGCAAGG + Intergenic
1085871825 11:80359116-80359138 CTGGGTCCTCACATGGTGGAAGG + Intergenic
1085901186 11:80701795-80701817 CTGGGTCCTCACATAGTAAAGGG + Intergenic
1085923939 11:80991842-80991864 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1086040527 11:82472061-82472083 CTGTGTCCTCACATGATGGAAGG + Intergenic
1086640766 11:89152826-89152848 CTGAGTCCTCACATGGTGAAGGG + Intergenic
1086790429 11:91030733-91030755 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1087087009 11:94230071-94230093 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1087570443 11:99920694-99920716 CTGTGTACTCACATGGTGGAAGG + Intronic
1087917539 11:103828649-103828671 CTGTGTCATCACATGGTGAAAGG - Intergenic
1087947812 11:104185453-104185475 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1088144591 11:106660607-106660629 CTGTGTCCTCACCTGATGAAAGG - Intergenic
1088252922 11:107877225-107877247 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1088324193 11:108585453-108585475 CTGTGTCCTCACATGGTAGAAGG - Intronic
1088427737 11:109723441-109723463 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1088489973 11:110377592-110377614 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1088713439 11:112528191-112528213 ATGTGTCCTTACCTGGTGGAAGG - Intergenic
1088743832 11:112787984-112788006 ATGTGTCCTCACATGGTGGAAGG - Intergenic
1088917462 11:114238475-114238497 CGGTGTCCTCACGTGGTGGAAGG + Intronic
1089639538 11:119838708-119838730 CTGTGTCCTCACATGCTGGAAGG + Intergenic
1089950746 11:122523895-122523917 CTGGGACCTCATGTGGTACAAGG - Intergenic
1090455063 11:126842003-126842025 CCCCATCCTCACCTGGTGCAGGG - Intronic
1090986692 11:131773221-131773243 CTGTGTCCTCACATGGTGTAAGG + Intronic
1091009702 11:131988108-131988130 CTGTGTCCTCACATAGTGGAAGG + Intronic
1091022087 11:132109362-132109384 CTGTGTCCTCACATGGTGGAAGG - Intronic
1091053152 11:132393079-132393101 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1091409341 12:228931-228953 CTGGGTGCACCCCTGATGCAGGG - Intronic
1091521586 12:1249852-1249874 TTGTGTCCTCACATGGTGGAAGG + Intronic
1091667514 12:2430093-2430115 GTGTGTCCTCACATGGTGGAAGG + Intronic
1091958260 12:4667108-4667130 CTGTGTGCTCACATGGTGGAAGG + Intronic
1092123364 12:6059595-6059617 CTGTGTCCTCACATGGTGGAAGG + Intronic
1092287022 12:7134508-7134530 CTGGGTCTTGGCCTGGGGCAGGG + Intronic
1092349586 12:7745268-7745290 CTGTGTCCTCACATGATGGAGGG - Intronic
1092350707 12:7753512-7753534 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1092361472 12:7840196-7840218 ATGTGTCCTCACATGGTGGAAGG - Intronic
1092386182 12:8037412-8037434 CAGTGTCCTAACCTGGTGCTAGG + Intronic
1092660109 12:10729481-10729503 GTGGGTCCTTACATGGTGGAAGG + Intergenic
1092769202 12:11881549-11881571 CTGTGTCTTCACTTGGTGGAAGG + Intronic
1093195180 12:16122141-16122163 CTGCGCCCTCACATGGTGGAAGG + Intergenic
1093763085 12:22932230-22932252 CTGTGTCCTCACATGGGGAAAGG - Intergenic
1093909291 12:24727297-24727319 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1094027422 12:25973746-25973768 CTGTGTCCTCACATGGTAGAAGG - Intronic
1094083109 12:26559460-26559482 CTGTGTCCTCACATGGTAGAAGG + Intronic
1094442872 12:30498659-30498681 CTGTGACCTCACATGGTGGAAGG - Intergenic
1095353280 12:41240728-41240750 TTGTGTCCTCACATGGTGGACGG + Intronic
1095860270 12:46908651-46908673 GTGGGCCCTCCTCTGGTGCAGGG - Intergenic
1096005313 12:48165786-48165808 CTGTGTCCTCATATGGTGGAAGG - Intronic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1096219839 12:49822126-49822148 TTGTGTCCTCACATGGTGGAAGG - Intronic
1096488678 12:52001550-52001572 CTGTGTCTTCACATGGTGCAAGG + Intergenic
1097073683 12:56376284-56376306 CTGTGTCCTCACATGGCACATGG + Intergenic
1097644867 12:62224443-62224465 CTGTGTCCTTACATGGTGGAAGG + Intronic
1098031741 12:66261724-66261746 CTGTGTCCTCACGTGGTAAAAGG - Intergenic
1098111150 12:67123169-67123191 GTGTGTCCTCACATGGTGGAAGG + Intergenic
1098345385 12:69497444-69497466 CTGTGTCCTCACATGGTAGAGGG + Intronic
1098469533 12:70827474-70827496 CTGGGTCCTCACACAGTGGAGGG + Intronic
1098492264 12:71095344-71095366 CTGTGTCCTCACATGGTGGAAGG + Intronic
1099303005 12:80921155-80921177 CTGTGTCCTCACGTGGTAGAAGG - Intronic
1099485324 12:83222777-83222799 CTGTGTCCTCACATGTTGGAAGG + Intergenic
1099744097 12:86679683-86679705 CTGTGTCCTCACATGGTAGAAGG - Intronic
1099925222 12:89008880-89008902 CTGTGTCCTCACATGGTGGCAGG + Intergenic
1099969238 12:89483478-89483500 CTGTGTCCTCACATGGTGAGAGG + Intronic
1100027704 12:90150199-90150221 CTGGAACCTCACATGGTGGAAGG - Intergenic
1100116795 12:91315546-91315568 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1100121686 12:91375845-91375867 CTGTGTCCTCACCTGGCAGAAGG + Intergenic
1100335377 12:93624157-93624179 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1100593684 12:96053406-96053428 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1100677354 12:96881879-96881901 CAGTGTCCTCACTTGGTGGAAGG + Intergenic
1100841166 12:98612851-98612873 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1100901931 12:99251019-99251041 CTGGGTCCTCACATGGTGGAGGG + Intronic
1100917154 12:99437193-99437215 CTGTGTCCTCATGTGTTGCAAGG + Intronic
1101235725 12:102787402-102787424 CTGTGTCCTCACATGGTGGGAGG - Intergenic
1101260610 12:103025892-103025914 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1101385017 12:104249217-104249239 CTGTGTCCTCACATGGTGGAAGG + Intronic
1101400714 12:104384333-104384355 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1101426471 12:104592424-104592446 CTATGTCCTCACATGGTGGAGGG + Intronic
1101432101 12:104635138-104635160 CTTGGTCATCACCTAGTGAAAGG - Intronic
1101510125 12:105385404-105385426 CTGTGTCCTCACTTGGTAGAAGG - Intronic
1101734569 12:107453455-107453477 CTGTGTTCTCACATGGTGGAAGG - Intronic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1102407290 12:112684917-112684939 CTACGTCCCCACCTGGTGGAAGG + Intronic
1102414325 12:112747311-112747333 CTGTGTCCTCACATGGTGGAAGG - Intronic
1102487876 12:113270418-113270440 CTGTGTCCTCACGTGGTGGAAGG + Intronic
1102575602 12:113854370-113854392 CTGGGTCTACACCGTGTGCACGG - Intronic
1102812907 12:115839789-115839811 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1103182819 12:118928835-118928857 CTGTGTCCTCACATGGCGGAAGG - Intergenic
1103222122 12:119254724-119254746 CTGGGTCCTCACATGGCAGAAGG + Intergenic
1103359965 12:120347677-120347699 CTGTGTCCTGACCTGTGGCATGG + Intronic
1103441050 12:120963446-120963468 CGGGGCCCTCACCTGGTGCAAGG + Intergenic
1103965747 12:124638302-124638324 CTGTGTCCTCACGCGGTGAAAGG - Intergenic
1103966451 12:124642964-124642986 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1103995625 12:124828262-124828284 CAGGGGCCTCTCCAGGTGCAGGG - Intronic
1104002920 12:124871879-124871901 CTGTGTCCTTGCCTGGTGGAAGG - Intronic
1104047156 12:125171559-125171581 CTGTGTCCTCATCTGGAGCTTGG + Intergenic
1104078146 12:125408437-125408459 CTGTGTCCTCGCATGGTGGAAGG - Intronic
1104110784 12:125702262-125702284 CTGTGTCCCCACCAGGTGGAGGG + Intergenic
1104128778 12:125872799-125872821 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1104207916 12:126657827-126657849 CTGTGTCCTCGCATGGTGGAAGG - Intergenic
1104236363 12:126941752-126941774 CTGTGTCCTCACATGGTGGAGGG + Intergenic
1104414714 12:128588722-128588744 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1104535888 12:129617725-129617747 CTGCATCCTCTCCTGGTGGAAGG + Intronic
1104593123 12:130100336-130100358 TTGTGTCCTCACGTGGTGGAAGG - Intergenic
1104770796 12:131363006-131363028 TTGCATCCTCACATGGTGCAAGG + Intergenic
1104979233 12:132566202-132566224 CTGCGTCCTCACATGGTGGAAGG + Intronic
1105658805 13:22470561-22470583 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1106223504 13:27767455-27767477 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1106387454 13:29301911-29301933 CTGTGTCCTCACCTGGTAGAAGG + Intronic
1106530947 13:30590789-30590811 GTGTGTCCTCACATGGTGGAAGG - Intronic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1106762046 13:32876939-32876961 TTGCATCCTCACCTGGTGGAAGG - Intergenic
1106797877 13:33226045-33226067 CTGTGCCCTCACATGGTGGAGGG - Intronic
1106871941 13:34031126-34031148 CTGTGTCCTAGCCTGGTGGAAGG - Intergenic
1106999352 13:35525834-35525856 CTGTGTCTTCACATGGTGGAAGG + Intronic
1107066399 13:36217963-36217985 CTGTGTCCTCACGTGGTAGAAGG - Intronic
1107300799 13:38963881-38963903 CTGTGTCCTCAGTTGGTGGAAGG - Intergenic
1107400823 13:40067311-40067333 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1107600127 13:42004617-42004639 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1107623060 13:42253311-42253333 CTGTGTCCGCACATGGTGGAAGG - Intronic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1107677137 13:42809070-42809092 CTGTGTCCTCACATAGTGAAAGG - Intergenic
1107748853 13:43542896-43542918 CTGAGTTCTCACATGGTGGAAGG + Intronic
1107791180 13:44003861-44003883 CTGCGTCCTCACATAGTGGAAGG - Intergenic
1107999505 13:45893469-45893491 ATGTGTCCTCACATGGTGGAAGG + Intergenic
1108054724 13:46474219-46474241 CTGCCTCCTCACATGGTGGAAGG - Intergenic
1108057029 13:46495299-46495321 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1108161466 13:47644724-47644746 CTGGGTCCTCATATGGTGGAAGG - Intergenic
1108568021 13:51720787-51720809 CTGTGTCCTCACATGGTGAAAGG + Intronic
1108606073 13:52039997-52040019 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1109143058 13:58740412-58740434 CTGCTTCCTCACATGGTGGAAGG - Intergenic
1109191534 13:59329698-59329720 CTGTGTCCTCAAGTGGTGCAGGG + Intergenic
1109232998 13:59781912-59781934 CTGTGTCCTCATGTGGTGGAAGG - Intronic
1109233523 13:59787908-59787930 CTGTGTCCTCACATTGTGGAAGG - Intronic
1109263996 13:60175625-60175647 CTGGATCCCCACATGGTGGAGGG - Intergenic
1109281121 13:60356811-60356833 CTGTGTCCTCACTTGGTAGAAGG + Intergenic
1109478094 13:62911506-62911528 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1109658737 13:65430138-65430160 CTGCATCCTCACATGGTGGAAGG - Intergenic
1109720766 13:66273372-66273394 CTGTGTCCTCCCATGGTGCAAGG - Intergenic
1109752886 13:66719451-66719473 CTGAGTCCTCACATGGTGGAGGG - Intronic
1110244889 13:73311445-73311467 CTGTGTCCTCGCATGGTGAAAGG - Intergenic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1110486447 13:76050453-76050475 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1110752595 13:79132450-79132472 CTGTGTCCTTATCTGGTGAAGGG + Intergenic
1110918804 13:81058450-81058472 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1111260563 13:85734377-85734399 CTGTGTCCTCACATGGTGGAGGG - Intergenic
1111608994 13:90578985-90579007 CTGTGTCCTCACATGGTGGAGGG + Intergenic
1111720301 13:91935423-91935445 CTGTGTCCTCACATGGTGGAAGG - Intronic
1111954264 13:94739920-94739942 CTGCGTCCTCACATGATGGAAGG + Intergenic
1112028916 13:95439287-95439309 CTGCATCCTCACATGGTGGAAGG + Intronic
1112462982 13:99619279-99619301 CTGTGTCCTCACATGGCGCAGGG - Intronic
1112523745 13:100122874-100122896 CTGTGTCCTCACATGGTGGAAGG + Intronic
1112608101 13:100927842-100927864 CTGGTTCCTCACATGGTAGAAGG + Intergenic
1112719766 13:102230149-102230171 CTGTGTTCTCACATGGTGCAAGG - Intronic
1112998608 13:105604596-105604618 CTGGGCCTTCACATGGTGGAAGG + Intergenic
1113030999 13:105993487-105993509 TTGTGTCCTCACATGGTGGAAGG + Intergenic
1113035848 13:106047770-106047792 CTGTGTCCTCACATGATGGAAGG - Intergenic
1113074167 13:106451726-106451748 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1113395662 13:109945256-109945278 CTGCATCCTCACATGGTGGAAGG + Intergenic
1113492576 13:110704003-110704025 CTGTGTCCTCACATGGTAGAAGG - Intronic
1113501539 13:110779355-110779377 CTGTGTGCTCACATGGTGGAAGG + Intergenic
1113834483 13:113319663-113319685 CTGGGGCCTCACCTGGGAGAGGG + Intronic
1114260001 14:21029756-21029778 CTGTGTCCTCACATGGTAGAAGG - Intronic
1114838357 14:26232027-26232049 CTGTGTCCTCACATGGTAGATGG - Intergenic
1114870910 14:26657399-26657421 CTGTGTCCTCATATGGTGAAAGG - Intergenic
1114888757 14:26889023-26889045 CTGGGTCCTCATATGGTGAAAGG + Intergenic
1115143089 14:30196534-30196556 CTGTGTCCTCACATGGTGGCGGG - Intergenic
1115389278 14:32836316-32836338 CTGCATCCTCATCTGGTGGAAGG + Exonic
1115863649 14:37717972-37717994 CTGTGTCCTCACATGGTGGAAGG - Intronic
1115913540 14:38283640-38283662 CTGTGTCCTCAGGTGGTGGAAGG - Intergenic
1115956964 14:38792114-38792136 CTGGGGCCTCACATTGTGCTTGG - Intergenic
1116250685 14:42479219-42479241 CTGTGTCCACACGTGGTGGAAGG - Intergenic
1116663979 14:47751082-47751104 CTGGTTACTCATCTGGTTCATGG - Intergenic
1116948516 14:50857801-50857823 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1117118013 14:52536220-52536242 CTGTGTCCTCACATGATGAAAGG - Intronic
1117157701 14:52957184-52957206 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1117303634 14:54452050-54452072 CTGTGTCCTCACGTGGTAGAAGG + Intergenic
1117514356 14:56485682-56485704 CTGAGTCCTCACATGGTGGAAGG - Intergenic
1118068285 14:62216422-62216444 CTGCGTCTTCACATGGTGGAAGG - Intergenic
1118072529 14:62261427-62261449 CTGGGTCCTCACGTGGTGGAAGG - Intergenic
1118386714 14:65261785-65261807 CTGTGTCCTCACATTGTGGAAGG + Intergenic
1118401033 14:65379877-65379899 CTGGGTCCTCACCTGGAAGAAGG + Intergenic
1118620285 14:67608782-67608804 TTGTGTCCTCACATGGTACAAGG + Intergenic
1118979441 14:70704361-70704383 CTGCGTCCTCACATAGTGGATGG - Intergenic
1119140587 14:72263669-72263691 CTGTGTCCTCACATGGTGAAAGG - Intronic
1119171709 14:72540743-72540765 CTGGGTACTCCCCGGGGGCAAGG + Intronic
1119537262 14:75412628-75412650 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1119547653 14:75484122-75484144 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1119622832 14:76145630-76145652 CTGTGTCCTCACATGATGAAAGG - Intergenic
