ID: 922226133

View in Genome Browser
Species Human (GRCh38)
Location 1:223647329-223647351
Sequence CTGTGAAATTACAACTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 8, 3: 31, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922226133 Original CRISPR CTGTGAAATTACAACTATCT GGG (reversed) Intronic
905070671 1:35222457-35222479 CTGTAAAATTACAAAAATATGGG - Intergenic
906778453 1:48550834-48550856 CTCTGAAATTAGACATATCTGGG - Intronic
908268456 1:62400587-62400609 CTGTGATATTAAAACTTTATGGG + Intergenic
910139434 1:84011044-84011066 CAGTTATATAACAACTATCTTGG + Intergenic
910481312 1:87661345-87661367 CTGTAAAATTACTACAAACTTGG - Intergenic
912188730 1:107312982-107313004 CTGTCAAATTGTAACTATGTAGG - Intronic
912428458 1:109614916-109614938 CTTTGAAATTGTGACTATCTTGG + Exonic
913098062 1:115538385-115538407 CTGTGAAATTACCACTAACCAGG + Intergenic
915092164 1:153434244-153434266 CTGTGAAGTTACACCTTTTTGGG - Intergenic
916772977 1:167931650-167931672 CTGTGTAATTCAAACTATGTAGG + Intronic
916946824 1:169737614-169737636 ATGTGAAATTACAGGTATTTGGG - Intronic
917365779 1:174230695-174230717 TTGTGAATTTACAGCTATCTGGG + Intronic
918458513 1:184752513-184752535 AAGTGAAATTACAATTATTTAGG - Intronic
919218357 1:194591393-194591415 CTGTTAAATTGCAACTTTTTTGG + Intergenic
919581545 1:199381513-199381535 CTATGTAATTATAACTATCCTGG + Intergenic
921100266 1:211922756-211922778 CTGTGAAAACACAACAATCCAGG + Intergenic
922226133 1:223647329-223647351 CTGTGAAATTACAACTATCTGGG - Intronic
922357828 1:224793534-224793556 CTGTGAATTTCCATCTATTTAGG + Intergenic
922865716 1:228860023-228860045 CTGCGAAATTACAGCTGTCTTGG + Intergenic
923508072 1:234624000-234624022 CTGTGAATCTAAAACTACCTGGG + Intergenic
924248191 1:242105624-242105646 CTGTGAAATACCAAATTTCTGGG - Intronic
1063694515 10:8320346-8320368 CTGTGCAATTTCAAATCTCTGGG + Intergenic
1063788974 10:9419087-9419109 ATGTAAAATTAAAACTATTTTGG - Intergenic
1063932357 10:11041773-11041795 CTGTGGAATTAAATCTATCATGG + Intronic
1064716066 10:18177813-18177835 ATGTGGAATTACAGCTATTTGGG + Intronic
1064821985 10:19347126-19347148 CTGTGTAATTACTACTGTCATGG + Intronic
1065944420 10:30593904-30593926 ATGTGAAATTACAGCTATCTAGG - Intergenic
1067473611 10:46552502-46552524 CTGTGTAATTACAAATGTCCTGG + Intronic
1067707419 10:48620123-48620145 CTATGAAAATACAGCTTTCTGGG + Intronic
1069041351 10:63698922-63698944 CTGTGAAATGACTCCTGTCTTGG + Intergenic
1069076857 10:64046410-64046432 CTGTAAAATTAAAAATATTTAGG - Intergenic
1070840548 10:79484442-79484464 CTGTGAGATTATAAATATTTGGG + Intergenic
1072202572 10:93174294-93174316 CTGTGAAATTACAAAGTTCATGG - Intergenic
1072896285 10:99370042-99370064 CTGGGAAGTTACAATTAACTAGG - Intronic