1119629396 14:76214575-76214597 TTGTGTCCTCACATGGTGAAGGG + Intronic
1119911468 14:78353432-78353454 CTGTGTCCTCACATGGTGGAAGG + Intronic
1120095610 14:80384429-80384451 CTATGTCCTCACATGGTGGAAGG + Intronic
1120221632 14:81741015-81741037 CTGTGTCCTCACATGGTGAAAGG - Intergenic
1120322620 14:82984365-82984387 CTGTGTCCTTACATGGTGGAGGG + Intergenic
1120355225 14:83424859-83424881 CTATGTCTTCACCTGGTGGAAGG - Intergenic
1120498908 14:85269687-85269709 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1120760008 14:88276284-88276306 CTGTGTCCTCACTCGGTGGAAGG - Intronic
1120924567 14:89784762-89784784 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1121069919 14:91009279-91009301 CTGTGTCCTCACATGGTGGAAGG - Intronic
1121303550 14:92890520-92890542 CAGTGTCCTCACATGGTGGAAGG - Intergenic
1121311656 14:92938682-92938704 CTGGGTCCACACGTGGTGGGTGG - Exonic
1121427303 14:93861625-93861647 CTGTGTTCTCACATGGTGGAGGG - Intergenic
1121627831 14:95399674-95399696 CTGTGTCCTCACATGGTTGAAGG + Intergenic
1121694207 14:95899680-95899702 CTGCCTCCTCACCTAGTGGAGGG + Intergenic
1121713632 14:96057259-96057281 CTGTGTCCTCACAAAGTGCAAGG - Intronic
1121789982 14:96691815-96691837 CTGTGTCCTCACATGGTGGGAGG + Intergenic
1121825191 14:97004478-97004500 CTGTGTCCTCACATGGTGAAAGG - Intergenic
1121844635 14:97162025-97162047 CTGTGTCCTCACATGGCGGAAGG + Intergenic
1121853171 14:97242374-97242396 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1121862247 14:97329447-97329469 CTGTGTCCTCACAGGGTGGAGGG + Intergenic
1121881440 14:97503871-97503893 CTCTGTCCTCACATGGTGAAAGG - Intergenic
1121933579 14:97995854-97995876 CTGGGACAGGACCTGGTGCATGG - Intergenic
1121941788 14:98077728-98077750 CTGTGTCCTCACATGGCACAAGG + Intergenic
1121974732 14:98392374-98392396 CTGTGTCCTTACATGGTGGATGG - Intergenic
1122495843 14:102154365-102154387 CTGTGTCCTCACATGGTGGAGGG + Intronic
1122623175 14:103071159-103071181 CTGGCTCCTTCCCTGCTGCATGG + Intergenic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1122833499 14:104417747-104417769 CTGTGTCCTCACTTGGTGGAAGG - Intergenic
1122913650 14:104845782-104845804 CTGTGTCCTCACATGGTGGGAGG - Intergenic
1123215408 14:106804807-106804829 CTGTGACCACACCTGGTGGAAGG + Intergenic
1123670748 15:22654410-22654432 CTGCATCCTCACTTGGTGAAAGG - Intergenic
1123905053 15:24912758-24912780 CTATGTCCTCACATGGTGAATGG - Intronic
1123985846 15:25645203-25645225 CTGGGTCCTCACATAGGGGAAGG - Intergenic
1124062124 15:26303374-26303396 CTGTGTCCTCACATGGTGGGAGG + Intergenic
1124096006 15:26649339-26649361 CTGGGTCATCACATGGTGGAGGG - Intronic
1124136194 15:27038292-27038314 GTGTGTCGTCACATGGTGCAGGG + Intronic
1124245041 15:28061615-28061637 CTGTGTACTCACCTGGTGGAAGG - Intronic
1124347619 15:28933004-28933026 CTGCGTCCTAACATGGTGGAAGG + Intronic
1124347667 15:28933333-28933355 CTCTGTCCTCACATGGTGGAGGG - Intronic
1124362071 15:29044972-29044994 CTGTGTCCACACATGGTGAAAGG + Intronic
1124381417 15:29170674-29170696 CTGTGTCCTCACATGGTGTGGGG - Intronic
1124395954 15:29301833-29301855 CTGTGTCCTCACATGGTGGAAGG - Intronic
1124412240 15:29446091-29446113 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1124465920 15:29939787-29939809 TTGAGTCCTCACATGGTGAAAGG - Intronic
1124526722 15:30460837-30460859 CTGCATCCTCACTTGGTGAAAGG - Intergenic
1124572585 15:30878666-30878688 CTGTGTCCACACATGGTGGAAGG - Intergenic
1124598993 15:31115940-31115962 CTATGTCCTCACATGGTGGAAGG + Intronic
1124663518 15:31570727-31570749 CTGGCATCACACCTGGTGCAGGG - Intronic
1124719208 15:32097453-32097475 CTGTGTCCTCGCATGGTGGAAGG - Intronic
1124771931 15:32546846-32546868 CTGCATCCTCACTTGGTGAAAGG + Intergenic
1125215201 15:37264040-37264062 CTGCATCCTCACATGGTGAAAGG - Intergenic
1125217249 15:37289553-37289575 CTGTGTCTTCACCTGGTGGAAGG + Intergenic
1125370042 15:38965596-38965618 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1125477641 15:40058230-40058252 CACTGTCCTCACCTGGTGGAAGG + Intergenic
1126143748 15:45457463-45457485 CTGGGTCCTCACCTGTTTCTGGG + Intergenic
1126358742 15:47823591-47823613 CTGAGACCTCACATGGTGGAAGG - Intergenic
1126541163 15:49825574-49825596 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1126541408 15:49828486-49828508 CAGTGTCCTCACATGGTGAAAGG + Intergenic
1126578461 15:50220571-50220593 CTGGGTGCTCACCTGCTCCCAGG - Intronic
1127093824 15:55493109-55493131 CTGTGTCCTCACATGGTGGAAGG - Intronic
1127783777 15:62338679-62338701 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1127795233 15:62432384-62432406 CTGTGTCCTCACATGGTAGAAGG + Intronic
1128203562 15:65830652-65830674 CTGGGGCCTCACTTGGTTCGTGG - Intronic
1128301624 15:66569748-66569770 CTGTGTCCTCACATGGGGGAAGG - Intergenic
1128405470 15:67333051-67333073 CTGTGTCCTCACATGGTGGAGGG + Intronic
1128486252 15:68092729-68092751 CTGTGTCCTCACAGGGTGAAAGG - Intronic
1128507687 15:68287772-68287794 CTGTGTCCTCACATGGTGGAAGG + Intronic
1128860739 15:71069599-71069621 CTGTGTCCTCACATCGTGCTGGG + Intergenic
1128912324 15:71527130-71527152 CTGTGTCCTTACATGGTGAAAGG - Intronic
1129056152 15:72821860-72821882 CATGGTCCTCAGCTGGTCCAAGG + Intergenic
1129580471 15:76803667-76803689 CTGTGTCTTCACATGGTGGAGGG + Intronic
1129589553 15:76903515-76903537 CTGTCTCCTTACATGGTGCAAGG - Intronic
1129612517 15:77071763-77071785 TTGGGTGCTCACCCGGTGCCAGG + Intronic
1130050113 15:80477343-80477365 CTGTGTCCTCACATGGTGGAAGG + Intronic
1130768600 15:86900195-86900217 CTGGCTCCTCAGCTTGTGGATGG + Intronic
1130785777 15:87094421-87094443 CTGTGTCCTCACCTGGTAGAAGG - Intergenic
1130949810 15:88576897-88576919 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1131064279 15:89423612-89423634 CTGGTTCCTCATCTGGAACAGGG - Intergenic
1131081923 15:89543800-89543822 CTGGGTACTGACCTGCTGCCTGG + Intergenic
1131322202 15:91405312-91405334 CTGTGTCCTCACATGGTGTAAGG + Intergenic
1131345171 15:91640154-91640176 TTGTGTCCTCACATGGTGGAAGG + Intergenic
1131539952 15:93267656-93267678 CTGTGTCCTCACATGGTAGAGGG + Intergenic
1131960393 15:97784471-97784493 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1132034396 15:98469171-98469193 CCGTGTCCTCACATGGTGAAAGG - Intronic
1132084805 15:98899430-98899452 CTGTGTGCTCACTTGGTGTAAGG - Intronic
1132119408 15:99163766-99163788 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1132248871 15:100318471-100318493 CTGTGTCCTCACCTGGGGGAAGG - Intronic
1132689898 16:1177756-1177778 CTGTGTCCTCACCTGGTGGGAGG + Intronic
1132767012 16:1539492-1539514 CCAGGTCCTCACCTGCTGCCAGG + Intronic
1133380963 16:5330036-5330058 CCGTGTCCTCACATGGTACAAGG + Intergenic
1133441142 16:5821817-5821839 CTGCATCCTCACATGGTGAAAGG + Intergenic
1133663713 16:7944445-7944467 CTGTGTTCTCACATGGTGAAAGG - Intergenic
1133960946 16:10492924-10492946 CTGCCTCCTCACCTCCTGCACGG + Intergenic
1134296259 16:12948614-12948636 TTGTGTCCTCACATGGTGGAAGG + Intronic
1134782737 16:16913368-16913390 CTGCATCCTCACTTGGTGTAAGG - Intergenic
1134832382 16:17334038-17334060 CTGTGACCTCACATGGTGAAAGG - Intronic
1134902741 16:17953341-17953363 CTATATCCTCACCTGGTGGAGGG + Intergenic
1135060101 16:19264071-19264093 CTGAGTCCCCACATGGTGGAAGG - Intronic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135299658 16:21314619-21314641 TTGTGTCCTCACATGGTGGAAGG + Intergenic
1135504211 16:23022132-23022154 CAGTGTCCTCACCTGATGCCTGG - Intergenic
1135507962 16:23055445-23055467 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1135568165 16:23528047-23528069 CTGCATCCTCACGTGGTGGAGGG - Intronic
1135643760 16:24143466-24143488 CAGGGTACTCATCTGTTGCAAGG - Intronic
1135804397 16:25529024-25529046 CTGTGTCCTCATATGGTGCAGGG + Intergenic
1135845327 16:25913378-25913400 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1136285903 16:29241646-29241668 CTGGGCCCTGCCCTGATGCAAGG + Intergenic
1137351064 16:47714356-47714378 GTGGGTCCTCACCAGGATCAGGG - Intergenic
1137386745 16:48049069-48049091 CTGTGTCCTCACTTGGCGGAAGG - Intergenic
1137423419 16:48355359-48355381 CTGTGTCCTCATATGGTGGAAGG - Exonic
1137595156 16:49718732-49718754 CTGCGTCCTCACATGGTGGAAGG + Intronic
1137805490 16:51301089-51301111 CTGCGTCCTCACATGGTGAAAGG + Intergenic
1138215770 16:55204010-55204032 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1138346241 16:56322053-56322075 CTGCGTCCTCACGTGGTGGAAGG + Intronic
1138359133 16:56411820-56411842 CTGTTTCCAGACCTGGTGCAGGG + Intronic
1138422369 16:56907676-56907698 CTGTGTCCTCACTTGGCGGAGGG + Intronic
1138693212 16:58788174-58788196 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1138694348 16:58797860-58797882 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1138730001 16:59184098-59184120 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1138954382 16:61953093-61953115 CTGTGTCCCCACATGGTGGAAGG - Intronic
1138973260 16:62171441-62171463 CTGTGTCCTCACATGGGGCAAGG + Intergenic
1139314526 16:66056928-66056950 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1139336443 16:66235038-66235060 CTGTGTCCTCACATGGTGAAGGG - Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140004982 16:71065746-71065768 CTGGGCACTTACCTGGTGCTGGG - Intronic
1140601153 16:76476669-76476691 CTGTGTCCTCACATGGTGAAAGG + Intronic
1140694027 16:77514076-77514098 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1140721450 16:77775902-77775924 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1141030040 16:80579634-80579656 CTGCGTCCTCACATGATGGAAGG - Intergenic
1141317388 16:82975300-82975322 CTGTGTCCTCACAAGGCGCACGG - Intronic
1141676433 16:85520195-85520217 CTGTATCCTCACATGGTGAAAGG + Intergenic
1141702379 16:85648443-85648465 CTGGGGCCTCACTTGGAGCAGGG + Intronic
1142091242 16:88211832-88211854 CTGGGCCCTGCCCTGATGCAAGG + Intergenic
1143250915 17:5522396-5522418 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1143316893 17:6039719-6039741 CTGTGCCCTCACATGGTGGAAGG + Intronic
1144007098 17:11110636-11110658 CTGTGTCCTCCCATGGTGGAAGG - Intergenic
1144147932 17:12416182-12416204 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1144253573 17:13443552-13443574 CTGCATCCTCACGTGGTGGAAGG - Intergenic
1144702697 17:17349292-17349314 CTGGGGGCTGACTTGGTGCAGGG + Intergenic
1144853133 17:18254131-18254153 CTGGGTGCTCCGCAGGTGCAGGG + Exonic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1145056551 17:19707197-19707219 CTGGGGCCTCATGTGGGGCAGGG - Intronic
1145837525 17:27965856-27965878 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1146296315 17:31653400-31653422 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1146303104 17:31706634-31706656 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1146527429 17:33578945-33578967 CTGCATCCTCACCTGGTCCTAGG + Intronic
1146592268 17:34137787-34137809 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1146625535 17:34432272-34432294 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1146684163 17:34829208-34829230 CTGTGTCCTCACATAGTGGAGGG - Intergenic
1146912288 17:36656614-36656636 CTGGGAACTCCCCTAGTGCAAGG - Intergenic
1147479149 17:40742434-40742456 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
1147965737 17:44193387-44193409 CTGGGTCCCTTCCTGGGGCAGGG + Exonic
1148534116 17:48424175-48424197 CTGTGTCCTCACATAGTGGAAGG + Intronic
1148862608 17:50612512-50612534 CTGGGTCCCGGCCTGGTGGAAGG - Intronic
1148964023 17:51419539-51419561 CAGAGTCCACACCTGCTGCAAGG - Intergenic
1148985821 17:51620266-51620288 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1149359971 17:55884893-55884915 CTATGTCCTCACATGGTGGATGG - Intergenic
1149387032 17:56152699-56152721 CTGATTCCTCACCTAGTGCCTGG - Intronic
1149852758 17:60050206-60050228 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1150266111 17:63833379-63833401 CTGGGTCTTCAGCTGGTTGATGG + Exonic
1150505468 17:65693881-65693903 CTGTGTCCTCCCATGGTGGAAGG - Intronic
1150600669 17:66648144-66648166 CTGTGTCCTCACATGGTGCAAGG + Intronic
1150950251 17:69795466-69795488 CTGTGTCCTTACATGGTGAAAGG - Intergenic
1151512881 17:74572200-74572222 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1151532797 17:74717867-74717889 CTGTGTCCTCACATGGTAGAAGG - Intronic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1152372194 17:79895891-79895913 CTGAGTCCTCACTTGGTGGAAGG - Intergenic
1152400473 17:80063536-80063558 TTGGGTCCCCACCTGCTGCCTGG + Intronic
1152477051 17:80525403-80525425 CTGTGTCCTCACGTGGTGGAGGG - Intergenic
1152546459 17:81002543-81002565 CTGCGTCATCACATGGTGGAAGG + Intronic
1153073764 18:1137906-1137928 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1153100914 18:1468599-1468621 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1153426387 18:4969435-4969457 CTGTGACCTCACATGGTGGAAGG - Intergenic
1153470330 18:5437284-5437306 CTGTGTCCTCATGTGGTGAAAGG - Intronic
1153668987 18:7392387-7392409 CTGTGTCTTCACGTGGTGGAAGG - Intergenic
1153844252 18:9034095-9034117 CTGTGCTCTCACCTGGTGGAAGG - Intergenic
1155026371 18:21944351-21944373 CTGTGTCCTCACATGATGGAAGG - Intergenic
1155233422 18:23796007-23796029 CTGGGTCCTCACATGGTAGAGGG - Intronic
1155254745 18:23985013-23985035 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1155769661 18:29680920-29680942 CTGGGTCCTCACATGGTAGAAGG + Intergenic
1156241339 18:35257493-35257515 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1156354863 18:36332239-36332261 CTGGGGCCACAGCTGCTGCAGGG - Intronic
1156612979 18:38749612-38749634 CTGTATCCTCACATGGTGGAAGG + Intergenic
1156708518 18:39913128-39913150 CTGTGTCCTCACATGATGGAAGG - Intergenic
1156926443 18:42586040-42586062 CTGGTTCCTCCCATGGTACATGG + Intergenic
1157416336 18:47506439-47506461 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1157436885 18:47677890-47677912 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1157510411 18:48267771-48267793 CTGTGTTCTCACGTGGTGTAAGG - Intronic
1157533021 18:48438323-48438345 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1157626966 18:49059191-49059213 CTGTGTCCTTACATGGTGGACGG - Intronic
1157689008 18:49665573-49665595 CTATGTCCTCACATGGTGGAAGG + Intergenic
1157713410 18:49865583-49865605 CTGGGTCCCCTCCTGGCTCAAGG + Intronic
1157786029 18:50483377-50483399 TTGTGTCCTCACATGGTGGAAGG - Intergenic
1157818871 18:50750948-50750970 GTGTGTCCTCACATGGTGGAAGG - Intergenic
1157911404 18:51620376-51620398 GTGTGCCCTCACATGGTGCAGGG - Intergenic
1158390649 18:57042246-57042268 CTGTGGCCTCACATGGTGGAAGG + Intergenic
1158620400 18:59027858-59027880 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1158645840 18:59246311-59246333 CTGCATCCTCACATGGTGGAAGG + Intergenic
1158703171 18:59767304-59767326 CTCTGTCCTCACATGGTGGAAGG - Intergenic
1158708899 18:59819382-59819404 CTGTGTCCTCACATGATGGAAGG + Intergenic
1158860402 18:61586239-61586261 CTGTGTACTCACGTGGTGGAAGG + Intergenic
1159270379 18:66141563-66141585 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1159410218 18:68064504-68064526 CTGTGTCCTCACGTGGCGGAAGG + Intergenic
1159479779 18:68974264-68974286 CTGGGTCCTCACATGGCAGAAGG - Intronic
1159536961 18:69726787-69726809 CTGTGTCCTCACATGGTAGATGG + Intronic
1159554109 18:69927169-69927191 CTGCGTCCTCATATGGTGGAAGG - Intronic
1159612209 18:70538681-70538703 CTGTGTCCTCACATGATGGAAGG - Intergenic
1159904310 18:74076419-74076441 CAGTGTCCTCACCTGGTAAAAGG - Intronic
1160132655 18:76242151-76242173 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1160337633 18:78056945-78056967 CTGAGTCCTCACCTGGCAGAAGG - Intergenic
1160609907 18:80076884-80076906 CTGTGTCCTCACGTGGTGGAAGG + Intronic
1160687879 19:445326-445348 CTGTGTCCTCACGTGGTGGAGGG - Intronic
1161589393 19:5122293-5122315 CAGGGTCCTCACCGGGTAGAAGG - Intronic
1161750115 19:6089606-6089628 CTGTGTCCTCACGTGATGGAAGG - Intronic
1162043272 19:7983224-7983246 CTGGGTTCTCACTTTGTCCAGGG - Intronic
1162923576 19:13918566-13918588 CAGGGTTCTCACCGGGTGGAGGG - Exonic
1163205301 19:15798280-15798302 CTGTTTCCACACCTGGGGCATGG - Intergenic
1163338242 19:16687649-16687671 CTGTGTCCTCGCATGGTGGAAGG + Intronic
1163639012 19:18451101-18451123 CTGGGACCTGACTTGGTGCTCGG - Intronic
1164824409 19:31273838-31273860 CAGGTTCCCCTCCTGGTGCAGGG - Intergenic
1165730061 19:38139532-38139554 ATTGTTCCTCACCTGGTGCCTGG + Intronic
1165751712 19:38264416-38264438 CTGGGCCCGCCCCTGGTGCCGGG - Intronic
1165886693 19:39084091-39084113 CTGGGCTCTCACCTGGTGGCCGG + Intronic
1165894243 19:39131863-39131885 CTGATTCCTCACCTGTTACAGGG + Intronic
1165906227 19:39196506-39196528 CTGGGTCCTCAGCTGGCCCTGGG + Intergenic
1166156041 19:40911808-40911830 CTGCGTTCTCACATGGTGGAAGG + Intergenic
1166281895 19:41799702-41799724 CTGGGCCCTGCGCTGGTGCAGGG - Intronic
1166836902 19:45672912-45672934 CTGGGTTCTCACATTGTGTATGG - Exonic
1166871224 19:45872288-45872310 CCGGGTCCTGGGCTGGTGCACGG + Exonic
1167112457 19:47470316-47470338 CTGGGACCTCACCTGCAGCCAGG + Intronic
1167276958 19:48544836-48544858 CTGGGTCCTTACTGGCTGCATGG - Intergenic
1167619987 19:50555382-50555404 CTCCTCCCTCACCTGGTGCAAGG + Intronic
1167735075 19:51289408-51289430 CTGTGTCCCCACTTGGTGGAAGG + Intergenic
1167735286 19:51290792-51290814 CTGGGTCCTCATGTGGTGAAAGG - Intergenic
1167789885 19:51668351-51668373 CTGTGTCCTCACATGTTGAAGGG + Intergenic
1167800147 19:51735382-51735404 CTGTGTCCTCACATGGTGGTGGG + Intergenic
1168334909 19:55592228-55592250 CAGGGTCCTTAGCTGGGGCAGGG - Exonic
1168476259 19:56677569-56677591 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
924988875 2:294425-294447 CTGAGTCCTCACGTGGTGGAGGG + Intergenic
925016879 2:534697-534719 CTGTGTTCTCACATGGTGGAAGG + Intergenic
925025739 2:605938-605960 CTGGGGGCTCACCTGCAGCATGG - Intergenic
925063110 2:908724-908746 CTGTGTCTTCACCTGGGGAAAGG - Intergenic
925303156 2:2831123-2831145 CTGGGTCATCCCATGGTGGAAGG - Intergenic
925423961 2:3733650-3733672 CTGTGTCCTCACATGATGGACGG + Intronic
925483364 2:4301416-4301438 CTGTGTCCTCACATGGTGGAAGG - Intergenic
925556054 2:5132677-5132699 CTGTGTCCTCACATGGGGGAAGG - Intergenic
925676129 2:6362834-6362856 CTGAGTTCTCACATGGTGGAAGG + Intergenic
925712279 2:6752999-6753021 CTGTGTCTTCACGTGGTGGAAGG - Intergenic
925799352 2:7582941-7582963 CTGCGTCCTCACATGGTGGGAGG + Intergenic
925988066 2:9231833-9231855 CTCAGTCCTCACCTGCTGCAGGG - Intronic
926110348 2:10178879-10178901 CTGTGTCCTCACGTGGTTAAAGG - Intronic
926288503 2:11509734-11509756 CTGCATCCTCACATGGTGGAAGG - Intergenic
926351845 2:12002739-12002761 CTGTGTCCTCACATGGTGGGAGG - Intergenic
926392652 2:12409534-12409556 CTGTGTCCTCACATGGTGAAAGG - Intergenic
926452892 2:13027307-13027329 CTGTGTCCTCACATGGTGGAAGG + Intergenic
926659493 2:15447975-15447997 CTGTGTCCTCACATGGTGAAAGG + Intronic
926908396 2:17827134-17827156 CTGTGTCCTTACATGGTGGAAGG + Intergenic
926933896 2:18067650-18067672 CTGTGTCCTCACATGGTGAAAGG - Intronic
926961867 2:18365819-18365841 CTGCATCCTCACATGGTGGAGGG - Intergenic
927050513 2:19323638-19323660 CTGTGTCCTCACATTGTGGAAGG + Intergenic
927084682 2:19662767-19662789 CTGTGTCCTCACATGATGGAAGG + Intergenic
927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG + Intergenic
927311310 2:21634825-21634847 CTGTGTCCTCACATGGTGGAAGG - Intergenic
927458041 2:23274478-23274500 CTGCATCCTCACATGGTGGAAGG - Intergenic
927592467 2:24368114-24368136 CTGTGTCTTCACTTGGTGGAAGG - Intergenic
928257163 2:29732740-29732762 CTGTGTCCTCACATGGTGGAAGG - Intronic
928694017 2:33830421-33830443 CTGTGTCCTCACATGGTGGAAGG - Intergenic
928874656 2:36023894-36023916 CTATGTCCTCACCTGGTGGACGG - Intergenic
928934214 2:36657774-36657796 CAGGGTCCTCACAATGTGCAGGG + Intergenic
929228114 2:39531623-39531645 CTGTGTCCTCACATGGTGGAAGG + Intergenic
929256705 2:39818921-39818943 CTGTGTTCTCACATGGTGAAAGG + Intergenic
929316082 2:40480409-40480431 CTGTGTCCACACATGATGCAAGG - Intronic
930107175 2:47649474-47649496 CTGTGTCCTCACATGGTGGAGGG - Intergenic
930170638 2:48247723-48247745 CTGTTTCCTCACATGGTGGAAGG - Intergenic
930253667 2:49064466-49064488 CTGAGTCCTCACATGGTGGAAGG - Intronic
930689155 2:54341343-54341365 CTGCATCCTCACATGGTGGAAGG - Intronic
930851748 2:55968477-55968499 CTGTGTCCTCACATGGTGGAGGG - Intergenic
930988991 2:57627922-57627944 CTGAGTCCTCACCGAGTGAAAGG - Intergenic
931872927 2:66481113-66481135 CTGGGTGCCCTCCTGCTGCAGGG - Intronic
931983790 2:67722159-67722181 CTGTGTCTTCTCCAGGTGCATGG - Intergenic
932326890 2:70869156-70869178 CTGAGTCATCACATGGTGGAGGG - Intergenic
932456695 2:71853954-71853976 CTGGGTCCTCACCCGGCCCAGGG - Intergenic
932631984 2:73352674-73352696 CTGTGTCCTCACATGGTCTAAGG - Intergenic
932652304 2:73571462-73571484 CTTTGTCCTCACGTGGTGGAAGG + Intronic
932897381 2:75654215-75654237 CTGTGCCCTCACATGGTGAAAGG + Intronic
933133887 2:78707359-78707381 CTGTGTCCTCACATGGTGGAGGG + Intergenic
933238364 2:79890885-79890907 CTGTGTCATCACATGGTGGAAGG + Intronic
933470546 2:82717376-82717398 CTGTGTTCTCACATGATGCAAGG - Intergenic
933593021 2:84253552-84253574 CTGTGTCCTCACATAGTGGAAGG - Intergenic
933784899 2:85830802-85830824 CTGTGTCCTCTCATGGTGGAAGG - Intergenic
933920447 2:87040313-87040335 CTGGGACCTGGGCTGGTGCAGGG - Intergenic
933931177 2:87153473-87153495 CTGGGACCTGGGCTGGTGCAGGG + Intergenic
933980946 2:87550286-87550308 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
933982398 2:87562410-87562432 CTGTGTCCTCACATGGTGGAGGG + Intergenic
933996143 2:87671478-87671500 CTGTGTCCTCACCTGAAGGAAGG + Intergenic
934002550 2:87729585-87729607 CTGGGACCTGGGCTGGTGCAGGG + Intergenic
934014290 2:87862498-87862520 CTGTGTCCTCACATGCTGGAAGG - Intergenic
934694303 2:96387940-96387962 CTGCGACCTCACATGGTGGAAGG - Intergenic
934946416 2:98545733-98545755 CTGGGTGCTCAGGTGGTGAATGG - Intronic
934972530 2:98774812-98774834 CTGTGTCCTCCCATGGTGGAAGG + Intergenic
934987170 2:98895909-98895931 CTGTGTCCTCTCATGGTGGAAGG - Intronic
934992917 2:98933965-98933987 CAGTGTCCTCACATGGTGGAAGG + Intronic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935262670 2:101368779-101368801 CTGTGCCCTCACTTGGGGCAAGG - Intronic
935463657 2:103368799-103368821 CTGGGTACTCACATGGTAAAAGG + Intergenic
935623197 2:105146392-105146414 ATGTGTCCTCACATGGTACATGG + Intergenic
935645811 2:105333324-105333346 TTGTGTCCTCACATGGTGGATGG - Intergenic
935679681 2:105625099-105625121 CTGGTTCCTCACTAGGTGGATGG + Intergenic
935697232 2:105780776-105780798 CTGTGTCCTCACATGCTGAAGGG - Intronic
935745229 2:106184599-106184621 CTGTATCCTCACATGGTGGAAGG + Intronic
935809654 2:106785194-106785216 CTGTGTCCTCACATTGTGGAAGG + Intergenic
935825826 2:106948265-106948287 CTGAGTCCTCAAATGGTGAAAGG + Intergenic
935851434 2:107224372-107224394 CTGCGTCCTCACATGGTAGAAGG + Intergenic
935920302 2:108005720-108005742 CTGCCTCCTCACATGGTGGAAGG + Intronic
936133320 2:109866532-109866554 CTTTGTCCTCACATGGTGTAAGG - Intergenic
936211377 2:110504953-110504975 CTTTGTCCTCACATGGTGTAAGG + Intergenic
936287918 2:111195433-111195455 CTGCTTCCTCACGTGGTGGAAGG - Intergenic
936297712 2:111279434-111279456 CTGTGTCCTCACCTGAAGGAAGG - Intergenic
936311444 2:111388383-111388405 CTGTGTCCTCACATGGTAGAGGG - Intergenic
936312884 2:111400499-111400521 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
936346026 2:111675875-111675897 CTGTGTGCTCACGTGGTGGAAGG - Intergenic
936361946 2:111811959-111811981 CTGGGACCTGGGCTGGTGCAGGG - Intronic
936405461 2:112198689-112198711 CTGTGTCCTCACATGATGAAAGG - Intergenic
936619457 2:114080414-114080436 CTGTGTCATCACATGGTGGAAGG + Intergenic
936707123 2:115088083-115088105 CTGTGTCCTCACACGGTGGAAGG + Intronic
936930620 2:117784872-117784894 CTGTGTCCTCACATGGTGGGAGG - Intergenic
936948561 2:117953937-117953959 CTGCTTCCTCACATGGTGGAAGG - Intronic
937088620 2:119189621-119189643 CTGTGTCCTCACATGGTGGAGGG - Intergenic
937134351 2:119540115-119540137 CTATGTCCTCACGTGGTGGAAGG - Intergenic
937282785 2:120731751-120731773 CTGAGTCCTCACATGGAGGAAGG - Intergenic
937433884 2:121864154-121864176 CTGTATCCTCACATGGTGGAAGG - Intergenic
937448999 2:121984961-121984983 CTGTGTCCTCATATGGTGGAAGG + Intergenic
937554302 2:123134157-123134179 CTGTGTCTTCACATGGTGAAAGG + Intergenic
937782881 2:125859482-125859504 CTGTGTCCTCACATGGTAGAAGG + Intergenic
937933956 2:127227467-127227489 CTGTGTCCTCACGTGGTGGGAGG + Intergenic
938079365 2:128361395-128361417 CTGGGTCCTGACCTGATGATGGG + Intergenic
938199543 2:129361857-129361879 CAGGAGCCTCAGCTGGTGCATGG + Intergenic
938556852 2:132432270-132432292 CTGTGTCCTCACATGGTGGAAGG + Intronic
938684285 2:133721871-133721893 CTGTGTCCTCACATGGTGAAAGG - Intergenic
938706282 2:133930477-133930499 CTGTGTCCTCATATGGTGGAAGG + Intergenic
939089920 2:137768190-137768212 CTGTGTCCTCACCTGGTGAAAGG + Intergenic
939677464 2:145090240-145090262 CTGTGTCCTCACATGGTTAAAGG - Intergenic
939826094 2:147017222-147017244 CTGTGTCCCCACATGGTGGAAGG + Intergenic
940008358 2:149030397-149030419 CTGTGTCCACACATGGTGGAAGG + Intergenic
940127158 2:150339203-150339225 CTGTGTCCTCACATGATGAAAGG - Intergenic
940182220 2:150947350-150947372 CTGTGTCCTCACATGGCGGAAGG + Intergenic
940363706 2:152822412-152822434 CTGCGTCCTCACATGGTGGAAGG + Intergenic
940725299 2:157329719-157329741 CTGCTGCCTCACCTGGTGCATGG - Intergenic
940771617 2:157844869-157844891 CTGTGTTCTCACATGGTGGAAGG - Intronic
941070168 2:160946526-160946548 TTCTGTCCTCACCTGGTCCAAGG - Intergenic
941349858 2:164418768-164418790 CTGTATCCTCACATGGTGGAAGG + Intergenic
941708446 2:168685719-168685741 CTGGCTCCTATCCTGGTGCCAGG + Intronic
941709439 2:168696681-168696703 CTGTGTCCTCACATGGTGGAAGG + Intronic
941714527 2:168749718-168749740 CTGGAAACTCACCTGATGCAGGG + Intronic
942122366 2:172791009-172791031 TTGTGTCCTCACATGGTGGAAGG + Intronic
942550170 2:177107468-177107490 CTGTGTCATCCCCTGGTGCAAGG - Intergenic
942718243 2:178919082-178919104 CTGTATCCTCACATGGTGGAAGG - Intronic
942814945 2:180042032-180042054 CTGGGTCCTCACATGGAAGAAGG - Intergenic
943195627 2:184744485-184744507 CTGTGTCCTCACATGGTGGAAGG - Intronic
943818899 2:192293158-192293180 CTGTGTCCTCACATGGTAGAAGG + Intergenic
943950585 2:194129154-194129176 CTGGGTCCTCAGCTGTGGCTGGG + Intergenic
944150730 2:196555316-196555338 CTGGGTCCTTATGTGGTGGAAGG + Intronic
944167085 2:196734514-196734536 CTGTGTCCTCACATGGTGGAAGG - Intronic
944217746 2:197272707-197272729 CTGCGTCCTCACATGATGGAAGG - Intronic
944224617 2:197337610-197337632 CTGTGTCCTCACATGGCGGAAGG - Intergenic
944226383 2:197352574-197352596 CTGTGTCCTCACATGATGAATGG - Intergenic
944384336 2:199147884-199147906 CTGTGTCCTCACATGGTAGAAGG - Intergenic
944636478 2:201680392-201680414 CTGGGTCCTCCCATGGTGGAAGG + Intronic
944653087 2:201851450-201851472 CTGTGTCCTTACATGGTGGAAGG + Intronic
944693244 2:202177495-202177517 CTGTGTCCTCACGTGGTGGGAGG + Intronic
944995826 2:205292290-205292312 TTGTGTCCTCACATGGTGGAAGG - Intronic
945645404 2:212485818-212485840 CTGTGTCCTCACATGCTGAAAGG + Intronic
945732877 2:213562698-213562720 CTCTGTCCTCACGTGGTGGAAGG + Intronic
945732898 2:213562857-213562879 CTCTGTCCTCACGTGGTGGAAGG + Intronic
946113258 2:217438504-217438526 CTGTGTCCTCACATGGTGGAAGG - Intronic
946151225 2:217772807-217772829 CTGTGTCCTCACATGGTGAAAGG + Intergenic
946327543 2:218992591-218992613 CTGGGACCTCAGCTGGGGCAGGG + Intronic
946331533 2:219012018-219012040 CTGTGTCCTCACATGGTGGAGGG - Intronic
946439068 2:219679788-219679810 CTGTGTCCTCACATGGTACAAGG + Intergenic
946468931 2:219938544-219938566 CTGTGTCCTCACCTGGCAGAAGG - Intergenic
946615045 2:221500163-221500185 CTGTTTCCTCACCTGGAGAATGG - Intronic
946628484 2:221641050-221641072 CTGTGTCCTCACGTGGTGGGAGG + Intergenic