1074662853 10:115682081-115682103 CTGTGAAAATAAAACTCTGTTGG + Intronic
1075043723 10:119129037-119129059 CTGTGAAATCAAAAAAATCTGGG + Intronic
1075790183 10:125078491-125078513 CTGTGGAAGTAGAACAATCTTGG - Intronic
1077907532 11:6545881-6545903 CTGTACAATTACGAGTATCTGGG + Exonic
1078241386 11:9533806-9533828 ATGTGAAATTACAGCTCTTTGGG - Intergenic
1078500046 11:11863884-11863906 CTGAGAAATTACAATAATTTGGG - Intronic
1079855405 11:25596657-25596679 ATTTCAAATTACAACTATCATGG + Intergenic
1080219588 11:29885843-29885865 TTGTCAAATTACAGCTATCTGGG - Intergenic
1081548671 11:44092182-44092204 CATTGAAGCTACAACTATCTTGG - Intergenic
1084913315 11:72408778-72408800 TTGTAAAATTCCAACTTTCTGGG - Intronic
1085810854 11:79679796-79679818 CTGGGAAATTAACACTAGCTAGG + Intergenic
1086935371 11:92739978-92740000 GGGAGAAAGTACAACTATCTGGG + Intronic
1088954039 11:114600154-114600176 CTTTGAAATTATAAATATATTGG - Intergenic
1089910683 11:122097382-122097404 CTGTTAAATTCCAACTGCCTTGG + Intergenic
1091790962 12:3271952-3271974 CTGTGAAATTAAAGCTGTTTTGG + Intronic
1091846584 12:3660675-3660697 GTATGAAAATGCAACTATCTGGG - Intronic
1095656035 12:44669907-44669929 TTGTTGAATTACAGCTATCTGGG - Intronic
1098051922 12:66463158-66463180 CTGTGAAATTTTAACTATGAAGG - Intronic
1098182419 12:67862085-67862107 TTGAGAACTTACATCTATCTTGG + Intergenic
1098986368 12:77016883-77016905 CTGTAAAATTAATACAATCTGGG + Intergenic
1099322500 12:81167914-81167936 CTGAGGAATTGCAACTATGTGGG + Intronic
1100496574 12:95130744-95130766 CTGTGAAAGTACTGCTGTCTAGG - Intronic
1100945911 12:99783768-99783790 CTGCGAAATTACAGCTATATAGG + Intronic
1102692158 12:114769812-114769834 CGGTGAAATTACACCAAACTGGG + Intergenic
1104257070 12:127148191-127148213 TTGTGAAATTACAGCTCTTTGGG + Intergenic
1105778121 13:23681453-23681475 TTGTGAAATTACAGCTGTTTAGG - Intergenic
1106228872 13:27806450-27806472 CTGTGAGATCACACTTATCTAGG - Intergenic
1107583326 13:41816083-41816105 ATGTGAATTTACAATGATCTCGG + Intronic
1108609255 13:52068148-52068170 CTGTGAAATGGCAACCCTCTTGG + Intronic
1108752441 13:53462079-53462101 CTGTGAACTTACAACAGTATCGG - Intergenic
1109372722 13:61445110-61445132 ATGTGAAATTACAGCTGTTTGGG + Intergenic
1109417721 13:62065110-62065132 CTGTTAAATTGCAACTGTCTTGG - Intergenic
1109856164 13:68130698-68130720 CTTTTAAATTTCACCTATCTTGG + Intergenic
1110374237 13:74774495-74774517 ATGTGAAATTACAGCTGTTTGGG - Intergenic
1112576109 13:100638236-100638258 CTGTGAAATCATTACTATCAGGG - Intronic
1113223364 13:108130590-108130612 CCTTGAAATTAAAAATATCTGGG - Intergenic
1115103720 14:29734656-29734678 CTGTGAAATGACCACTTCCTAGG - Intronic
1115513293 14:34159488-34159510 CAGGGAAATCAAAACTATCTGGG + Intronic
1117926982 14:60791772-60791794 TTTTAAAATTACAAATATCTGGG + Intronic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1120318074 14:82921641-82921663 CAGTGCTATTTCAACTATCTAGG - Intergenic
1120897505 14:89546906-89546928 CTTTGTAATTCCAGCTATCTGGG - Intronic
1124685625 15:31779435-31779457 CTGTTACATTAGAACTATCTTGG + Intronic
1124850317 15:33330641-33330663 ATTTTAAAATACAACTATCTGGG - Intronic
1124853513 15:33364113-33364135 CATTGAAATGACAAATATCTTGG + Intronic
1125192643 15:37011346-37011368 CTGGAAAATTTCAACTATCTTGG - Intronic
1126520489 15:49587969-49587991 CTGTGAAAATCCAACTTTCAAGG + Intronic
1129141388 15:73601385-73601407 CTGTGAAATCACAATTAGCAAGG + Intronic
1133488816 16:6247178-6247200 ATGTGAAATTGCAACTGTCTTGG + Intronic
1133687027 16:8175285-8175307 CTATGAATTTGCAACTACCTAGG - Intergenic
1135342172 16:21658446-21658468 CTGTGTAATTCCAATTATATGGG - Intergenic
1137417235 16:48294377-48294399 ATGTGAAATTAGAGCTTTCTGGG + Intronic
1139100014 16:63754250-63754272 TTGTAAAATTACAGCTGTCTGGG - Intergenic
1144024233 17:11263414-11263436 CTGTGAAAGAGAAACTATCTCGG + Exonic
1144114222 17:12070865-12070887 CTGTGAGATTACCACAAACTTGG + Intronic
1144526799 17:15997464-15997486 CCCTGGAGTTACAACTATCTTGG - Intronic
1148081574 17:44969946-44969968 CTGTAAAATTAAAATAATCTTGG - Intergenic
1148983158 17:51596918-51596940 CTGTGATATTACAATTATCATGG - Intergenic
1150952551 17:69820079-69820101 CTGTGAAATAACTATTAACTTGG - Intergenic
1151314595 17:73313781-73313803 TTGTGAAACTGCAGCTATCTGGG + Intergenic
1155391218 18:25338967-25338989 CTGTTAACTTTCAAATATCTGGG - Intronic
1155682523 18:28506230-28506252 CTTTTAAATTACAAGTATGTTGG - Intergenic
1155697527 18:28700314-28700336 CTGTTAACTCACAACTTTCTGGG + Intergenic
1156199192 18:34810581-34810603 CTACAAAATTACAACTATGTAGG + Intronic
1156567505 18:38210406-38210428 CTATGAAATTATAATTATTTAGG + Intergenic
1157075627 18:44464220-44464242 CTGTTAAATTTAAACTATCATGG - Intergenic
1157124425 18:44942513-44942535 CAGTGAAGTCACAGCTATCTGGG + Intronic
1158049700 18:53201853-53201875 CTGTGAAAATACAACTCTCTAGG + Intronic
1158159117 18:54460019-54460041 CTCTGAAAATTCAAATATCTTGG - Intergenic
1158319488 18:56247618-56247640 CTGTGAAAATACAACTATTAGGG + Intergenic
1158450055 18:57556339-57556361 CTTTGTAATTAAAAATATCTTGG - Intronic
1162993287 19:14317387-14317409 CTGTGGAATTAAAAATATATGGG - Intergenic
1164509675 19:28887026-28887048 ATGTGAAATGACAGCTATCTGGG + Intergenic
925622536 2:5807858-5807880 CTGGGAATATAAAACTATCTTGG - Intergenic
928489964 2:31772154-31772176 ATGTGTAATTACAACTTTTTTGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
928970289 2:37021274-37021296 TTGTGAAATTACAGCTACCTGGG - Intronic