946844036 2:223843521-223843543 TTGAGTCCTCACGTGGTGGAAGG - Intergenic
946972348 2:225108558-225108580 CTGTGTCCTCACATGGTGGAAGG + Intergenic
947154807 2:227151790-227151812 CTGCATCCTCACATGGTGGAAGG - Intronic
947158407 2:227186929-227186951 TTGTGTCCTCACGTGGTGGAAGG + Intronic
947208877 2:227687450-227687472 CTGGATTCTCACTTGGAGCAGGG + Exonic
947337952 2:229106599-229106621 ATGTGTCCTCACATGGTGGAGGG - Intronic
947361791 2:229352854-229352876 CTGTGTCCTCACATGGTGGAAGG - Intergenic
947814594 2:233027881-233027903 CTGTGTCCTCACATGGTGGAGGG + Intergenic
947968278 2:234300701-234300723 CTGGGTCCTGTCCTTCTGCAAGG - Intergenic
947999108 2:234553146-234553168 CTGTGTCCTCACCTGGCGGAAGG - Intergenic
948027089 2:234786913-234786935 CTGTGTCCTCACGTAGTGGAAGG + Intergenic
948317699 2:237041650-237041672 CGGCGTCCTCACATGGTGGAAGG + Intergenic
948364669 2:237446950-237446972 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
948512470 2:238477948-238477970 CTGTGTCCTCACATGGTGGAAGG - Intergenic
948522903 2:238552243-238552265 CTGTGTCCTCACATGGTGGAAGG - Intergenic
948582950 2:239000326-239000348 CTGTGCCCTCACATGGTGGAAGG + Intergenic
948636601 2:239341964-239341986 CTGTGTCCTCACCTGTTGGAAGG - Intronic
948779329 2:240308286-240308308 ATGGCTCCTCCCCTGGAGCAAGG - Intergenic
948875796 2:240827207-240827229 ATGGGTCCTCCCCTGGTGGAGGG - Intergenic
1168810517 20:701659-701681 CTGGTCCCCCACCTGGAGCAGGG - Intergenic
1169594574 20:7183280-7183302 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1169606274 20:7323128-7323150 CTGTATCCTCACATGGTGGAGGG + Intergenic
1169612482 20:7397582-7397604 CTGGGTACTCACATGGTGGGAGG - Intergenic
1169713381 20:8589556-8589578 TTGTGTCCTCACATGGTGGAAGG + Intronic
1169752341 20:9007118-9007140 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1169936631 20:10890792-10890814 CTGTGTCCTCACATGGCGGAAGG + Intergenic
1169944645 20:10975625-10975647 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1170064176 20:12292631-12292653 CGGTGTCCTCACATGGTGGAAGG - Intergenic
1170382918 20:15781571-15781593 CTGTGTCCCCACATGGTGGAAGG + Intronic
1170498697 20:16952032-16952054 CTGTGTCCTCACGTGGTGGGAGG - Intergenic
1170547912 20:17450709-17450731 CTGGGTCTTCCCATGGTGGAAGG + Intronic
1170796934 20:19556045-19556067 CTGTGTCCTCACATGGTGGAAGG + Intronic
1171031311 20:21679288-21679310 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1171221189 20:23399392-23399414 CTATGTCCTCACGTGGTGGAAGG - Intronic
1171238180 20:23544905-23544927 CTGTGTCCTCACGTGGTAGAAGG - Intergenic
1171277201 20:23867476-23867498 CTGGGTGCTCACATGGTGCTGGG - Intergenic
1171336059 20:24386613-24386635 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1171726253 20:28623884-28623906 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1171751879 20:29059491-29059513 CTGTTTCCTCACATGGTGGAAGG - Intergenic
1171790447 20:29518379-29518401 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1171815507 20:29782895-29782917 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1171857265 20:30358456-30358478 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1171902873 20:30873143-30873165 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1171950862 20:31420530-31420552 CTGTGTCCTCACATGGGGGAAGG + Intergenic
1172784340 20:37456726-37456748 CTGTGTCCTTACATGGTGCAAGG + Intergenic
1172822372 20:37748745-37748767 CTGCGTCCTCACATGGTGGAAGG + Intronic
1173148492 20:40545761-40545783 CTTTGTCCTCACCTGGCTCAGGG - Intergenic
1173180571 20:40803617-40803639 CTGTGTCCTGACATGGTGGAAGG + Intergenic
1173291510 20:41719072-41719094 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1173419377 20:42887317-42887339 TTGTGTCCTCACATGGTGGAAGG - Intronic
1173428131 20:42960349-42960371 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1173435818 20:43031355-43031377 CTGTGTCTTCACTTGGTGGAAGG - Intronic
1173571058 20:44076333-44076355 CTGTGTCCTCACCTGGTAGGTGG - Intergenic
1173574586 20:44103943-44103965 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1174650420 20:52120107-52120129 CTGTGTCCACACATGGTGGAAGG - Intronic
1175552380 20:59825946-59825968 CTGTGTCCTCACATGGTGGAGGG - Intronic
1175630971 20:60536140-60536162 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1175680985 20:60988715-60988737 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1175733236 20:61368385-61368407 CTGTGTCCTCACCTGGCGGATGG - Intronic
1175916680 20:62429211-62429233 TCGGGTCCTCACATGGTGGAAGG - Intergenic
1176078911 20:63261958-63261980 CCGTGGCCTCACATGGTGCAAGG + Intronic
1176160422 20:63644782-63644804 CTGTGTCCTCACATGATGGAAGG - Intronic
1177094072 21:16809393-16809415 CTGTGTCCTCCCATGGTGGAAGG - Intergenic
1177223781 21:18227090-18227112 CTGTGTCCTCACATAGTGGAAGG + Intronic
1177327935 21:19616674-19616696 CTGTGTCCTCACATGGTGGCAGG - Intergenic
1177349778 21:19922340-19922362 CTGTCTCCTCACATGGTGAAAGG + Intergenic
1177392735 21:20497648-20497670 CTGTGTCCTCACATGGTGAAGGG + Intergenic
1177394847 21:20520445-20520467 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1177433392 21:21019893-21019915 CTGGGTGCTGTCGTGGTGCAGGG + Intronic
1177471911 21:21570343-21570365 CTGTGTCCTGACATGGTGAAAGG - Intergenic
1177686457 21:24443360-24443382 CTGTGTCCTCACATGGTGGGAGG - Intergenic
1177897058 21:26866348-26866370 CTGTGTCCTCACCTGTTTGAAGG + Intergenic
1178097013 21:29226793-29226815 CTGTGTCCTCACATGGTGGAAGG + Intronic
1178136886 21:29637598-29637620 CTTTGTCCTCACATGGTGAAAGG - Intronic
1178291206 21:31370023-31370045 CTGTGTCCTCATGTGGTGGAAGG - Intronic
1178305140 21:31484941-31484963 CTGAGTCCTTACATGGTGGAAGG - Intronic
1178352762 21:31884639-31884661 CTGAGTCCTCATATGGTGGAAGG - Intronic
1178374078 21:32051952-32051974 TTGTGTCCTCACATGGTGGAAGG + Intergenic
1178458293 21:32776586-32776608 CTGAGTCCTCACATGGTGGAAGG + Intergenic
1178462337 21:32814378-32814400 CTGAGTCCTTACATGGTGGAAGG + Intergenic
1178608844 21:34062651-34062673 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1178817483 21:35944993-35945015 TTGTGTCCTCACTTGGTGGAAGG - Intronic
1178846538 21:36178479-36178501 CTGTGTCCTCACATGGTGGGAGG - Intronic
1178905733 21:36634524-36634546 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1179021575 21:37645688-37645710 CTGGGTGCTCACCCGTTCCAGGG - Intronic
1179284858 21:39968557-39968579 TTGTGTCCTCACATGGTGGAAGG + Intergenic
1179503279 21:41823085-41823107 CTGTGTCCTCACATGGTAGAAGG - Intronic
1179533933 21:42039318-42039340 CTGTGTCCCCACATGGTGGAGGG + Intergenic
1179842715 21:44087618-44087640 CTGGGCCATCACCTGCTGTAAGG + Intronic
1180318953 22:11303461-11303483 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1180336263 22:11579113-11579135 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1180408589 22:12581249-12581271 CTGTTTCCTCACATGGTGGAAGG - Intergenic
1181004073 22:20001377-20001399 CTGAGTCCTCCCATGGTGGAAGG - Intronic
1181338739 22:22161965-22161987 CTGGGTCCTCTCTGGGTGCTTGG + Intergenic
1181709568 22:24673863-24673885 CTGGATCCTCACATGGTCCCAGG - Intergenic
1182352386 22:29706146-29706168 CTGGGTCCTCACTCTGTGCCAGG - Intergenic
1182483485 22:30625344-30625366 CTGTGTTCTCACATGGTGGAAGG + Intronic
1182663352 22:31940762-31940784 CTGGGTCTTCACCTGGTACAGGG - Intronic
1182831693 22:33309505-33309527 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1182890694 22:33816440-33816462 CTACGTCCTCACATGGTGAAAGG + Intronic
1182915317 22:34024068-34024090 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1182931144 22:34175482-34175504 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1182955136 22:34417422-34417444 CTGAGTCCCCACATGGTGGAAGG + Intergenic
1182970118 22:34565967-34565989 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1183007562 22:34916188-34916210 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
1183064324 22:35352970-35352992 CTGCCTCCCTACCTGGTGCAGGG + Intergenic
1183337988 22:37261648-37261670 CTGTATCCTCACGTGGTGGAGGG - Intergenic
1183346754 22:37312340-37312362 CTGGGGCCTGGCCTGGTGCCAGG - Intronic
1183374902 22:37457465-37457487 CTGGCTTCTCACCTGGCCCAGGG - Intergenic
1183539070 22:38419266-38419288 CTCTGTCTACACCTGGTGCAGGG - Intergenic
1184097547 22:42324843-42324865 CTGGGTCCTCACCTGCAAGATGG - Intronic
1184145036 22:42604989-42605011 CTGAGTCCTGACATGGTGGAAGG - Intronic
1184149955 22:42632021-42632043 CTGGGTGCCCACCCTGTGCAGGG - Intronic
1184286833 22:43476745-43476767 CTGGGACCTCACTGGCTGCAGGG - Intronic
1184287062 22:43477739-43477761 CTGGGACCTCACTGGCTGCAGGG - Intronic
1184649039 22:45911269-45911291 CTGGGTCCTCCCCTGGAGCCAGG + Intergenic
1184677635 22:46052423-46052445 CTGGGGCCTCAGCAGGGGCAGGG + Intronic
1184908806 22:47511711-47511733 CTGCATCCTCACATGGTGAAAGG - Intergenic
1184956368 22:47889461-47889483 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
1185005075 22:48271056-48271078 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185080092 22:48704936-48704958 CTGTGTCCTGAGATGGTGCAGGG + Intronic
949372717 3:3352957-3352979 CTGTGTCCTCACATGGTGGAAGG - Intergenic
949425906 3:3915591-3915613 CTGGGGGCTCAGCTGGTCCAAGG + Intronic
949714723 3:6916596-6916618 ATGTGTCCTCACATGGTGGAAGG + Intronic
949904226 3:8844976-8844998 CTGTGTTCTCACATGGTGAAAGG - Intronic
949931533 3:9082388-9082410 CTGTGTCTTCACATGGTGGAAGG - Intronic
949957077 3:9277967-9277989 CTGTGTCCTCACATGGTGGAAGG - Intronic
950520248 3:13493834-13493856 ATTGGACCTGACCTGGTGCAGGG - Intronic
950675609 3:14552524-14552546 CTGGCTCCTCACCTCCTGCCTGG + Intergenic
950713673 3:14832288-14832310 CTGTGACAACACCTGGTGCAGGG - Intronic
950896633 3:16457950-16457972 CTGTGTCCTCACATGGTGGAAGG - Intronic
950948769 3:16977903-16977925 CTGCATCCTCACATGGTGGAAGG + Intronic
951389075 3:22080835-22080857 CTGTGTCCTCACGTGGAGCAAGG - Intronic
951480231 3:23153106-23153128 CTGTGTCCTCACATGGTAGAAGG + Intergenic
951794709 3:26525420-26525442 CTGTGTCCTCACATAGTGGAAGG + Intergenic
951934652 3:28008532-28008554 CTGAGTCCTCATGTGGTGAAAGG - Intergenic
952434323 3:33257114-33257136 CTGTGTCCTCACATGGTGGAAGG - Intergenic
952436234 3:33275389-33275411 CTGTGTCCTCACCTGGCAGAAGG + Intergenic
952509820 3:34041834-34041856 CTGTGTCCTCACATGGTGGAAGG - Intergenic
952808905 3:37384047-37384069 TTGTGTCCTCACATGGTGGAAGG - Intergenic
953120043 3:40031196-40031218 CTGTGTCCTCACATCGTGGAAGG + Intronic
953367902 3:42362571-42362593 CTGTGTCCTCACATGTTGGAAGG + Intergenic
953747784 3:45588167-45588189 CTGTGTCCTCACATGGTAGAAGG - Intronic
953780212 3:45862340-45862362 CCAGATCCTCACCTCGTGCATGG - Intronic
954643391 3:52115687-52115709 CTGTGTCCTCGCGTGGTGGAAGG - Intronic
955019201 3:55102452-55102474 CTGGTTCCTCACATGGTAGAAGG - Intergenic
955024422 3:55153681-55153703 CTGTGTCCTCACCTAATGGAAGG - Intergenic
955123160 3:56082309-56082331 CTGTGTTCTCACATGGTGGAAGG - Intronic
955165126 3:56503475-56503497 CTGTGTCTTCACATGGTGGAAGG + Intergenic
955515649 3:59724026-59724048 CTGTGTCCTCACATGGTGGAAGG + Intergenic
955525944 3:59819919-59819941 CTGTGTCCTCACATGGTGGAAGG - Intronic
955541440 3:59980692-59980714 CTGTGTCCTCACATGGTGGAAGG - Intronic
955613869 3:60784860-60784882 CTGTGTCCTCACATGGTGAAGGG - Intronic
955882776 3:63565454-63565476 CTGCGTCCTCACGTGGTAGAAGG + Intronic
956040948 3:65144199-65144221 TTGTGTCCTCACCTGTTGGAAGG - Intergenic
956041561 3:65150397-65150419 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
956280137 3:67547181-67547203 CTGTGTCCTCACGTGGTAGAAGG - Intronic
956564970 3:70625994-70626016 CTGTGTCCTCACATGGTAGAAGG - Intergenic
956774540 3:72554039-72554061 CTATGTCCTCACATGGCGCAAGG + Intergenic
956946077 3:74225296-74225318 CTATGTCCTCACATGGTGGAAGG + Intergenic
956992695 3:74786478-74786500 CTGTGTCCTCACATGATGAAAGG + Intergenic
957217817 3:77344500-77344522 CTGTGTCCTCACCTGGTAGAAGG - Intronic
957439546 3:80225933-80225955 CTGTGTCCTCCCATGGTGGAAGG - Intergenic
957791057 3:84941851-84941873 CTGTGTCCTCACATGGTGGAAGG + Intergenic
957863130 3:85985249-85985271 ATGTGTCCTCACATTGTGCAAGG + Intronic
958189395 3:90165586-90165608 CTGTGTCCTCACATGGTAGAAGG + Intergenic
958411703 3:93825195-93825217 CTGTGTCCTCACATGGTGGAAGG + Intergenic
958501847 3:94921002-94921024 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
958748259 3:98163857-98163879 CTGTGTTCTCACGTGGTGAAAGG + Intergenic
958752046 3:98203198-98203220 CTGTGTTCTCACGTGGTGAAAGG + Intergenic
958797447 3:98720756-98720778 CTTTGTCCTCCCCTGGTGCAAGG - Intergenic
958821030 3:98973983-98974005 CTGTGTCCTCACATGATGAAAGG + Intergenic
958836023 3:99146024-99146046 CTGTGTCCTCACATGGTGGAAGG - Intergenic
959003227 3:100989147-100989169 CTGCATCCTCACATGGTGGAAGG - Intronic
959210849 3:103378339-103378361 CTGGGTCCTCACATGGTGTAAGG + Intergenic
959411983 3:106035882-106035904 CTGTGTCCTCACGTGGTAGAAGG + Intergenic
959594230 3:108111632-108111654 CAGTGTCCTCACGTGGTGGAAGG + Intergenic
959770190 3:110085671-110085693 CTGTGTCCTCACATGGTGGAAGG - Intergenic
959877046 3:111395378-111395400 CTGTGTCTTCACATGGTGGAAGG - Intronic
959910599 3:111759311-111759333 CTGTGTCCTCACATGGTGGAAGG + Intronic
960038643 3:113127133-113127155 CTGTGTCAGCACCTGGGGCATGG - Intergenic
960121594 3:113952805-113952827 CTGTGTCCTCACATGGTGGAAGG + Intronic
960217731 3:115063407-115063429 CTGCGTCCTCACATGATGGAGGG + Intronic
960461588 3:117942525-117942547 CTGTATCCTCACATGGTGGATGG - Intergenic
960629053 3:119710377-119710399 CTGTGTCCTCACGTGGAGGAAGG + Intronic
961074861 3:123973004-123973026 ATGTGTCCTCACTTGGTGGAGGG + Intronic
961251802 3:125513217-125513239 CTGTGTCCTCACATGGTGGAAGG - Intronic
961269884 3:125680711-125680733 CTGGGTATTTACCTGGGGCATGG - Intergenic
961308817 3:125979477-125979499 ATGTGTCCTCACTTGGTGGAGGG - Intronic
961360321 3:126363183-126363205 CTGTGTCCTCACATGGTGGGAGG - Intergenic