930381351 2:50634316-50634338 CTATGAAATTATACATATCTGGG + Intronic
934927932 2:98394822-98394844 ATGTGAAATTACAGCTATCTGGG - Intronic
937609920 2:123848829-123848851 CTGTGAAATTTACACTGTCTAGG + Intergenic
937658530 2:124404317-124404339 CAGTGAGATTACAAGTATCCCGG - Intronic
938912661 2:135899419-135899441 ATGTGAAGTTACAGCCATCTGGG - Intergenic
940110640 2:150148709-150148731 ATCTGCAATTACAACTTTCTAGG - Intergenic
940156429 2:150661698-150661720 CTGTGAAACAACCACTTTCTAGG + Intergenic
940340296 2:152573269-152573291 GTGAGAAATGACACCTATCTAGG + Intronic
940570236 2:155422829-155422851 ATATGAAATTACAACTAGATAGG - Intergenic
942082769 2:172416924-172416946 CTGTGGAAGTAAAGCTATCTTGG - Intergenic
942516575 2:176760222-176760244 CTCTCAAATTACAAGTATCCTGG + Intergenic
944095232 2:195958901-195958923 CAGAGTAATTACAACTGTCTGGG - Intronic
945712254 2:213312848-213312870 CAGTGCAGTTACAACTTTCTGGG + Intronic
947146507 2:227071001-227071023 CAATGAAAAGACAACTATCTGGG + Intronic
947163507 2:227238236-227238258 CAATTAAATTACAACTCTCTCGG + Intronic
947907259 2:233774427-233774449 CAGAGAAATTACTACTACCTGGG - Intergenic
948015263 2:234684211-234684233 ATGTGAAATTACAGCTCTCTGGG + Intergenic
948931502 2:241135202-241135224 ATGTTAAATTAAAACTATGTGGG + Intronic
1169494911 20:6106074-6106096 CTGTGAATTTGCAACTGTCCAGG - Intronic
1173504447 20:43575890-43575912 CTGAAAAATTACAACTCTCTTGG + Intronic
1185169953 22:49286997-49287019 CTGTGAAGTGACAGCTCTCTGGG - Intergenic
949901369 3:8817591-8817613 CTGTGAATTGCCAACTGTCTGGG + Intronic
950921369 3:16698059-16698081 TTGTGAAATTACAGCTATCTGGG + Intergenic
951132012 3:19058141-19058163 CTGGGAAATTGCAACTTCCTAGG - Intergenic
951230370 3:20171878-20171900 CTTTGAAGTTACACCTATATTGG + Intronic
957694498 3:83617647-83617669 AGGTGAAATTACAGCTATCTGGG + Intergenic
962525762 3:136236197-136236219 CTGTGAAGTTACATCTCTCTAGG - Intergenic
963730337 3:148965261-148965283 CTGTGAAATTGCAAGAATTTGGG + Intergenic
965619511 3:170628769-170628791 CTGTGAAATAAAAACTTTCTAGG + Intronic
972204738 4:36758478-36758500 TTGTGAAGTTACAGCTATCTGGG - Intergenic
972988443 4:44794180-44794202 CTGTGAAAATATAAATTTCTGGG - Intergenic
974737155 4:65951638-65951660 CTTTGACAATACAACTAGCTAGG - Intergenic
975002301 4:69239637-69239659 CTGTGAAATGACAACGCTCTCGG - Intergenic
975007589 4:69310087-69310109 CTGTCAAATGACAACCCTCTTGG + Intronic
976424701 4:84888751-84888773 CTGTCAAACTACAAATAGCTTGG + Intronic
979751273 4:124282030-124282052 CTGTGAAATTAGAATCATATGGG + Intergenic
980778258 4:137463963-137463985 CTGTGAAATGGCAACTCTTTTGG + Intergenic
981150111 4:141370710-141370732 CTGTGAAATTCTAAATAACTTGG - Intergenic
981474115 4:145170822-145170844 CTGTAAAAATCCAAGTATCTTGG - Intronic