961703509 3:128765632-128765654 ATGTGTCCTCACATGGTGGAAGG + Intronic
961990000 3:131179124-131179146 CTGTGTCCTCACATGGTGGAAGG - Intronic
962301237 3:134244925-134244947 CTGTGTTCTCACATGGTGGAAGG - Intronic
962629226 3:137258988-137259010 CTGGGTCCTCACGTGGCAAAAGG - Intergenic
962814902 3:138988832-138988854 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
962948290 3:140194276-140194298 CTGTGTCCTTACATGGTGGAAGG + Intronic
963059707 3:141215339-141215361 CTGCGTCCTCACATGGTGGAAGG + Intergenic
963071660 3:141309894-141309916 CTGTGTCCTCACATGGTGGAAGG - Intergenic
963173726 3:142277386-142277408 CTGCATCCTCACGTGGTGAAAGG - Intergenic
963262639 3:143208206-143208228 CTGTGTCCTCACATGGTGGAAGG + Intergenic
963271791 3:143292179-143292201 CTGGGTGCTGACATGGTGCTTGG + Intronic
963390779 3:144661094-144661116 CTGTGTCTTCACATGGTGGAAGG + Intergenic
963412107 3:144941908-144941930 CTGTGTCCTCACATGGTGGCTGG + Intergenic
963462791 3:145638175-145638197 CTGTGTCTTCACATGGTGGAAGG - Intergenic
963564106 3:146906155-146906177 CTGTTTCCTCACCTGGTGGAAGG + Intergenic
963645467 3:147908357-147908379 AAGGGTCCTCACATGGTGGAAGG - Intergenic
963645471 3:147908376-147908398 CTGTGTTCTCACATGGTGGAAGG - Intergenic
963678521 3:148345419-148345441 TTGTGTCCTCACATGGGGCAAGG - Intergenic
963681599 3:148384767-148384789 TTGTGTCCTCATCTGGTGGAAGG - Intergenic
963765275 3:149328278-149328300 ATGTGTCCTCGCATGGTGCAAGG + Intronic
963896783 3:150694968-150694990 CTGTGTCCTCACATGGTAGAAGG + Intronic
963908427 3:150793774-150793796 CTGTGTCCTCACATGGTAGAAGG - Intergenic
963989363 3:151635413-151635435 CTGTGTCCTCACATGGTGGAAGG + Intergenic
964497059 3:157302516-157302538 CTGTGTCCTCACGTGGTTGAAGG - Intronic
964679349 3:159320299-159320321 CTGTGTCCTCACATGGTGAAAGG - Intronic
964736243 3:159921604-159921626 CTGTGTCCACACATGGTGGAGGG + Intergenic
964885140 3:161473363-161473385 CTGTGTACTCACATGGTGGAAGG + Intergenic
964964313 3:162472124-162472146 CTGTGTCATCACATGGTGGAAGG + Intergenic
965443457 3:168745607-168745629 CTGTGTCCTCACATGGTGGAAGG + Intergenic
965746247 3:171929113-171929135 CTGTGTCCTCATGTGGTGGAAGG - Intronic
965759869 3:172064189-172064211 CTGTGTCCTCACATGGTGGAGGG - Intronic
965968294 3:174523004-174523026 CTGTGTCCTCACATGGTGGAAGG - Intronic
965988894 3:174791402-174791424 CTGTGTCCTCACGTGGTGGAAGG - Intronic
966003834 3:174983598-174983620 CTGTGTCCTCACATGGTGGAAGG + Intronic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966226698 3:177605515-177605537 CTGTGTCCTCACATGGTAGAAGG - Intergenic
966433354 3:179855767-179855789 CTGGGTCCTCACATGGCAGAAGG - Intronic
966558092 3:181286215-181286237 GTGTGTCCTCACATGGTGAAAGG - Intergenic
966702959 3:182876664-182876686 CTGTGTCCACACATGGTGGAAGG + Intronic
966716652 3:183019467-183019489 CTGTGTCCTCACGTGGTGGAAGG - Intronic
967013111 3:185457479-185457501 CTGTGTCCTCACGAGGTGGAAGG + Intronic
967123462 3:186404531-186404553 CTATGTCCTCACATGGTGAAAGG - Intergenic
967726099 3:192863790-192863812 CTGTGTCCTCACCTGATGGAAGG - Intronic
968046539 3:195626866-195626888 CTGCGTCCTCACATGGGGGATGG - Intergenic
968308114 3:197663175-197663197 CTGCGTCCTCACATGGGGGATGG + Intergenic
968479572 4:827217-827239 CTGGGGACTCCCCTGGCGCAGGG + Intergenic
968604891 4:1530488-1530510 CTGGCTCATCCCCTGGTGCTGGG + Intergenic
969085972 4:4656666-4656688 CTGTGTCCTCACATGGTGGGAGG - Intergenic
969104792 4:4797526-4797548 CTGGGTCATCCCATGGTGGATGG + Intergenic
969189306 4:5504102-5504124 CTGCGTCCTCACATGGTAGAAGG - Intergenic
969299007 4:6286359-6286381 CTGTGTCCTCACAGGGTGGAAGG - Intronic
970209878 4:13698080-13698102 CTGTGTCCTCACATGGTAAAAGG + Intergenic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
970694992 4:18666719-18666741 CTGTGTCCTCACATGGTGAAGGG + Intergenic
970800091 4:19963067-19963089 CTGCATCCTCACATGGTGGAGGG + Intergenic
970860522 4:20697796-20697818 CTGTGTCCTCACATAGTGGAAGG + Intronic
970871282 4:20819775-20819797 CTGTGTCCTCACATGGTAGAAGG - Intronic
970896589 4:21110750-21110772 TTGTGTCCTCACATGGTGGAAGG - Intronic
970948731 4:21727332-21727354 CTGTGTCCTCACATGGTGGGAGG - Intronic
970979766 4:22082653-22082675 CTGGCTCTTGACCTGCTGCATGG - Intergenic
971246688 4:24935589-24935611 CTCGGTCCTCACGTGATGGAAGG - Intronic
971324641 4:25633985-25634007 CTGTATCCTCACATGGTGGAAGG + Intergenic
971353885 4:25877050-25877072 CTGTGTCCTCACATGGTGGAAGG - Intronic
971390446 4:26180539-26180561 CTGTGTCCTCACAAGGTGAAAGG + Intronic
971592352 4:28484280-28484302 CTGTGTCCTCACATGTTGGAAGG - Intergenic
971714307 4:30155537-30155559 CTGTGTCCTCACTTGGTAGAAGG + Intergenic
971905966 4:32726390-32726412 CTGTGTCCTCACACGGTGGAAGG + Intergenic
971971815 4:33630825-33630847 CTGTGTCCTCATCTGGAGCCTGG + Intergenic
972268393 4:37484749-37484771 TTGTGTCCTCACATGGTGGAAGG - Intronic
972297133 4:37750634-37750656 CTGTGTCCTCACATGGTGGAAGG - Intergenic
972414102 4:38821725-38821747 CTGTATCCTCACCTGGGGGAGGG - Intronic
972425310 4:38927390-38927412 CTGTGTCCTTACATGGTGGAAGG + Intronic
972775819 4:42239531-42239553 CTGTGTCCTCACATGGGGAAAGG - Intergenic
972842374 4:42946654-42946676 CTGTATCCTCACATGGTGAAAGG + Intronic
972990449 4:44817199-44817221 CTGTGTCCTCACATGGTGGAAGG + Intergenic
973537146 4:51894994-51895016 CTGGGTCCTCCCATGTTGGAAGG + Intronic
973576400 4:52294165-52294187 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
973602819 4:52558758-52558780 CTGTGTTCTCACGTGGTGGAAGG + Intergenic
973766121 4:54164639-54164661 CTGTGTCCTCACACGGTGGAAGG + Intronic
973770934 4:54205813-54205835 CTGCGTCCTCACATGGTGGAAGG + Intronic
973995364 4:56453217-56453239 GTGGTCCCTCAACTGGTGCAGGG - Intronic
974365763 4:60946934-60946956 CTGTGTTCTCACATGGTGAAAGG + Intergenic
974439673 4:61899816-61899838 CTGAATCCTCACATGGTGGAAGG + Intronic
974441868 4:61929238-61929260 CTGCATCCTCACATGGTACAAGG - Intronic
974488948 4:62539265-62539287 CTGTGTCCTCACATAGTGAAAGG + Intergenic
974610598 4:64210401-64210423 CTGTGTGCTCACATGGTGGAAGG - Intergenic
974828382 4:67158435-67158457 CTAGCTCATCACCTGGTACATGG + Intergenic
974904982 4:68044493-68044515 CTGTATCCTCACATGGTGGATGG - Intergenic
975409026 4:74026181-74026203 CTGAGTTCTCACATGGTGGATGG - Intergenic
975557401 4:75677990-75678012 CTGTGTTCTCACATGGTGAAAGG - Intronic
975805086 4:78103698-78103720 CTGTGTCCTCACATGGTGAAAGG - Intronic
975923786 4:79424447-79424469 CTGCGTCCTCACATGGTAGAAGG + Intergenic
976118461 4:81754058-81754080 CTATGTCCTCACTTGGTGGAAGG + Intronic
976258439 4:83123174-83123196 CTGTGTCCTCACATGGTGAAGGG + Intronic
976285013 4:83362886-83362908 CTATGTCCTCACATGGTGGAAGG - Intergenic
976305196 4:83552916-83552938 CTGTGTCCTCACATGATGGAAGG - Intronic
976745006 4:88393839-88393861 CTGTGTCCTCACATAGTGAAGGG + Intronic
976755815 4:88496963-88496985 CTGTGTCCTCTCATGGTGGAAGG - Intronic
976764498 4:88585099-88585121 CTGTGTCCTCACATGGTGGAAGG + Intronic
976839795 4:89418779-89418801 CTATGTCCTCACATGGTGGAAGG + Intergenic
977127361 4:93186999-93187021 CTGTGTCCTCACATGGTGCAAGG + Intronic
977191069 4:94001331-94001353 CTGTGTCCTCACATGGTAGAAGG + Intergenic
977381357 4:96278367-96278389 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
977570033 4:98619855-98619877 CTGCGTCCTCACGTGTTGGAAGG + Intronic
977823326 4:101501823-101501845 TTGTGTCCTCACATGGTGGAGGG + Intronic
977954659 4:103012815-103012837 TTGTGTCCTCACATGGTGGAAGG + Intronic
978156008 4:105489864-105489886 CTGTGTCCTCACATGGTAAAAGG - Intergenic
978171447 4:105675805-105675827 TTGGGCCCTCACATGGTGGAAGG + Intronic
978285025 4:107066883-107066905 CTGTGTCCTCACATGGTGGAAGG - Intronic
978696567 4:111587184-111587206 CTGTGTCCTCACATGGTGGAAGG + Intergenic
978768914 4:112433312-112433334 CTGTGTCCTCACATAGTGGAAGG + Intronic
979021224 4:115501050-115501072 CTGTATCCTCACATGGTGGAAGG - Intergenic
979646027 4:123070538-123070560 CTGTGTCCTCACGTAGTGAAAGG + Intronic
979665777 4:123309358-123309380 CTGTGTCCTCACATGGTGGAAGG + Intronic
979714600 4:123822581-123822603 CTGTGCCCTCACATGGTGGACGG + Intergenic
979719622 4:123883428-123883450 CTGGGTTCTTACATGGTGGAAGG - Intergenic
979727090 4:123975052-123975074 CTGTGTCCTCACATGGTGGAAGG - Intergenic
979749755 4:124264358-124264380 CTATGTCCTCACGTGGTGAAAGG - Intergenic
979862850 4:125715912-125715934 CTGTGTCTTCACATGGTGAAGGG - Intergenic
980379929 4:132000490-132000512 CTGTGTCCTCACATGGTGAAAGG - Intergenic
980429211 4:132668305-132668327 CTGTATCCTCACATGGTGGAAGG + Intergenic
980452420 4:132991815-132991837 CTGTATCCTCACATGGTGGAAGG - Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
980727066 4:136776542-136776564 CTGTGTCCTCACATGGTGGAAGG - Intergenic
980976571 4:139616785-139616807 CTGCATCCTCACATGGTGGAAGG + Intergenic
981038740 4:140199914-140199936 CTGTGTTCTCACATGGTGGAAGG + Intergenic
981264284 4:142762949-142762971 CTGTGTCCTCACATGATGGAAGG - Intronic
981353872 4:143764813-143764835 CTGTGTCCTCACATTGTGAAAGG - Intergenic
981552970 4:145960411-145960433 CTGTGTCCTCACAAGGTGAAAGG + Intergenic
981628111 4:146784592-146784614 CTGTGTCCTCACATGGTCAAAGG - Intronic
981686538 4:147460729-147460751 CTGGGTCCTCACATGGCGGAAGG - Intergenic
981719845 4:147790189-147790211 CTGTGTCCTCACTTGGGACACGG + Intronic
981863637 4:149387204-149387226 CTGAGTCCTCACATGATGGAAGG + Intergenic
981890560 4:149731300-149731322 CTGTGTCTTCACATGGTGGAAGG - Intergenic
981917585 4:150051683-150051705 CTGGGTCCTCACATGGTGGAAGG - Intergenic
982115333 4:152094235-152094257 CTGTGTCCTCACATGGTGGACGG - Intergenic
982177292 4:152718166-152718188 CTGCATCCTCACTTGGTGGAAGG + Intronic
982203753 4:152981797-152981819 CTGTGTCCTCACATGGTGGAAGG - Intergenic
982219372 4:153111689-153111711 CTGTGTCCTCACCTGGTAGAAGG - Intergenic
982329409 4:154164503-154164525 CTGTGTCCTCACATGGTGAAAGG - Intergenic
982709979 4:158748242-158748264 CTGTGTTCTCACATGGTGGAAGG - Intergenic
982727995 4:158925932-158925954 CTGTGTCCTCACAGGGTGGAAGG + Intronic
982743202 4:159079337-159079359 CTGTGTCCTCACATGGTGGAAGG - Intergenic
983465622 4:168084910-168084932 GTGTGTCCTCACATGGTGGAAGG + Intergenic
983477064 4:168226425-168226447 CTGTGTTCTCACATGGTGGAAGG - Intronic
983491651 4:168397071-168397093 CTGTGTCCTTACTTGGTGGAAGG - Intronic
983748682 4:171235195-171235217 CTGTGTCCTCACATAGTGGAGGG + Intergenic
984215338 4:176905786-176905808 CTGTGCCCTCACTTGGTGGAAGG - Intergenic
984260288 4:177436603-177436625 CTGTGTCGTCACGTGGTGGAAGG - Intronic
984289728 4:177780663-177780685 CTGTGTCTTCACATGGTGAAGGG + Intronic
984489026 4:180408838-180408860 CTGTGTTCTCACATGGTGGATGG - Intergenic
984523752 4:180831649-180831671 CTGAGTCCTCACTTGGTGGAGGG + Intergenic
984523760 4:180831680-180831702 CTGTGTCCTCACATGGGGGAAGG + Intergenic
984578925 4:181487499-181487521 CTGTGTTCTCACATGGTGGAAGG + Intergenic
984808473 4:183772923-183772945 CTCTGTCCTCACATGGTGGAAGG + Intergenic
985175574 4:187196179-187196201 ATGGGACCTCTCCTGTTGCATGG + Intergenic
985434274 4:189913817-189913839 CTGTGTCCTCACATGGTGGAAGG - Intergenic
985729397 5:1538921-1538943 CTGTGTCCTCATGTGGTGAAAGG + Intergenic
985745096 5:1642396-1642418 CTGCGTCCTCACATGGCGGACGG + Intergenic
985757401 5:1727114-1727136 CTGGGGCCTCACGTGGCGCAGGG + Intergenic
985773557 5:1827877-1827899 CTGTGTCCTCACTTTGTGGAAGG - Intergenic
986028948 5:3877452-3877474 CTGTCTTCTCACCTGGAGCAAGG - Intergenic
986064365 5:4221260-4221282 GTGGGGCCACAGCTGGTGCACGG - Intergenic
986670664 5:10140166-10140188 CTGTGTCCTCACATGGTGGAAGG - Intergenic
986867984 5:12012581-12012603 CTGTGCCCTCACATGGTGGAAGG - Intergenic
986945692 5:13016492-13016514 CTGTATCCTCACATGGTGGAAGG + Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987225269 5:15833283-15833305 CTGTGTCCTCACATGGTGGAAGG + Intronic
987302026 5:16605779-16605801 CTGTGTCCTCACATGGTGGAAGG + Intronic
987436994 5:17906587-17906609 CTGTGTCTTCACATGGTGGAAGG - Intergenic
987760776 5:22160710-22160732 CTGTGTTCTCACATGGTGAAAGG + Intronic
988032537 5:25782392-25782414 TTGTGTCCTCACATGGTGGAAGG - Intergenic
988106748 5:26760362-26760384 CTGTGTCCTCACGTGGTGAAAGG - Intergenic
988151074 5:27381299-27381321 CTGCTTCCTCACATGGTGGAAGG - Intergenic
988173540 5:27690892-27690914 CTGTGTCCTCACAGGGTGAAAGG + Intergenic
989289408 5:39745937-39745959 CTGTGTCCTCACATGGTGGAAGG + Intergenic
989382394 5:40822269-40822291 CTGTGTCCTCATATGGTGGAAGG + Intergenic
989405115 5:41051681-41051703 CTGTGTCCTTACCTAGTGGAAGG - Intronic
989503952 5:42203506-42203528 CTGTGTCCTCACATGGTAGAAGG - Intergenic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
989980481 5:50637736-50637758 CTGTGTCCTCACATGGTGGAAGG - Intergenic
990120235 5:52442359-52442381 CTGTTTCCTCACATGGTGGAAGG - Intergenic
990428014 5:55707915-55707937 CTGTGTCCTCACATGGGGGAAGG - Intronic
990658170 5:57981433-57981455 CTGCGTCCTCACACGGTTCAAGG + Intergenic
990697283 5:58434316-58434338 CTGTGTCCTCACATGGTAGAAGG - Intergenic
990703500 5:58500734-58500756 TTGTGTCCTCACATGGTGCTGGG - Intergenic
990755697 5:59066831-59066853 CTTTGTCCTCACATGGTGGAAGG - Intronic
990845220 5:60130044-60130066 CTGTGTCCTCACATGGTGGAAGG - Intronic
991031417 5:62085912-62085934 CTGTGTCCTCACGTGGTAGAAGG - Intergenic
991300086 5:65121539-65121561 CTGGGTCCTCACTTGGCAGAAGG + Intergenic
991335666 5:65544189-65544211 CTGTGTCCTCACATAGTGGAAGG + Intronic
991402797 5:66272108-66272130 CTGTGTCCTCACATGGTGGGTGG + Intergenic
991403538 5:66278792-66278814 CTGGGTCTTCACCTGGTGGAAGG + Intergenic
991445136 5:66691656-66691678 CTGTGTCTTCACTTGGTGGAAGG + Intronic
991445250 5:66692770-66692792 CTATGTCCTCACTTGGTGGAAGG + Intronic
991558255 5:67920849-67920871 CTGTGTCCTCACATGGTGGAAGG - Intergenic
991582810 5:68174459-68174481 CCGTGTCCTCACATGGTGGAAGG + Intergenic
991895553 5:71394163-71394185 CTGTGTTCTCACATGGTGAAAGG + Intergenic
991929051 5:71733624-71733646 CTGTGTCCTCATATGGTGGAAGG + Intergenic
992113725 5:73519827-73519849 CTGAGACCCCATCTGGTGCAAGG + Intergenic
992388037 5:76304701-76304723 CTGTGTCCTCACATGGTGGAAGG + Intronic
992673673 5:79084211-79084233 CTGTGTCCTCACATGGTAGATGG + Intronic
992747333 5:79832688-79832710 CTGAGTACTCACATGGTGGAGGG + Intergenic
992862987 5:80930754-80930776 CTGTGTCCTCATCTGGTGGAAGG + Intergenic
992943481 5:81786401-81786423 CTGTGTCCTCACATGGTGGAAGG + Intergenic
993281706 5:85933455-85933477 CTGTGTCCTCACATGGTGGAAGG - Intergenic
993488421 5:88515463-88515485 CTGTGTCCTCACATGGTATAAGG + Intergenic
993495863 5:88608190-88608212 TTGTGTCCTCACATGGTGGAAGG - Intergenic
993545777 5:89211354-89211376 CTGTGTCCTCACATGGTTGAAGG - Intergenic
993575378 5:89592924-89592946 CTGTGTCCGCACATGGTGGAAGG + Intergenic
993699094 5:91097231-91097253 GTGTGTCCTCACATGGTGGAAGG + Intronic
994047713 5:95328358-95328380 CTGTGTCCTCACATGGTGGAAGG - Intergenic
994163271 5:96580940-96580962 TTGTGTCCTCACATGGAGCAAGG - Intronic
994252917 5:97557811-97557833 CTGTGTCCTCACATGGTAGAAGG - Intergenic
994663197 5:102677354-102677376 CTGTGTCCTCACATGGTGAAAGG - Intergenic
994810229 5:104507871-104507893 CTGTGTCCTCACATGGTAGAAGG - Intergenic
995058585 5:107789321-107789343 CTGCATCCTCACATGGTGGAAGG - Intergenic
995072648 5:107942215-107942237 ATGGTTCCTCAGCTCGTGCAAGG + Intronic
995336248 5:111002875-111002897 CTGTGTCCTCACATGGTGGGAGG - Intergenic
995926853 5:117385371-117385393 CTGTGTCCTCACATGATGTAAGG - Intergenic
995999404 5:118340876-118340898 CTATGTCCTCACATGGTGAAAGG - Intergenic
996042932 5:118836741-118836763 CTGTGTCTTCACCTAGTGGAAGG - Intergenic
996049321 5:118914312-118914334 CTTTGTCCTCAACTGGTGAAAGG - Intronic
996178303 5:120387367-120387389 CTGTGTCCTCACATGGTGGAAGG + Intergenic
996214022 5:120845879-120845901 CTGTGTCCTCACATGGTGGAAGG - Intergenic
996306709 5:122055202-122055224 CTGAGTCCTCACATGGTGGAAGG + Intronic
996331271 5:122331680-122331702 CTGTGTCCTCACATGGTGGAAGG + Intronic
996352455 5:122560615-122560637 CTGGAGCCCCACATGGTGCAGGG - Intergenic
996480515 5:123970469-123970491 CTGTGTTCTCACATGGTGAAAGG + Intergenic
996516288 5:124373109-124373131 TTGTGTCCTCACATGGTGGAAGG + Intergenic
996589409 5:125129285-125129307 CTGTGTTCTCACATGGTGGAAGG + Intergenic
996742474 5:126813686-126813708 CTGTGTCCTCACATGGTTAAAGG + Intronic
996793432 5:127318132-127318154 TTGTGTTCTCACATGGTGCAAGG - Intronic
996832920 5:127759430-127759452 CTCTGTCCTCACATGGTGGAAGG - Intergenic
996915031 5:128702225-128702247 CTGTGTCATCACATGGTGGAAGG - Intronic
996920980 5:128767490-128767512 CTGTGTCCTCACATAGTGGAAGG - Intronic
996993709 5:129668494-129668516 CTATGTCCTCACATGGTGGAAGG + Intronic
997345927 5:133192015-133192037 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
997709566 5:135992458-135992480 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
997791086 5:136763058-136763080 CTGTGATCTCACCTGGTGGATGG + Intergenic
997849258 5:137316160-137316182 CTGTGTGCTCACATGGTGGAAGG + Intronic
998161726 5:139816786-139816808 CTGTGCCCTCTCCTGTTGCATGG + Intronic
998784873 5:145698594-145698616 CTGTGTCCTCACCTGGTAGAAGG + Intronic
999059688 5:148620091-148620113 CTGGATGTTCACCTGGGGCAAGG + Intronic
999100909 5:149025188-149025210 CTGACTCCTCACATGCTGCATGG + Intronic
999297229 5:150467305-150467327 CTGCATCCTCACATGGTGGAAGG - Intergenic
999481185 5:151949549-151949571 CTGTGTCCCCACGTGGTGGAAGG - Intergenic
999734229 5:154500616-154500638 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
999743540 5:154574757-154574779 CTGCGTCCTCTCATGGTGGAAGG - Intergenic
999816141 5:155178250-155178272 CTGTGTCTTCACATGGTGAAAGG - Intergenic
1000134252 5:158330168-158330190 CTGGGTCCTTACCTGGTAGAAGG - Intergenic
1000239294 5:159394527-159394549 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1000259042 5:159568392-159568414 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1000284083 5:159811528-159811550 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1000284534 5:159815719-159815741 CTGTGTCATCACTTGGTGGAAGG - Intergenic
1000375245 5:160574734-160574756 CTGTGTCCTCACATGGTGAAAGG - Intronic
1001446854 5:171792004-171792026 CTGTGTCCTCACATGGTGGAAGG - Intronic
1001511431 5:172325583-172325605 CTGGGTCCTCACGTGGTGAAAGG + Intronic
1001566591 5:172703485-172703507 CTGAGTCCACACGTGGTGCAAGG + Intergenic
1001744247 5:174078748-174078770 CTGTGTCCTCACATGGTGGAAGG - Intronic
1001882663 5:175258114-175258136 GTGGGTGCTCACCAGGTGAAAGG - Intergenic
1003193033 6:3890843-3890865 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1003201459 6:3965088-3965110 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1003247921 6:4399968-4399990 CAGGGCACTCACCTGGTGCCTGG - Intergenic
1003253743 6:4456591-4456613 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1003294334 6:4810750-4810772 CAGTGTCCTCACATGGTGGAAGG + Intronic
1003486745 6:6586734-6586756 CTGTGCCCTCACATGGTGGAAGG - Intergenic
1003652841 6:7977198-7977220 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1003675520 6:8201065-8201087 CTGTGTCCTCCCCTGGCGGAAGG - Intergenic
1003833461 6:10040817-10040839 CTGTGTCCTCACTTGGTGCAAGG + Intronic
1003877037 6:10447073-10447095 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1003946216 6:11078269-11078291 CTATGTCCTCACATGGTGGAAGG - Intergenic
1004190652 6:13460891-13460913 CTGTGTCCTCACATGGTGGAAGG - Intronic
1004233295 6:13851803-13851825 CTGTGTCCTCACTTGGTGGAAGG - Intergenic
1004249890 6:14015198-14015220 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1004352846 6:14905389-14905411 CTGTGTCCTCACCTGGTGGAAGG - Intergenic
1004522676 6:16377090-16377112 GTGTGTCCTCACATGGTGGAAGG - Intronic
1004759825 6:18654338-18654360 CTAGGTCCTCACATGGTGAAAGG - Intergenic
1005017771 6:21390410-21390432 CCGTGTCCTCACTTGGTGGAAGG - Intergenic
1005169708 6:22968867-22968889 CTGTGTCCTCACCTGGTGGAAGG + Intergenic
1005269863 6:24152273-24152295 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1005809344 6:29504317-29504339 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
1005827095 6:29639433-29639455 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1005844839 6:29769266-29769288 CTGGGTCCTCTTGTGGAGCATGG - Intergenic
1006102345 6:31693347-31693369 CTGGGGCCTCACCGGCTGCTGGG + Exonic
1006330478 6:33386757-33386779 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1006436658 6:34029270-34029292 CTGGGTCCTGCCCTGGTACATGG + Intronic
1006630572 6:35427299-35427321 CTGGGTTCTCACCTGCCTCAGGG - Exonic
1006810207 6:36815489-36815511 CTGTGTCCTCACATGGTGGGAGG - Intronic
1007470345 6:42086011-42086033 CTGTGTCCTCACATGGTGGAAGG - Intronic
1007814857 6:44514488-44514510 CTGTGTCCTTACGTGGTGGAAGG - Intergenic
1007814862 6:44514519-44514541 CTGCATCCTCACGTGGTGGAAGG - Intergenic
1007828114 6:44616975-44616997 CTGCATCCTCACATGGTGGAGGG - Intergenic
1008142055 6:47843407-47843429 CTGTGTCCTCACATGGTGCAAGG + Intergenic
1008438096 6:51499573-51499595 CTGTGTTCTCACTTGGTGGAAGG + Intergenic
1008560454 6:52719823-52719845 CTGAGTCCTCACATGGTAGAAGG - Intergenic
1008668232 6:53738752-53738774 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1008840441 6:55896609-55896631 CTGCGTCCTCACATGGTGAAAGG + Intergenic
1008925292 6:56885684-56885706 CTGCATCCTCACCTGGTGGAAGG - Intronic
1009040612 6:58171830-58171852 CTGTGTTCTCACATGGTGAAAGG - Intergenic
1009304803 6:62075282-62075304 CTGTGTCCTCACATGGTGGAGGG - Intronic
1009516482 6:64625494-64625516 CTGTGTCCTCACATTGTGGAAGG + Intronic
1009747580 6:67838508-67838530 CTGTGTCCTCACATGGTAGAGGG + Intergenic
1009763131 6:68034818-68034840 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1009902316 6:69822338-69822360 CTGTGTCCTCTCATGGTGGAAGG - Intergenic
1009947416 6:70355914-70355936 CTGTATCCTCACATGGTGGAAGG - Intergenic
1010162969 6:72880339-72880361 CTATGTCCTCACATGGTGGAAGG + Intronic
1010339580 6:74732555-74732577 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1010367595 6:75069850-75069872 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1010507656 6:76680204-76680226 CTGAGTCCTCACCTGGTGGAAGG - Intergenic
1010649474 6:78434565-78434587 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1010974450 6:82296748-82296770 ATGTGTCCTCACATGGTGGAAGG + Intergenic
1010986967 6:82435703-82435725 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1011000352 6:82581770-82581792 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1011127355 6:84021438-84021460 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1011289938 6:85766374-85766396 CTGGGTCCTCACATGGTAGAAGG + Intergenic
1011756097 6:90499637-90499659 CTGTGTCCTCACATGGTACAAGG + Intergenic
1011805460 6:91067863-91067885 CTGTGTCCTCACATGATGGAAGG - Intergenic
1011859605 6:91738264-91738286 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1012443232 6:99281671-99281693 CTGTGTCCTCACATGGTAAAAGG - Intronic
1012926617 6:105274267-105274289 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1013398283 6:109766166-109766188 CTGTGTCCTCACATGATGGAAGG - Intronic
1013594114 6:111645577-111645599 CTGTGTCCTCACCTGGTAGAAGG - Intergenic
1013630016 6:111977254-111977276 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1013693295 6:112670314-112670336 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1013749261 6:113383531-113383553 CTGTGTCTTCACCTGGTGGAAGG + Intergenic
1013781863 6:113737717-113737739 CTGTGTCCTCACATGGTGAAAGG - Intergenic
1013786708 6:113789441-113789463 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1014336442 6:120142553-120142575 CTGTGTCCTCACCTGGTGGAAGG - Intergenic
1014503618 6:122225793-122225815 CTGCATCCTCACATGGTGGAAGG + Intergenic
1014525105 6:122493291-122493313 CTGTGTCCTCACATGGTGAAAGG - Intronic
1014642160 6:123926010-123926032 CTGTGTCCTCACATGGTGGAAGG + Intronic
1014775911 6:125509632-125509654 CTGTGTGCTCACGTGGTGGAAGG - Intergenic
1015094630 6:129400136-129400158 CTGTGTCCTCACATGGTAAAAGG + Intronic
1015169893 6:130240768-130240790 CTGAGTCCTCACATGGTGGAAGG - Intronic
1015175721 6:130305997-130306019 ATGTGTCCTCACATGGTGGAAGG + Intronic
1015187088 6:130430212-130430234 CTGTGTCCTCACATGGTAGAAGG + Intronic
1015234371 6:130953773-130953795 CTGTGTCCTCACCTGATGGAAGG - Intronic
1015256806 6:131186674-131186696 CTGCATCCTCACCTAGTGGAAGG + Intronic
1015256814 6:131186705-131186727 CTGTATCCTCACATGGTGGAGGG + Intronic
1015369792 6:132437749-132437771 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1015389407 6:132664307-132664329 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1015684675 6:135846678-135846700 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1015776368 6:136818857-136818879 CCGTGTCCTCACGTGGTGGAAGG + Intergenic
1016195152 6:141327129-141327151 CTGTGTCCTCACATGATGAAAGG + Intergenic
1016353177 6:143189992-143190014 CTGTGTCCTCACATGGTGGAAGG + Intronic
1016508640 6:144814240-144814262 CTGCGTCCTCCCATGGTGGAAGG - Intronic
1016563519 6:145424757-145424779 CTGCATCCTCACGTGGTGGAAGG - Intergenic
1016670085 6:146694364-146694386 CTGTGTACTCACCTAGTGGAAGG + Intronic
1016795009 6:148108397-148108419 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1016982689 6:149867498-149867520 CTGAGTCCTCACCTTGTGGGAGG + Intergenic
1016995867 6:149962237-149962259 CTGGGTCCTTAGCATGTGCAAGG + Intergenic
1017002712 6:150006931-150006953 CTGGGTCCTTAGCATGTGCAAGG - Intergenic
1017012314 6:150070921-150070943 CTGGGTCCTTAGCATGTGCAAGG - Intergenic
1017187486 6:151616803-151616825 CTGTGTCCTCACATGGTGGAAGG + Intronic
1017338220 6:153287139-153287161 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1017346767 6:153391861-153391883 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1017357362 6:153525109-153525131 TTGTGTCCTCACATGGTGGAAGG - Intergenic
1017459419 6:154635188-154635210 CTGAGTCCTCACATGGTAGAAGG + Intergenic
1017552230 6:155521323-155521345 CTGTGTCCTCCCCTGGTGGAAGG - Intergenic
1017595650 6:156025907-156025929 CTGTGTCCTCACATGGTGGAGGG - Intergenic
1017792880 6:157817023-157817045 CTATGTCCTCACATGGTGGAAGG - Intronic
1017803865 6:157925953-157925975 CTGAGTCCCCACATGGTGGAAGG + Intronic
1017852345 6:158315790-158315812 CTGTGTCCTCACATGGTGGAAGG + Intronic
1017924920 6:158902394-158902416 CTGCGTCCTCACATGGTTGAAGG - Intronic
1018040602 6:159918461-159918483 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1018154075 6:160969260-160969282 CTGTGTCCTCACCTGGTAGAAGG - Intergenic
1018223091 6:161601328-161601350 TTGTGTCCTCACTTGGTGAAAGG + Intronic
1018334791 6:162775135-162775157 CTGGGTCCCCACATGGTGGAAGG - Intronic
1018350838 6:162957170-162957192 CAGGGTCCTCACCTGGAGAATGG + Intronic
1018479915 6:164180003-164180025 CTGCGTCCTCACGAGGTGGAAGG - Intergenic
1018520576 6:164645662-164645684 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1018714614 6:166521982-166522004 CTGTGTCCTCACTTGATGGAAGG - Intronic
1018785340 6:167103669-167103691 CTGTGTCCGCACATGGTGGAAGG - Intergenic
1019127720 6:169852141-169852163 CTGGGTCAGTACCTGGAGCAGGG - Intergenic
1019182747 6:170201620-170201642 CTGTGTCCTCACGTGATGGAAGG + Intergenic
1019327806 7:446746-446768 CTGGGTCCTCGGCTGGTGCAGGG - Intergenic
1019340436 7:506524-506546 GTGTGTGCTCACCTGGTGCTTGG - Intronic
1019527096 7:1485278-1485300 CAGCGCCCTCACCTGCTGCAGGG + Exonic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1019791947 7:3020074-3020096 CCGTGTCCTCACATGGTGGAAGG - Intronic
1019911009 7:4100581-4100603 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1019994924 7:4717820-4717842 GTCGGTCTTCACCTGGAGCATGG - Intronic
1020220624 7:6233924-6233946 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1020366571 7:7386968-7386990 CCGTGTCCTCACATGGTGGAAGG + Intronic