982059474 4:151590001-151590023 CTGTGAAATTAGATCTCTGTTGG + Intronic
982656996 4:158162508-158162530 CAGTGAAATTACACCTTACTAGG - Intronic
983364986 4:166775083-166775105 AAGTGAAATTATGACTATCTGGG + Intronic
984609572 4:181822475-181822497 CTTTGAAATTACAAAAATGTAGG - Intergenic
985868463 5:2534828-2534850 CTGTGAGATTTCAGCTATCCTGG - Intergenic
987724000 5:21673830-21673852 CTCAGAAAATAAAACTATCTTGG - Intergenic
987856900 5:23431507-23431529 CTATGACTTTAGAACTATCTTGG + Intergenic
987860263 5:23477228-23477250 TTGTAAAATTACAGCTATTTGGG + Intergenic
988175705 5:27721992-27722014 CTGTGTAAGAACAACTATTTGGG - Intergenic
988963053 5:36388619-36388641 CACTGAAATTACTATTATCTTGG + Intergenic
989323390 5:40162488-40162510 CTGTGCCATTACAACTCTCTCGG - Intergenic
989702747 5:44289864-44289886 TTGTGAATCTACAAATATCTTGG + Intergenic
990171197 5:53051998-53052020 ATGTGAAATTATAACTATACAGG + Intronic
992155294 5:73949391-73949413 ATGTGAATTTATCACTATCTGGG + Intergenic
994667922 5:102729586-102729608 CTGTTAAAATGAAACTATCTTGG - Intergenic
997133270 5:131298550-131298572 CTGTGAATTCACCACTTTCTAGG + Intronic
997205420 5:132045698-132045720 TTGTGAAATTAACATTATCTAGG + Intergenic
1000688695 5:164287366-164287388 CTGTGAAAATACTGCTCTCTTGG - Intergenic
1000771143 5:165356116-165356138 CTATGAAATTACAATTACTTAGG - Intergenic
1001003725 5:168031383-168031405 CTCTGAAATTCCAAATAGCTAGG - Intronic
1001417446 5:171555911-171555933 CTGTGAAATTCTATCTACCTAGG - Intergenic
1005246206 6:23888144-23888166 CAGTGAATTTACAAATATGTGGG + Intergenic
1005271190 6:24165286-24165308 ATGTGAAATTACAGCTATCTGGG - Intergenic
1005568054 6:27116230-27116252 CTGTGAAAATACAACAACATGGG - Intergenic
1005890566 6:30134654-30134676 CTGTGAAATTACCATGATCCTGG - Intergenic
1007553564 6:42747400-42747422 CGGTGAAATTTCAAGTTTCTTGG - Intronic
1007965931 6:46003735-46003757 TTGTTAAATTACAGGTATCTGGG + Intronic
1008198273 6:48553339-48553361 CTGTGAAATTCCAATTTTATTGG - Intergenic
1009701330 6:67185755-67185777 CTTTGAAATTTGCACTATCTGGG + Intergenic
1012337089 6:98073605-98073627 CTGTGAACTCTTAACTATCTTGG - Intergenic
1014008496 6:116449307-116449329 CTGTATAATTACAACTATTCTGG - Intergenic
1014277829 6:119406350-119406372 ATGTGAAATTACAGCTGTTTGGG - Intergenic
1018284107 6:162218497-162218519 CTGTGCAAATCCACCTATCTGGG + Intronic
1018933954 6:168261097-168261119 CTGTGAAAATGAAACTATCTGGG - Intergenic
1019205505 6:170358384-170358406 CTGTGAAACTTCAACTATAATGG - Intronic
1020787189 7:12587999-12588021 CTTTTAAATTAAAACTATGTTGG + Intronic
1020916567 7:14201156-14201178 CAGTGAAAAGACAGCTATCTAGG - Intronic
1020940525 7:14528885-14528907 CTGTGATATGACAAATAACTTGG + Intronic