1020725501 7:11808346-11808368 CTGTGTCCTCACACGGTGGAAGG - Intronic
1020810663 7:12846478-12846500 CTGTGGCCTTACCAGGTGCAGGG + Intergenic
1020842934 7:13243580-13243602 CTATGTCCTTACCTGGTGAAAGG - Intergenic
1021062465 7:16130939-16130961 GTGTGTCCTCACATGGTGGAAGG - Intronic
1021518727 7:21517018-21517040 CTGTGTCTTCACATGGTGAAAGG + Intergenic
1021560073 7:21960887-21960909 CTGTGTCCTCACATGGTGGGGGG - Intergenic
1021808951 7:24384015-24384037 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
1021845791 7:24761428-24761450 ATGTGTCCACACCTGGTGGAAGG + Intergenic
1021864162 7:24938251-24938273 TTGTGTCCTCACGTGGTGGAAGG - Intronic
1022220261 7:28307366-28307388 CTGGGTCCTCACATGCTGGGAGG - Intronic
1022323711 7:29310735-29310757 CTGTGTCCTCACATGGTGGGAGG + Intronic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1022640766 7:32180503-32180525 CTGTGTCCTCACATGATGGAAGG - Intronic
1022647614 7:32245794-32245816 CTGTGTCCTCACATGGTGGAAGG + Intronic
1023047414 7:36222740-36222762 CGGGGTCCCCACTTGGTGGAAGG + Intronic
1023062466 7:36341762-36341784 GTGTGTCCTCACATGGTGGAAGG - Intronic
1023122201 7:36921053-36921075 TTGCGTCCTCACATGGTGGAAGG - Intronic
1023539586 7:41251222-41251244 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1023823344 7:43992265-43992287 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1023897652 7:44447526-44447548 CTGTGTCCTCACGTGGTGACAGG - Intronic
1023939219 7:44759399-44759421 CTGGGTCATGCCCTGCTGCAGGG - Exonic
1023961391 7:44929592-44929614 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1023965219 7:44960607-44960629 CTGGGGCCTCTCCTGTTGAATGG - Intergenic
1024390591 7:48807210-48807232 CTGTGTCCTCACATGGTGAAGGG - Intergenic
1024550199 7:50556332-50556354 CTATGTCCTCACATGGTGAAAGG + Intronic
1025300616 7:57817236-57817258 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1025886733 7:65601792-65601814 CTGTGTTCTCACATGGTGAATGG + Intergenic
1025952767 7:66158470-66158492 CTGGATCCTCACATGGCACAAGG - Intergenic
1026028496 7:66767708-66767730 CTGTGTCCTCACATGGTGGGAGG - Intronic
1026103657 7:67403431-67403453 CTGTGTCATCACATGGTGGAAGG + Intergenic
1026122441 7:67549800-67549822 ATGTGTCCTCACATGGTGAAAGG + Intergenic
1026221663 7:68403276-68403298 CTGTGTCCTCATATGATGCAAGG - Intergenic
1026491369 7:70866686-70866708 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1026614485 7:71889270-71889292 CTGCGTCCTCATGTGGTGGAAGG + Intronic
1026637650 7:72098223-72098245 CTTGGTCCCCAACTGGTGCTTGG + Intronic
1026833729 7:73624647-73624669 CCGGGTTCTCACCTGGCGTAAGG - Intergenic
1026943730 7:74303306-74303328 CTGGCACCTCACCTGCTCCACGG - Intronic
1027301070 7:76836413-76836435 CTGTGTCTTCACATGGTGAAAGG + Intergenic
1027617649 7:80443650-80443672 CTGTGTCCTCACATGGTGGAAGG + Intronic
1027673749 7:81133763-81133785 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1027695728 7:81407823-81407845 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1028525028 7:91774656-91774678 GTGGGTCCTCACCATGTCCAAGG - Intronic
1028669417 7:93384074-93384096 CTATGTCCTGACCTGGGGCAGGG - Intergenic
1028766770 7:94568802-94568824 CTGTGTCCACACATGGTGGAAGG - Intergenic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029606558 7:101602683-101602705 CTGGGGCCATATCTGGTGCAGGG - Intergenic
1029751604 7:102545717-102545739 CTGTGTCCTCATATGGTGGAAGG + Intronic
1029769557 7:102644808-102644830 CTGTGTCCTCATATGGTGGAAGG + Intronic
1029877450 7:103769348-103769370 CTGTATCCTCACGTGGTGGAAGG - Intronic
1029941608 7:104486506-104486528 CTGTGTCCTCACATGGTGAGAGG + Intronic
1029972459 7:104802549-104802571 CTCTGTCCTCACATGGTGGAAGG - Intronic
1029996479 7:105012920-105012942 CGGGGCCCTCACCTCGCGCAGGG + Intergenic
1030271073 7:107668800-107668822 CTGCGTCCTCACATGGTGGAAGG + Intronic
1030422163 7:109321158-109321180 CTGTGTCCTCACTAGGTGGAAGG + Intergenic
1030427194 7:109393488-109393510 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
1030605995 7:111639629-111639651 CTGTGTCCTCACATGATGGAAGG - Intergenic
1030776811 7:113543663-113543685 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1031213514 7:118860749-118860771 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1031506965 7:122596942-122596964 CTGCTTCCACACCTGGTGGAAGG + Intronic
1031609536 7:123808838-123808860 CTGTTTCCTCACATGGTGGAAGG + Intergenic
1031628274 7:124015740-124015762 CTGTGTCCTCACATGCTGGAAGG + Intergenic
1031634856 7:124090397-124090419 TTGTGTCCTCACATGGTGTAAGG - Intergenic
1032690877 7:134285290-134285312 ATGGGTCTTCACCTTGTGGAAGG - Intergenic
1032742050 7:134748944-134748966 CTGTGTCCTCACATGGTGAAAGG - Intronic
1032761887 7:134951063-134951085 CTGTGTCCTTACATGGTGGAAGG + Intronic
1032889792 7:136182012-136182034 CAGTGTCCTCACATGGTGAAGGG + Intergenic
1033261200 7:139845338-139845360 CTCGCTTCTCACCTGGTGCCTGG + Intronic
1033476537 7:141698474-141698496 CTCAGTCCTCATCTGGAGCAGGG - Intronic
1033872627 7:145774747-145774769 CTGTGTCTTCACCTGTTGGAAGG - Intergenic
1034309399 7:150073189-150073211 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1034362254 7:150510311-150510333 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1034402708 7:150876089-150876111 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1034530569 7:151693756-151693778 CTGCGTCCTCACATGGTGGAAGG - Intronic
1034657884 7:152743799-152743821 CAGTGTCCTCTCCTGGTGGAAGG + Intergenic
1034737155 7:153439971-153439993 CTGTGTCCTCACATGGCGGAAGG - Intergenic
1034797460 7:154027453-154027475 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1034872087 7:154694117-154694139 CTGTGTCCTCGCTTGGTGGAAGG + Intronic
1034888930 7:154822353-154822375 CTGCGTCCTCACATGGTGGAAGG + Intronic
1034949832 7:155289832-155289854 CTGCATCCTCACATGGTGAAGGG + Intergenic
1035205772 7:157292997-157293019 CTGGGGCCTCACCGGGCGCTGGG - Intergenic
1035461097 7:159039660-159039682 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1035635263 8:1139463-1139485 ATGTGTCCTCACGTGGAGCAAGG + Intergenic
1035719936 8:1784378-1784400 CTGCATCCTCACGTGGTGGAGGG + Exonic
1036130200 8:6102788-6102810 CTGCCTCCTCACCTGGAGGAAGG + Intergenic
1036222222 8:6930329-6930351 CTGTGTCCTCACCTGATGGAAGG - Intergenic
1036290204 8:7481283-7481305 CTGTGTCCTCCCATGGTGGAAGG + Intergenic
1036331273 8:7830237-7830259 CTGTGTCCTCCCATGGTGGAAGG - Intergenic
1036714472 8:11107742-11107764 CTGGCTCCTCTCCTGCTGCTAGG + Intronic
1037463863 8:19139888-19139910 CTGAGTCCTCACAAGGTGAAAGG + Intergenic
1037836819 8:22219554-22219576 CTGTGTCCTCACAGGGTGAAAGG - Intergenic
1037843083 8:22259433-22259455 CTATGTCCTCACATGGTGGAAGG - Intergenic
1038165613 8:25082584-25082606 CTGTGTCTTCACATGGTGAAAGG - Intergenic
1038282774 8:26180974-26180996 CTGTGTCCTCACCTGGTGGAAGG - Intergenic
1038358614 8:26854932-26854954 CTGTGTGCTCACTTGGTGGAAGG - Intronic
1038381268 8:27096598-27096620 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1038483361 8:27916993-27917015 CTGTGTCCTCACTTGGTGGGAGG - Intronic
1038532246 8:28327931-28327953 CTGTGTCCTCAAGTGGTGGAAGG + Intronic
1038757439 8:30354611-30354633 CTGGGTCCTCACATGGTTGAAGG + Intergenic
1038867175 8:31452006-31452028 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1039274754 8:35923174-35923196 CTGTGTCCTCACCTAGTGGAAGG + Intergenic
1039647615 8:39304779-39304801 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1039883481 8:41641933-41641955 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1040021398 8:42744545-42744567 CTGAGTCCTCACATGGTGGACGG + Intergenic
1040350361 8:46560598-46560620 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1040792345 8:51247164-51247186 CTGTGTCCTCATATGGTGAAAGG + Intergenic
1041024356 8:53668777-53668799 CTGAGTCCTCACATGGCGGAAGG + Intergenic
1041128937 8:54675974-54675996 CTGTGTCCTCCCATGGTGGAAGG + Intergenic
1041258209 8:55997485-55997507 CTGTGTCCTCACGTGGTGGAAGG + Intronic
1041640872 8:60200130-60200152 CTGTGTCCTCACATGGTAGAAGG - Intronic
1042168707 8:65971967-65971989 TTGTGTCCTCACATGGTGAAAGG - Intergenic
1042201204 8:66280774-66280796 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1042411409 8:68470739-68470761 CTGTGTCCTCACATGGTGGAAGG + Intronic
1042628635 8:70790916-70790938 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1042736744 8:71998176-71998198 CTGTGTTCTCACATGGTGGAAGG + Intronic
1042775884 8:72430808-72430830 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1043011645 8:74888499-74888521 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1043022429 8:75020500-75020522 CTGTGTCCTCACATGGTGGAGGG + Intronic
1043530382 8:81143454-81143476 CTGGATCTTCACATGGTGAAAGG - Intergenic
1044348157 8:91130879-91130901 CTGTGTCCTCACATGGTAGAAGG + Intronic
1044415556 8:91935336-91935358 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1044510639 8:93074351-93074373 CTGTGTCCTCACATGGTAGAGGG - Intergenic
1044548145 8:93482337-93482359 CTGTATCCTCACATGGTGGAAGG - Intergenic
1044631864 8:94288042-94288064 CTGTGTCCTCACATGGCGGAAGG + Intergenic
1045395266 8:101754509-101754531 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1045404475 8:101852008-101852030 CTGCATCCTCACATGGTGGAAGG - Intronic
1045411322 8:101923122-101923144 TTGTGTCCTCACTTGGTGAAAGG - Intronic
1045468870 8:102493479-102493501 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1045599204 8:103693964-103693986 ATGGGACCTGACCTGGTGCTTGG + Intronic
1045719623 8:105093010-105093032 CTGTGTCCTCACATGTTGGAAGG - Intronic
1046079430 8:109353341-109353363 CTGCATCCTCACATGGTGGAAGG + Intergenic
1046308617 8:112403589-112403611 CTGTGTCCTCACATGGTGGAAGG + Intronic
1046471726 8:114683647-114683669 CTGGGTCATAACATGGTGAAAGG + Intergenic
1046484064 8:114862083-114862105 CTGGTTCATGAGCTGGTGCATGG + Intergenic
1046897901 8:119493014-119493036 CTATGTCCTCACATGGTGGAAGG - Intergenic
1046970648 8:120219522-120219544 CTGTGCCCTTACCTGGTGGAAGG + Intronic
1047063248 8:121251186-121251208 TTGTGTCCTCACATGGTGAAAGG - Intergenic
1047105499 8:121726643-121726665 CTGTGTCCTCACCTGGGGGGAGG + Intergenic
1047373329 8:124274115-124274137 CTGTGTCCTCACATGGCGGAAGG - Intergenic
1047432862 8:124807665-124807687 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1047638039 8:126787462-126787484 CTGTGTCCTCCCATGGTGGATGG - Intergenic
1048142817 8:131811289-131811311 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1048322397 8:133410350-133410372 CTGTCTCCTCACATGGTGTAAGG + Intergenic
1048399121 8:134047188-134047210 CAGCGTCCTCACATGGTGAAAGG - Intergenic
1048434150 8:134400211-134400233 CTGTGTCCTCACATGATGAAGGG - Intergenic
1048465552 8:134662147-134662169 CTGTGTCCTCACATGGTGGAAGG + Intronic
1049025117 8:139983144-139983166 CTGTGTCCTCACATGGTGGGAGG - Intronic
1049254822 8:141608158-141608180 CTGTGGCCTCACATGGTGGATGG - Intergenic
1049275483 8:141718119-141718141 CTGGATCCTCTCCTGGAGGAGGG - Intergenic
1049323376 8:142009282-142009304 CTGTGCCCTCACATGGTGGATGG - Intergenic
1049408702 8:142462972-142462994 CTGGGCCCTCTCCTGGAGCTGGG + Intronic
1050057302 9:1669045-1669067 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1050103936 9:2146187-2146209 CTGTGTCCTCACATGGTAGAAGG + Intronic
1050272298 9:3959237-3959259 GTGTGTCCTCACGTGGTGGAAGG - Intronic
1050489557 9:6173417-6173439 ATGGGTCCCCACCTGCAGCAAGG - Intergenic
1050529530 9:6576306-6576328 CTGTGTCCTCACATGGTGGAAGG + Intronic
1050605400 9:7295967-7295989 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1051108852 9:13611953-13611975 TTGTGTCCTCACATGGTGGAAGG + Intergenic
1051277279 9:15408939-15408961 CTGTGTCTTCACCTGGTGGAAGG + Intergenic
1051297517 9:15612009-15612031 CTGTGTCCTAACATGGTGGAAGG - Intronic
1051352041 9:16206085-16206107 CTGAGTCCTCACATGGCGGAAGG + Intronic
1051467191 9:17393128-17393150 CTGTGTCCTCACATGGTCTAAGG + Intronic
1051508389 9:17849869-17849891 CTGTGTCCTCACATGGCACAAGG + Intergenic
1051662684 9:19440501-19440523 CTGTGTCCTCACATGGTAGAAGG - Intronic
1051701702 9:19831009-19831031 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1051737377 9:20215162-20215184 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1052378735 9:27746145-27746167 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1052437526 9:28447354-28447376 TTGTGTCCTCACATGGTGGAAGG - Intronic
1052456827 9:28710212-28710234 CTGTGTCCTCACATAATGCAAGG - Intergenic
1052458163 9:28727795-28727817 CTTGGTCCACATCTGGTCCACGG - Intergenic
1052605023 9:30688535-30688557 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1052944899 9:34160506-34160528 CTATGTCCTCACATGGTGAAAGG + Intergenic
1053034876 9:34816584-34816606 CTGTGTCCTCCCATGGTGAAAGG + Intergenic
1053039933 9:34862057-34862079 CTGTGTCCTCACACGGTGGAAGG + Intergenic
1053723363 9:40971979-40972001 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1054702233 9:68424399-68424421 CTGTGTCCTCACATGGTGGAAGG + Intronic
1054865454 9:69995840-69995862 CTGTGTCCTCTCCTGGTGAAAGG - Intergenic
1054935374 9:70681980-70682002 CTGTGTCCTCACGTGGTGGGAGG - Intronic
1055107546 9:72528182-72528204 TTGTGTCCTCACATGGTGGAAGG - Intronic
1055364932 9:75533187-75533209 CTGGATCCACACCTGCTTCAAGG - Intergenic
1055411385 9:76033770-76033792 CTGTGTCCTCACATGGTAGAAGG + Intronic
1055466415 9:76570974-76570996 CTGTGTCCTCACATGGTGGGAGG + Intergenic
1055618210 9:78095112-78095134 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1055657083 9:78461668-78461690 TTGTGTCTTCACCTGGTGGAAGG - Intergenic
1055723749 9:79204908-79204930 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1056423472 9:86453167-86453189 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1056735841 9:89209137-89209159 CTGTGTCCTCACATGGTTGAAGG + Intergenic
1056789988 9:89618949-89618971 CTGTGTCCCCACGTGGTGGAAGG - Intergenic
1056842878 9:90012954-90012976 CTGTGTCCTCACATGGTGAAAGG - Intergenic
1056854189 9:90110932-90110954 CTGTGTCCTTCCCTGGTGGAAGG - Intergenic
1057043219 9:91862707-91862729 CTGTGTCCTCACATGGTGGAGGG - Intronic
1057056284 9:91963700-91963722 CTGTATCCTCACATGGTGGAGGG - Intergenic
1057255481 9:93543499-93543521 CTGGGTCCCCGCCAGGTGTAGGG + Intronic
1057317810 9:93981334-93981356 CTGTGAATTCACCTGGTGCAGGG - Intergenic
1057452148 9:95174245-95174267 CTGTGTCTTCACATGGTGAAAGG + Intronic
1057673306 9:97114895-97114917 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1057795839 9:98157448-98157470 GGGTGTCCTTACCTGGTGCAGGG + Exonic
1057855031 9:98595207-98595229 CTGGGTCCTCACATGGTGGGAGG + Intronic
1057871094 9:98718383-98718405 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1057895057 9:98902611-98902633 CTATGTCCTCACATGGTGAAAGG - Intergenic
1057974391 9:99588881-99588903 CTGCATCCTCACATGGTGGAAGG - Intergenic
1058271827 9:102982018-102982040 CTGGGTCCTCACTTGGTGGAAGG - Intergenic
1058475316 9:105327224-105327246 CTGGGAGCTCACCAGCTGCAAGG - Intronic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1058600093 9:106659884-106659906 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1058636301 9:107041688-107041710 CTGTGTCCTCACATGGTGGTGGG + Intergenic
1058785127 9:108379376-108379398 CTGTGGCCTCACGTGGTGGAAGG - Intergenic
1058890737 9:109358517-109358539 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1058983179 9:110188864-110188886 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1059142950 9:111871160-111871182 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1059323435 9:113487049-113487071 CTGGGTGCTGACCTGGAGCCAGG + Intronic
1059465147 9:114464452-114464474 CTGTGTCCTCACATGGTGGAAGG + Intronic
1059506708 9:114805889-114805911 CTGGGCTCTCACCTGCTGCCTGG - Exonic
1059599643 9:115762872-115762894 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1059613384 9:115923194-115923216 CTGTATCCTCACATGGTGGAAGG + Intergenic
1059701498 9:116779314-116779336 CTGTGTCCTCACCTGGCAAAAGG - Intronic
1059726285 9:117011391-117011413 CTGTGTTCTCACATGGTGGAAGG - Intronic
1060219974 9:121759339-121759361 AGGGGTCCTCACCTGGAGGAGGG - Intronic
1060283196 9:122227469-122227491 CTGGGCCATCACCTGGGGGAGGG + Exonic
1060500375 9:124149260-124149282 CTGTTTCCTCACATGGTGGAAGG + Intergenic
1060607767 9:124932828-124932850 CTGTGCCCTCACATGGTGGAAGG + Intronic
1060660528 9:125402596-125402618 CTGAGCCCTCACCTTGGGCAAGG + Intergenic
1060723457 9:125992976-125992998 CTGAGTCCTCCCTTGGTGCCTGG + Intergenic
1060808536 9:126594923-126594945 CTGTGTCCTAACATGGTGCAAGG - Intergenic
1061034431 9:128105871-128105893 CTGGGTCCTCACCTGCTCATAGG - Exonic
1061266678 9:129509829-129509851 CTGTATCCTCACATGGTGGAAGG + Intergenic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1061548167 9:131316672-131316694 CTGCATCCTCACCTGGGGGAAGG - Intergenic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1061752935 9:132793196-132793218 CTTCATCCTCACCTGGTGGAAGG + Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062026946 9:134344901-134344923 CTGGGTCCACACCAGGCACAGGG - Intronic
1062056785 9:134472957-134472979 CTGGGGCCTCACCTGGGAGAGGG - Intergenic
1062069615 9:134548498-134548520 CTATGTCCTCACATGGTGGAAGG + Intergenic
1062461492 9:136664323-136664345 CTTGGTCCTACCTTGGTGCATGG - Intronic
1062688869 9:137831048-137831070 CTGTGTCCCCACGTGGTGGAGGG + Intronic
1062725985 9:138073846-138073868 CTGGGGCATCACTTGGTGGAGGG + Intronic
1203451786 Un_GL000219v1:124002-124024 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1203367178 Un_KI270442v1:269211-269233 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185465014 X:349236-349258 CTGCGTCCTCACGGGGTGGAAGG - Intronic
1185480757 X:444608-444630 CTGTGTCCTCATATGGTGAAAGG + Intergenic
1185489702 X:511784-511806 CTGTGCCCTCACGTGGTGGAAGG - Intergenic
1185641253 X:1589682-1589704 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185671050 X:1810403-1810425 CTGTGTCCTCACCTGGTGGAAGG - Intergenic
1185758082 X:2668020-2668042 CTGTGTCCTCACATGCTGGAAGG - Intergenic
1185808302 X:3080661-3080683 CTGTGTCCTCACATGGTGGAAGG + Intronic
1185827385 X:3264909-3264931 CTGTGTCCTCACACGGTGGAAGG - Intergenic
1185839076 X:3371815-3371837 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1185842601 X:3406530-3406552 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1185842776 X:3408520-3408542 ATGGGTCCTCACATGGTGGAAGG + Intergenic
1185845321 X:3432496-3432518 CTGTGTCCCCACATGGTGGAAGG + Intergenic
1185869679 X:3653257-3653279 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185872258 X:3673897-3673919 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185876760 X:3708188-3708210 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1185949823 X:4420665-4420687 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1185967933 X:4628629-4628651 CTGTGTCCTCGCATGGTGGAAGG - Intergenic
1185969013 X:4641017-4641039 CTGTGTCCTCACATGCTGGAAGG - Intergenic
1186000091 X:5000006-5000028 CTGTGTCCTCACCTGGCAGAAGG + Intergenic
1186027017 X:5324277-5324299 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1186029146 X:5347778-5347800 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186034714 X:5409390-5409412 CTGTGTCCTCCCATGGTGAAAGG - Intergenic
1186035919 X:5423541-5423563 CTGAGTCCTCACGTGGTAGAAGG - Intergenic
1186054869 X:5639407-5639429 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186066796 X:5775268-5775290 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1186151310 X:6677275-6677297 CTGTGTCCTCACACGGTGAAAGG - Intergenic
1186170547 X:6872009-6872031 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1186178797 X:6952750-6952772 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186211400 X:7253979-7254001 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186228984 X:7432099-7432121 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186242354 X:7583141-7583163 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186249702 X:7652513-7652535 CTGGGTCCTTACATGGAGGAAGG - Intergenic
1186276998 X:7949858-7949880 CTGTGTCCTCACATGGTAGATGG + Intergenic
1186281575 X:7998803-7998825 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186313899 X:8348524-8348546 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186364411 X:8876014-8876036 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186408755 X:9327143-9327165 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186442746 X:9600301-9600323 CTGTGTTCTCACATGGTGGAAGG + Intronic
1186451783 X:9680061-9680083 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186482917 X:9909938-9909960 CTGCGTCCTCACATGATGGAAGG + Intronic
1186939770 X:14492946-14492968 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1186963463 X:14762130-14762152 CTGCATCCTCACATGGTGGAAGG + Intergenic
1186987056 X:15028489-15028511 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1187057900 X:15758322-15758344 CTGCATCCTCACGTGGTGGAAGG + Intronic
1187108063 X:16265704-16265726 CTGTGTCCTCACATGATGGAAGG + Intergenic
1187446168 X:19363259-19363281 GTGTGTCCTCACATGGTGGAAGG - Intronic
1187471584 X:19574557-19574579 CTGTGCCCTCACGTGGTGGAAGG + Intronic
1187563350 X:20423379-20423401 CTGCATCCTCACATGGTGAAAGG - Intergenic
1187948364 X:24448225-24448247 CTGAATCCTCACATGGTGGAAGG + Intergenic
1188351816 X:29140777-29140799 CTGAGTCCTCACATGGTGGAAGG + Intronic
1188425567 X:30043278-30043300 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1188870714 X:35367588-35367610 CAGTTTCCTCACCTGCTGCATGG + Intergenic
1189068374 X:37836360-37836382 CTGTGTCCTCACAAGGTGGAAGG - Intronic
1189219949 X:39363014-39363036 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1189241350 X:39526909-39526931 TTGTGTCCTCACATGGTGGAAGG - Intergenic
1189274492 X:39775501-39775523 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1189379362 X:40490971-40490993 CTGGGGCCTCCCCTAGGGCAGGG - Intergenic
1189380086 X:40496466-40496488 CTGTGTCCTCACATGGTGGGAGG - Intergenic
1189554201 X:42125509-42125531 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1189631278 X:42956341-42956363 CTGTGTCCTCACATGATGGAAGG + Intergenic
1189668682 X:43384637-43384659 CTGTGTCCTCACATGGCACAAGG - Intergenic
1189740147 X:44109446-44109468 CTGCATCCTCACATGGTGGAAGG + Intergenic
1189768820 X:44401329-44401351 CTGTGTCCTCACATGATGGAAGG - Intergenic
1190144823 X:47880928-47880950 CAGGGTCCTGAGGTGGTGCAGGG + Intronic
1190370326 X:49734129-49734151 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1190623676 X:52314704-52314726 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1190762347 X:53447001-53447023 CTGTGTCCTCACCTGGTGGAAGG - Intergenic
1191203007 X:57804806-57804828 CTGGGGCCTCTCGTGGTGTAGGG - Intergenic
1191719995 X:64221514-64221536 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1191821390 X:65312738-65312760 CTGTGTCCTCACCTGGTGGAAGG + Intergenic
1191901249 X:66042720-66042742 CTGGCTCATGCCCTGGTGCATGG - Intergenic
1192119178 X:68438811-68438833 CTCTGTCCTCACATGGTGGAAGG - Intergenic
1192171452 X:68857900-68857922 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1192275268 X:69623366-69623388 CTGTATCCTCACGTGGTGGAAGG + Intronic
1192342369 X:70274736-70274758 TTGTGTCCTCACATGGTGGAAGG + Intronic
1193084122 X:77433455-77433477 CTGTGTTCTCACATGGTGAAGGG + Intergenic
1193136951 X:77983008-77983030 CTGTGTCCTCACATGGTGGAAGG + Intronic
1193272232 X:79543196-79543218 ATGTGTCCTCACATGGTGGAAGG + Intergenic
1194173813 X:90622481-90622503 CTGTGTCCTTACATGGTGAAAGG - Intergenic
1194736713 X:97521127-97521149 CTGTGCCCTCACATGGTGGAAGG - Intronic
1194780254 X:98015870-98015892 CTGTGTCATCACATGGTGAAAGG + Intergenic
1195121235 X:101755124-101755146 CTGGTACCTCAGATGGTGCAGGG - Intergenic
1195407730 X:104535157-104535179 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1195779816 X:108449722-108449744 CTGTGACCTCACATGGTGAAAGG + Intronic
1195987617 X:110647312-110647334 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1196021727 X:110997876-110997898 CTGTGTCCTCACGTAGTGGAAGG - Intronic
1196076740 X:111586080-111586102 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1196298716 X:114029949-114029971 CTGTGTCCTCACATGGGGGAAGG - Intergenic
1196323218 X:114368813-114368835 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1196327158 X:114420035-114420057 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1196407596 X:115380916-115380938 CCGTGTCCTCACATGGTGGAAGG - Intergenic
1196536062 X:116845873-116845895 CTTTGTCCTCACATGGTGGAAGG + Intergenic
1196567229 X:117222411-117222433 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1196567424 X:117225741-117225763 CTGCTTCCTCACATGGTGGAAGG - Intergenic
1196731560 X:118946085-118946107 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1196886472 X:120250967-120250989 CCGGGTCCTCACCTGCTTCCCGG - Exonic
1196931674 X:120687830-120687852 CTGTGTCTTCACAAGGTGCAAGG - Intergenic
1196937710 X:120745973-120745995 CTGTGCCCTCACATGGTGGAGGG - Intergenic
1197063796 X:122214848-122214870 CTGTGTTCTCACATGGTGGAAGG + Intergenic
1197405760 X:126047068-126047090 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1197610933 X:128637431-128637453 CTGTGTCCTCACATGGCGAAAGG + Intergenic
1197787140 X:130210026-130210048 CTGCGTCCTCACATGGTGGAAGG - Intronic
1197914179 X:131516866-131516888 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1198009738 X:132539403-132539425 CTGTGTCCTAACATGGTGGAAGG + Intergenic
1198120748 X:133590140-133590162 CTGTGTCCTCACCTGGGGGAAGG - Intronic
1198308337 X:135404618-135404640 CTGAGTCCTCACATGGTGAAGGG + Intergenic
1198671778 X:139088914-139088936 CTGTGTCCTCACATGGTGGAAGG - Intronic
1198838064 X:140825641-140825663 CTGGGTCATTACATGGTGGAAGG + Intergenic
1198891844 X:141404996-141405018 CTGTGTCCTCACATGGTGGATGG - Intergenic
1198896709 X:141463564-141463586 CTGTGTCCTCAAGTGGTGGAAGG + Intergenic
1198920612 X:141721859-141721881 CTGTGTCATCTCCTGGTGAAAGG + Intergenic
1199130183 X:144175975-144175997 CTGTGTCCTCACATGCTGGAAGG + Intergenic
1199589371 X:149452115-149452137 CTGTGTACTCACGTGGTGGAAGG - Intergenic
1199945448 X:152662417-152662439 CAGTGTCCTCACATGGTGAAAGG + Intergenic
1200520033 Y:4200171-4200193 CTGTGTCCTTACATGGTGAAAGG - Intergenic
1200783488 Y:7238050-7238072 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1200788603 Y:7280222-7280244 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1200791646 Y:7304784-7304806 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1200842324 Y:7795392-7795414 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1200944115 Y:8815267-8815289 CTGGGTCCTCACATGGTAGAAGG + Intergenic
1201071509 Y:10151021-10151043 ATGGGTCCTCACATGGTGGAAGG - Intergenic
1201227819 Y:11835105-11835127 CTGTGTCCTCACATGCTGGAAGG - Intergenic
1201232440 Y:11878354-11878376 CTATGTCCTCACATGGTGAAAGG - Intergenic
1201245035 Y:11995127-11995149 CTGGTTCTTCAGATGGTGCAGGG + Intergenic
1201251519 Y:12063224-12063246 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1201446690 Y:14064607-14064629 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1201502700 Y:14662554-14662576 CTGTGTCCTCACATGGTAGAAGG + Intronic
1201512514 Y:14780649-14780671 CTGTGTCCTCACATGGTAAAAGG - Intronic
1201597146 Y:15682957-15682979 CTGCATCCTCACATGGTGGAAGG - Intergenic
1201637362 Y:16139077-16139099 CTGTGTCCTCACATGATGGAAGG + Intergenic
1201688193 Y:16731433-16731455 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1201962798 Y:19700459-19700481 CTGTGTCCTCACCTGGCACGTGG - Intergenic