1025775724 7:64559142-64559164 ATGTGAAATTACAGCTGTTTGGG + Intronic
1026502617 7:70955992-70956014 ATGTGAAATTACAGCGGTCTGGG - Intergenic
1029360784 7:100087328-100087350 TTGTGGAATTACAGCTATCTGGG + Intergenic
1030098148 7:105919912-105919934 CTGTGACATGACATCAATCTTGG + Intronic
1030674436 7:112369871-112369893 ATGTGAAATTACAGCTATCTGGG + Intergenic
1032342741 7:131090943-131090965 ATGTGAAATTACAGCTGTTTGGG - Intergenic
1032344234 7:131105366-131105388 TTGTGAAATCACATCTATTTAGG - Intergenic
1033022371 7:137739322-137739344 CTGTGAAATCACATCTCCCTGGG + Intronic
1033076715 7:138256715-138256737 CTGTGAAACGACAACCCTCTTGG - Intergenic
1033357702 7:140613811-140613833 ATGTGAAATTACAGCTGTCGTGG - Intronic
1033561903 7:142540232-142540254 CTCTGAATTCACAACTTTCTGGG - Intergenic
1034120555 7:148623131-148623153 CTGTGAAAATACAGCCATGTGGG + Intergenic
1036440795 8:8780027-8780049 TTGTGAAATTACAGCTGTCTGGG - Intergenic
1037009296 8:13820715-13820737 ATATGAAATTACAGCTATCTGGG + Intergenic
1037015129 8:13895164-13895186 CTGTTCATTTACAATTATCTGGG + Intergenic
1037452183 8:19026306-19026328 CTGCCAAATTACAACATTCTAGG + Intronic
1038083458 8:24166391-24166413 CTCTGAAATTATAAATATCAAGG - Intergenic
1038387505 8:27162972-27162994 CTGTGAAACTACAATACTCTTGG + Intergenic
1039722285 8:40177007-40177029 TTGTGAAATTACAGCTATTTGGG + Intergenic
1042375888 8:68051547-68051569 CTGAGAAATTACAATAAACTGGG - Intronic
1043463612 8:80485615-80485637 CTGTGAAATGACTACTGTCCGGG + Intronic
1044044415 8:87413189-87413211 TTGTGAAATTACAGCTATCTGGG + Intronic
1046160588 8:110358141-110358163 CTGTAAAATCCCAACTACCTGGG + Intergenic
1046384725 8:113494330-113494352 CACTGAAAATACATCTATCTAGG + Intergenic
1050135826 9:2462672-2462694 CTTTACAATTACAACTATGTAGG - Intergenic
1052608403 9:30735471-30735493 ATATGAAAGTACAAATATCTGGG + Intergenic
1052785793 9:32827066-32827088 ATGCGAAATTACAGCTATCTGGG - Intergenic
1056614423 9:88151522-88151544 CTGTGAAGTTAGAACTGTCTTGG + Intergenic
1061474519 9:130855269-130855291 CTGTGATATTACAAGTTCCTGGG + Intronic
1186536181 X:10351067-10351089 CTGTGACATTCCAAATTTCTGGG + Intergenic
1188895666 X:35665515-35665537 TTGTGAAATTACAGCTATCTGGG - Intergenic
1189713449 X:43840143-43840165 GTGTGAAATCACAAATAACTAGG + Intronic
1194012747 X:88582901-88582923 CAGGGAACTCACAACTATCTGGG + Intergenic
1195303172 X:103552400-103552422 TTGTGAAATTACAGTTATCTGGG - Intergenic
1195309396 X:103616067-103616089 ATGTGAAATTACAGCTATTTGGG - Intronic
1197286019 X:124595945-124595967 CTGTAAAAATTCACCTATCTAGG + Intronic
1198004436 X:132478240-132478262 CACTGAAAATAAAACTATCTGGG - Intronic
1199447995 X:147947799-147947821 CTTTGAAATTACAACCATTTGGG + Intronic